Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2021 Aug 9;37(12):1069–1076. doi: 10.1002/kjm2.12431

Downregulation of miR‐29b‐3p aggravates podocyte injury by targeting HDAC4 in LPS‐induced acute kidney injury

Zong‐Lan Ha 1, Zi‐Ying Yu 2,✉
PMCID: PMC11896236  PMID: 34369661

Abstract

Sepsis is a severe organ dysfunction disease, usually accompanied by acute kidney injury (AKI). miR‐29b‐3p was inhibited in sepsis‐induced AKI, while its role in AKI was unclear. Therefore, this study determined the role of miR‐29b‐3p in sepsis‐induced AKI, and investigated its underlying mechanism. In this study, the AKI model was established through injecting with lipopolysaccharides (LPS) intraperitoneally. In LPS challenged mice, serum blood urea nitrogen and creatinine were increased, and renal tissues pathological damage was induced. Besides, miR‐29b‐3p was declined in LPS‐induced AKI mice and podocytes. In addition, HDAC4 was elevated in LPS‐treated podocytes. Furthermore, upregulated miR‐29b‐3p attenuated LPS‐induced mice podocyte injury, and HDAC4 was identified as a direct target of miR‐29b‐3p. Moreover, overexpression of miR‐29b‐3p attenuated LPS‐induced AKI in mice. In conclusion, miR‐29b‐3p was inhibited in LPS‐induced AKI. Downregulation of miR‐29b‐3p aggravated podocyte injury through targeting HDAC4 in LPS‐induced AKI. miR‐29b‐3p may act as a valuable target for AKI therapy.

Keywords: acute kidney injury, HDAC4, LPS, miR‐29b‐3p, sepsis

1. INTRODUCTION

Sepsis is an organ dysfunction disease triggered by the dysregulated host response to bacterial, viral, or fungal infections. 1 , 2 At present, sepsis is considered as the major cause of death in intensive care units (ICU). Sepsis is characterized by the excessive production of various inflammatory mediators, resulting in extensive cell and tissue damage. 3 The kidney is the most vulnerable organ in the process of sepsis. 4 Studies reported that over 50% of sepsis patients are accompanied by acute kidney injury (AKI). 2 , 5 Besides, the mortality of sepsis patients with AKI is higher than that of patients with AKI alone. 1 , 6 Therefore, it is a severe threat to public health. Thus, it is essential to investigate the sepsis‐induced AKI mechanism and search for practical AKI treatment strategies after sepsis.

Podocytes are terminally differentiated epithelial cells in the kidney. 7 , 8 Podocytes are attached to the outside of the glomerular basement membrane, which is vital for glomerular filtration to filter proteins and other molecules. 7 Podocyte injury is the primary cause of glomerular disease. 8 , 9 Recent studies have also revealed that podocyte injury was involved in the sepsis‐induced AKI. 10 , 11 For example, Senouthai et al. reported that podocyte injury induced by LPS contributed to the pathogenesis of AKI. 10 Therefore, the regulation of podocyte injury may be helpful for the treatment of AKI after sepsis.

MicroRNAs (miRNAs) belong to the small noncoding RNAs family with 18–25 nt in length. miRNAs exert post‐transcriptional regulation function through binding to target genes. 12 Increasing evidence revealed that miRNAs participate in the regulation of induced AKI. 13 , 14 For instance, Huang et al. found that miR‐129‐5p attenuated LPS‐induced AKI through targeting HMGB1/TLRs/NF‐kappaB pathway. 13 The study performed by Ma et al. showed that miR‐590‐3p alleviated AKI through inhibiting tumor necrosis factor receptor‐associated factor 6 (TRAF6) in mice with sepsis. 14 As a member of the miRNAs family, miR‐29b‐3p was suppressed in the AKI model triggered by sepsis. 15 Besides, the role of miR‐29b‐3p in myocardial protection and intestinal ischemia/reperfusion injury were proved. 16 , 17 Nevertheless, the influence of miR‐29b‐3p on sepsis‐induced AKI remains unclear. Therefore, this study determined the effects of miR‐29b‐3p on sepsis‐induced AKI and podocytes injury and explored its mechanism.

2. MATERIALS AND METHODS

2.1. Animals

BALB/c male mice aged 8–10 weeks were acquired from Beijing Laboratory Animal Research Center (Beijing, China). Total mice were separated into the Control group, LPS group, LPS + NC agomir group, and LPS + miR‐29b‐3p agomir group. To induce the AKI model, the mice in LPS group were injected with 20 mg/kg of LPS (Sigma, St. Louis, MO, United States) intraperitoneally. The control mice were treated with isochoric vehicle. The mice in the LPS + NC agomir group were injected with 80 mg/kg negative control agomir (RiboBio, Guangzhou, China) daily via caudal vein for 3 days, and then injected with 20 mg/kg of LPS intraperitoneally after the last agomir administration. The mice in the LPS + miR‐29b‐3p agomir group were injected with 80 mg/kg miR‐29b‐3p agomir (RiboBio, Guangzhou, China) daily via caudal vein for 3 days, and then injected with 20 mg/kg of LPS intraperitoneally after the last agomir administration. 18 After 24 h of LPS challenge, the renal tissues and blood samples of all mice were harvested.

The experiments were conducted complying with national and international regulations and policies. The study was permitted by Committee of Animal Experimentation of XXX Hospital.

2.2. Detection of blood urea nitrogen and creatinine

The blood samples were harvested to determine the levels of blood urea nitrogen (BUN) and creatinine in mice. According to the manufacturers' protocols. The levels of BUN (MyBioSource, CA, United States) and creatinine (BioVision, Inc., Milpitas, CA, United States) were determined using the commercial kits.

2.3. Detection of urinary albumin/creatinine ratio

The urine samples were collected to detect the urinary creatinine and albumin. The levels of urinary creatinine (BioVision, Inc., Milpitas, CA, United States) and albumin (Abcam, Cambridge, MA, United Kingdom) were determined using the commercial kits following the manufacturers' protocols. The results were presented as the urinary albumin/creatinine ratio (UACR).

2.4. HE staining

Mice kidneys were resected and fixed using 10% formalin and embedded using paraffin. After the 5 μm slices were made, the samples were dyed with hematoxylin and eosin, following by analyzed under a light microscope (Olympus, Japan). Histology score assessed by two senior pathologists.

2.5. Quantitative real‐time polymerase chain reaction

Quantification of miR‐29b‐3p was conducted by quantitative real‐time polymerase chain reaction (qRT‐PCR). After RNA was obtained through employing TRIzol (Sigma, St. Louis, MO, United States), cDNA was generated utilizing the cDNA Synthesis Kit (Sigma, St. Louis, MO, United States) according to the manufacturer's protocols. QPCR assay was then performed utilizing SYBR Green Master Mix (Thermo Fisher Scientific, Waltham, MA, United States) on the ABI PRISM7500 system. The primers of miR‐29b‐3p used in the study were: F, 5′‐TCAGGAAGCTGGTTTCATATGGT‐3′; R, 5′‐CCCCCAAGAACACTGATTTCAA‐3′ 19 ; HDAC4: F, 5′‐CACGAGCACATCAAGCAACAA‐3′; R, 5′‐CAGTGGTTCAGATTCCGGTGG‐3′. 20 The relative expression miR‐29b‐3p was determined by 2−ΔΔCt method.

2.6. Cell culture

Mouse podocytes cells MPC5 were bought from the Cell Bank of the Chinese academy of sciences (Shanghai, China). MPC5 cells were grown in collagen I‐coated dishes in RPMI‐1640 medium containing 10% FBS and 20 U/ml of recombinant mouse IFN‐γ at 33°C. For MPC5 cell differentiation, the medium was changed to RPMI‐1640 medium with 5% FBS without IFN‐γ, and the cells were moved to 37°C for 10 days. 21 , 22

In designated experiments, the differentiated MPC5 cells were exposed to LPS (1, 5 and 10 μg/ml) for 48 h or transfected with miR‐29b‐3p mimic (RiboBio, Guangzhou, China) using Lipofectamine 3000 (Thermo Scientific, Waltham, MA, United States) following the manufacturer's protocols.

2.7. 3‐(4,5‐Dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide assay

MPC5 cell viability was evaluated using 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) assay (Sigma, St. Louis, MO, United States). MPC5 cells were plated into 96‐wells plates for 24 h at 37°C, following by treated with 20 μl MTT for 4 h. Afterward, the cells were treated with 100 μl dimethyl sulfoxide (DMSO). The microplate reader was employed to record the absorbance at 490 nm.

2.8. Flow cytometry

Annexin V‐FITC Apoptosis Detection Kit (Sigma, St. Louis, MO, United States) was used to determine the cell apoptosis following the manufacturer's protocols. Briefly, MPC5 cells were collected and washed in PBS buffer. The cells were then resuspended using binding buffer and dyed with Annexin‐V and PI at no light environment for 15 min. Last, the stained cells were quantified using Flow Cytometry (BD, San Jose, CA, United States).

2.9. Western blot

Proteins were extracted using RIPA (Beyotime, Shanghai, China) and quantified with the BCA method. Then, lysates were separated by SDS‐PAGE, followed by transfer onto PVDF membranes. After obstructed nonspecific epitopes, the membranes were probed with anti‐HDAC4 (1:500) and anti‐GAPDH (1:1000) antibodies (Abcam, Cambridge, MA, United Kingdom) at 4°C overnight, and incubated with secondary antibody IgG H&L (HRP) (1:2000, Abcam, Cambridge, MA, United Kingdom). The blots were visualized using the ECL Plus Western Blotting Substrate (Thermo Fisher Scientific, Waltham, MA, United States).

2.10. Luciferase assay

The wild type and mutant fragments of 3′‐UTR HDAC4 targeting of miR‐29b‐3p were constructed into the psiCHECK‐2 vector (Promega, Madison, WI, United States), respectively. The fused psiCHECK‐2 vector, miR‐29b‐3p mimic and inhibitor (RiboBio, Guangzhou, China) were transfected into HEK293 cells utilizing Lipofectamine 3000. Forty‐eight hours later, the cells were harvested to determine the relative luciferase activity by the Dual‐luciferase reporter assay system (RiboBio, Guangzhou, China).

2.11. Statistical analysis

All data were displayed as mean ± SD. Date analysis was realized by SPSS Statistics 22.0 (SPSS, Chicago, IL, United States) using Student's t test or one‐way analysis of variance. All experiments were conducted at least three times. p < 0.05 was regarded as a principle of statistical significance.

3. RESULTS

3.1. miR‐29b‐3p was decreased in LPS‐induced AKI mice

To determine the effect of miR‐29b‐3p on AKI, the AKI mouse model was established by LPS. In the LPS treated AKI mice, serum BUN and creatinine levels were significantly elevated compared with control mice (p < 0.01, Figure 1A,B). Besides, UACR was increased in the LPS‐induced AKI mice (p < 0.01, Figure 1C). In addition, HE staining results presented that LPS challenge caused renal tissues pathological damage such as edema of renal tubular epithelial cells and renal interstitial epithelial cells (p < 0.01, Figure 1D,E). Furthermore, miR‐29b‐3p expression in the LPS‐induced AKI mice was detected. miR‐29b‐3p was significantly decreased in serum and renal tissues of mice treated by LPS (p < 0.01, Figure 1F,G). Therefore, these results showed that miR‐29b‐3p was decreased in the LPS‐induced AKI mice.

FIGURE 1.

FIGURE 1

Open in a new tab

miR‐29b‐3p was down‐regulated in the LPS‐induced AKI mice model. (A) Serum level of BUN was determined in LPS‐induced AKI mice. (B) Serum level of creatinine was detected in LPS‐induced AKI mice. (C) Urinary albumin/creatinine ratio (UACR) was determined in LPS‐induced AKI mice. (D) The pathological damage of renal tissues in LPS‐induced AKI mice was evaluated using HE staining. (E) The tissue injury score of renal tissues in LPS‐induced AKI mice was determined. (F) The expression of miR‐29b‐3p in the serum of LPS‐induced AKI mice was determined using qRT‐PCR. (G) The expression of miR‐29b‐3p in renal tissues of LPS‐induced AKI mice was determined using qRT‐PCR. **p < 0.01 compared to control group

3.2. miR‐29b‐3p was downregulated and HDAC4 was upregulated in LPS‐induced podocytes

In vitro experiments were conducted to determine the miR‐29b‐3p expression in LPS‐treated podocytes MPC5 cells. First, MPC5 cells underwent in vitro differentiation, which was verified by the increased synaptopodin (Figure S1A). Then, MPC5 cells were treated by LPS (1, 5 and 10 μg/ml). The morphological changes of MPC5 cells after LPS stimulation was presented in Figure S1B. Results showed that LPS (1, 5 and 10 μg/ml) dose‐dependently decreased MPC5 cell viability (all p < 0.01, Figure 2A). Besides, LPS exposure induced MPC5 cell apoptosis in a dose‐dependent manner (all p < 0.01, Figure 2B). Furthermore, miR‐29b‐3p was significantly decreased in LPS‐treated MPC5 cells (all p < 0.05, Figure 2C). HDAC4 was demonstrated to play important roles in AKI through promoting podocyte injury. Therefore, the HDAC4 level in LPS‐treated podocytes was determined. It was observed that the protein level of HDAC4 was elevated in MPC5 cells after LPS exposure (all p < 0.05, Figure 2D). Thus, miR‐29b‐3p was decreased, and HDAC4 was elevated in LPS‐induced podocytes.

FIGURE 2.

FIGURE 2

Open in a new tab

miR‐29b‐3p was down‐regulated, and HDAC4 was up‐regulated in LPS‐induced podocytes. (A) MTT assay was used to detect the viability of LPS ‐treated MPC5 cells. (B) The apoptosis of LPS‐treated MPC5 cells was measured by flow cytometry. (C) The expression of miR‐29b‐3p in LPS‐treated MPC5 cells was analyzed using qRT‐PCR. (D) The protein level of HDAC4 in LPS‐treated MPC5 cells was determined by western blot. *p < 0.05; **p < 0.01 compared to control group. LPS‐1: 1 μg/ml LPS. LPS‐5: 5 μg/ml LPS. PS‐10: 10 μg/ml LPS

3.3. Overexpressed miR‐29b‐3p attenuated LPS‐induced mice podocyte injury

To investigate the action of miR‐29b‐3p on LPS‐induced podocyte injury, miR‐29b‐3p mimic was introduced into mouse podocyte MPC5 cells. miR‐29b‐3p mimic considerably elevated miR‐29b‐3p expression (p < 0.01, Figure 3A). MTT assay revealed that the decreased MPC5 cell viability caused by 10 μg/ml of LPS exposure was reversed by overexpression of miR‐29b‐3p (p < 0.05, Figure 3B). Besides, MPC5 cell apoptosis induced by 10 μg/ml of LPS was suppressed by overexpression of miR‐29b‐3p (p < 0.01, Figure 3C). Furthermore, LPS‐induced increase in HDAC4 protein level was suppressed miR‐29b‐3p mimic (p < 0.01, Figure 3D). Hence, overexpressed miR‐29b‐3p attenuated 10 μg/ml of LPS‐induced mice podocyte injury.

FIGURE 3.

FIGURE 3

Open in a new tab

Overexpression of miR‐29b‐3p attenuated LPS‐induced mice podocyte injury. (A) The expression of miR‐29b‐3p in MPC5 cells transfected with miR‐29b‐3p mimic was analyzed using qRT‐PCR. (B) The viability of 10 μg/ml of LPS‐treated MPC5 cells with miR‐29b‐3p overexpression was determined by MTT assay. (C) The apoptosis of 10 μg/ml of LPS‐treated MPC5 cells with miR‐29b‐3p overexpression was measured using flow cytometry. (D) The protein level of HDAC4 in 10 μg/ml of LPS‐treated MPC5 cells with miR‐29b‐3p overexpression was determined by western blot. **p < 0.01 compared to NC mimic group. @p < 0.05; @@p < 0.01 compared to LPS + NC mimic group

3.4. HDAC4 was a direct target of miR‐29b‐3p

miRNAs usually exert roles via binding to target mRNAs. Therefore, bioinformatics analysis was performed to screen the potential targets of miR‐29b‐3p in the Targetscan database (http//www.targetscan.org). Results suggested that HDAC4 might be a potential target of miR‐29b‐3p, and the putative binding sequences were presented in Figure 4A. To better study the relationship between miR‐29b‐3p and HDAC4, luciferase assay was conducted. It was observed that miR‐29b‐3p mimic greatly inhibited the activity of HDAC4‐WT reporter but had no effect on HDAC4‐MUT reporter (p < 0.01, Figure 4B). Contrarily, miR‐29b‐3p inhibitor significantly promoted the activity of wild 3′‐UTR of HDAC4 reporter but did not affect 3′‐UTR of HDAC4 reporter (p < 0.01, Figure 4B). Besides, miR‐29b‐3p mimic suppressed the HDAC4 protein level (p < 0.01), but miR‐29b‐3p inhibitor increased the level of HDAC4 in MPC5 cells (p < 0.05, Figure 4C). Moreover, the protein level of HDAC4 was increased in renal tissues of AKI mice (p < 0.01, Figure 4D). Collectively, these data revealed that HDAC4 was a target of miR‐29b‐3p.

FIGURE 4.

FIGURE 4

Open in a new tab

HDAC4 was a direct target of miR‐29b‐3p. (A) The putative binding sites of miR‐29b‐3p and HDAC4 were shown. (B) Luciferase assay was conducted to verify the relationship between miR‐29b‐3p and HDAC4. (C) Western blot was performed to detect the level of HDAC4 in MPC5 cells transfected with miR‐29b‐3p mimic or inhibitor. (D) The protein level of HDAC4 in renal tissues of LPS‐induced AKI mice was determined using western blot. **p < 0.01 compared to NC mimic group or control group. @p < 0.05 compared to the NC inhibitor group

3.5. Overexpression of miR‐29b‐3p attenuated LPS‐induced AKI in mice

To better investigate the influence of miR‐29b‐3p on AKI injury caused by LPS, the mice were intraperitoneally injected with miR‐29b‐3p agomir to elevate miR‐29b‐3p expression before LPS exposure. It was observed that overexpression of miR‐29b‐3p suppressed the LPS‐induced serum BUN and creatinine levels in mice (all p < 0.01, Figure 5A,B). Besides, the elevated UACR induced by LPS was decreased by miR‐29b‐3p agomir (p < 0.01, Figure 5C). The renal tissue pathological damage caused by LPS challenge was attenuated by miR‐29b‐3p agomir (p < 0.01, Figure 5D,E). In addition, miR‐29b‐3p agomir administration increased miR‐29b‐3p level in serum and renal tissues of LPS‐induced AKI mice (all p < 0.01, Figure 5F,G). Moreover, overexpressed miR‐29b‐3p suppressed the LPS‐induced HDAC4 protein level in renal tissues of AKI mice, while had no effects on the mRNA level of HDAC4 (p < 0.01, Figure 5H,I). Taken together, overexpressed miR‐29b‐3p attenuated LPS‐induced AKI.

FIGURE 5.

FIGURE 5

Open in a new tab

Overexpression of miR‐29b‐3p attenuated LPS‐induced AKI in mice. (A) Serum level of BUN was determined in LPS‐induced AKI mice with miR‐29b‐3p overexpression. (B) Serum level of creatinine was detected in LPS‐induced AKI mice with miR‐29b‐3p overexpression. (C) Urinary albumin/creatinine ratio (UACR) was determined in LPS‐induced AKI mice with miR‐29b‐3p overexpression. (D) The pathological damage of renal tissues in LPS‐induced AKI mice with miR‐29b‐3p overexpression was evaluated using HE staining. (E) The tissue injury score of renal tissues in LPS‐induced AKI mice with miR‐29b‐3p overexpression was determined. (F) The expression of miR‐29b‐3p in the serum of LPS‐induced AKI mice with miR‐29b‐3p overexpression was determined using qRT‐PCR. (G) The expression of miR‐29b‐3p in renal tissues of LPS‐induced AKI mice with miR‐29b‐3p overexpression was determined using qRT‐PCR. (H) The protein level of HDAC4 in renal tissues of LPS‐induced AKI mice with miR‐29b‐3p overexpression was determined by western blot. (I) The mRNA expression of HDAC4 in renal tissues of LPS‐induced AKI mice with miR‐29b‐3p overexpression was determined by qRT‐PCR. **p < 0.01 compared to control group. @@p < 0.01 compared to LPS + NC agomir group

4. DISCUSSION

Sepsis is a severe organ dysfunction disease triggered by a dysregulated host response to infection. 1 , 2 The kidney is the most vulnerable organ after sepsis with high mortality. 1 , 6 Over 50% of patients with sepsis are accompanied by AKI. 2 , 5 Therefore, it is imperative to elucidate the underlying mechanism of AKI caused by sepsis and explore practical strategies for the disease. Therefore, this study determined the effect of miR‐29b‐3p on sepsis‐induced AKI and podocytes injury, and explored its underlying mechanism.

To simulate sepsis‐induced AKI, the mice underwent an LPS challenge to induce the AKI model. BUN and creatinine were considered as two primary indicators of kidney dysfunction. 23 Besides, the renal tissue pathological damage was induced by LPS in this study. These findings suggested that LPS successfully induced AKI in mice.

Previous study reported that miR‐29b‐3p was downregulated in the sepsis‐induced AKI model. 15 To determine the effects of miR‐29b‐3p on AKI, we first determined the expression of miR‐29b‐3p in serum and renal tissues of LPS‐induced AKI mice. The expression of miR‐29b‐3p in serum and renal tissues of AKI mice was decreased, which was consistent with the study conducted by Xu et al. 15 Furthermore, we found that LPS induced podocyte injury, and the expression of miR‐29b‐3p in LPS‐induced podocytes were also decreased. The extensive experiments revealed that overexpression of miR‐29b‐3p attenuated LPS‐induced podocyte injury. Moreover, this study revealed that elevated miR‐29b‐3p attenuated LPS‐induced AKI in mice in vivo. These in vivo results implied the potential of miR‐29b‐3p in AKI therapy in the future. The role of miR‐29b‐3p in the modulation of LPS‐induced AKI and podocyte injury has not been reported. This study for the first time reported elevated miR‐29b‐3p suppressed LPS‐induced AKI and podocyte injury.

Furthermore, we found that HDAC4 was increased in LPS‐induced podocytes, which was similar to the results in the podocytes of diabetic nephropathy. 24 Besides, elevated miR‐29b‐3p suppressed the level of HDAC4. The negative regulation relationship between miR‐29b‐3p and HDAC4 implied that HDAC4 might be a target of miR‐29b‐3p. Further results suggested that HDAC4 was a direct target of miR‐29b‐3p. Similar results have been concluded by previous study. 25 They found that miR‐29b‐3p negatively modulated the target gene HDAC4 level to mediate multiple myeloma progression. 25 HDAC4 is a member of histone deacetylases (HDACs). Recent studies reported that HDAC4 was involved in podocyte injury. 24 , 26 Wang et al. showed that high glucose and TGF‐β1 stimulation promoted the level of HDAC4 in podocytes, which was related to the impairment of podocytes in diabetic nephropathy. 24 Moreover, a study revealed that miR‐29b attenuated HDAC4 mediated podocyte dysfunction and renal fibrosis in diabetic nephropathy. 27 These findings suggested that the regulatory mechanism of miR‐29b‐3p on LPS‐induced AKI and podocyte injury might be mediated by HDAC4.

However, the expression level of HDAC was still high after miR‐29b‐3p increased 80‐fold in this study. This suggested that HDAC4 might also be regulated by other molecules or signaling pathways, which would be explored in the future study.

There were still some limitations in this study. The level of miR‐29b‐3p in human sepsis‐induced AKI was not explored in this study, which will be investigated in our future study. In addition, the conclusions in this study were obtained from preclinical animal and cell experiments, which could not be transferred to human samples directly.

5. CONCLUSION

miR‐29b‐3p was downregulated in LPS‐induced AKI. Downregulation of miR‐29b‐3p aggravated podocyte injury through targeting HDAC4 in LPS‐induced AKI. miR‐29b‐3p may act as a valuable target for AKI therapy.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Supporting information

Figure S1 Identification of podocyte differentiation. A. The protein expression of synaptopodin in differentiated podocytes was determined by western blot. B. The morphological changes of podocytes MPC5 after LPS stimulation. **p < 0.01.

KJM2-37-1069-s001.jpg (1.4MB, jpg)

Ha Z‐L, Yu Z‐Y. Downregulation of miR‐29b‐3p aggravates podocyte injury by targeting HDAC4 in LPS‐induced acute kidney injury. Kaohsiung J Med Sci. 2021;37:1069–1076. 10.1002/kjm2.12431

Funding information Subject of Hunan Provincial Health Commission, Grant/Award Number: 202110000210

REFERENCES

  • 1. Feng LX, Zhao F, Liu Q, Peng JC, Duan XJ, Yan P, et al. Role of Nrf2 in lipopolysaccharide‐induced acute kidney injury: protection by human umbilical cord blood mononuclear cells. Oxid Med Cell Longev. 2020;2020:6123459. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Li K, Liu TX, Li JF, Ma YR, Liu ML, Wang YQ, et al. rhEPO inhibited cell apoptosis to alleviate acute kidney injury in sepsis by AMPK/SIRT1 activated autophagy. Biochem Biophys Res Commun. 2019;517(4):557–65. [DOI] [PubMed] [Google Scholar]
  • 3. Hotchkiss RS, Moldawer LL, Opal SM, Reinhart K, Turnbull IR, Vincent JL. Sepsis and septic shock. Nat Rev Dis Primers. 2016;2(1):1–21. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Caraballo C, Jaimes F. Focus: death: organ dysfunction in sepsis: an ominous trajectory from infection to death. Yale J Biol Med. 2019;92(4):629–40. [PMC free article] [PubMed] [Google Scholar]
  • 5. Heeg M, Mertens A, Ellenberger D, Müller GA, Patschan D. Prognosis of AKI in malignant diseases with and without sepsis. BMC Anesthesiol. 2013;13(1):36. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Plataki M, Kashani K, Cabello‐Garza J, Maldonado F, Kashyap R, Kor DJ, et al. Predictors of acute kidney injury in septic shock patients: an observational cohort study. Clin J Am Soc Nephrol. 2011;6(7):1744–51. [DOI] [PubMed] [Google Scholar]
  • 7. Reiser J, Altintas MM. Podocytes. F1000Res. 2016;5:F1000. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Hanamura K, Tojo A, Fujita T. Urinary and glomerular podocytes in patients with chronic kidney diseases. Clin Exp Nephrol. 2014;18(1):95–103. [DOI] [PubMed] [Google Scholar]
  • 9. Wang Y, Yu F, Song D, Wang SX, Zhao MH. Podocyte involvement in lupus nephritis based on the 2003 ISN/RPS system: a large cohort study from a single centre. Rheumatology (Oxford). 2014;53(7):1235–44. [DOI] [PubMed] [Google Scholar]
  • 10. Senouthai S, Wang J, Fu D, You Y. Fractalkine is involved in lipopolysaccharide‐induced podocyte injury through the Wnt/β‐catenin pathway in an acute kidney injury mouse model. Inflammation. 2019;42(4):1287–300. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Bettaieb A, Koike S, Chahed S, Zhao Y, Bachaalany S, Hashoush N, et al. Podocyte‐specific soluble epoxide hydrolase deficiency in mice attenuates acute kidney injury. FEBS J. 2017;284(13):1970–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136(2):215–33. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Huang X, Hou X, Chuan L, Wei S, Wang J, Yang X, et al. miR‐129‐5p alleviates LPS‐induced acute kidney injury via targeting HMGB1/TLRs/NF‐kappaB pathway. Int Immunopharmacol. 2020;89(Pt A):107016. [DOI] [PubMed] [Google Scholar]
  • 14. Ma J, Li YT, Zhang SX, Fu SZ, Ye XZ. MiR‐590‐3p attenuates acute kidney injury by inhibiting tumor necrosis factor receptor‐associated factor 6 in septic mice. Inflammation. 2019;42(2):637–49. [DOI] [PubMed] [Google Scholar]
  • 15. Xu G, Mo L, Wu C, Shen X, Dong H, Yu L, et al. The miR‐15a‐5p‐XIST‐CUL3 regulatory axis is important for sepsis‐induced acute kidney injury. Ren Fail. 2019;41(1):955–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Cai Y, Li Y. Upregulation of miR‐29b‐3p protects cardiomyocytes from hypoxia‐induced apoptosis by targeting TRAF5. Cell Mol Biol Lett. 2019;24:27. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Dai Y, Mao Z, Han X, Xu Y, Xu L, Yin L, et al. MicroRNA‐29b‐3p reduces intestinal ischaemia/reperfusion injury via targeting of TNF receptor‐associated factor 3. Br J Pharmacol. 2019;176(17):3264–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Liu Y, Guan H, Zhang JL, Zheng Z, Wang HT, Tao K, et al. Acute downregulation of miR‐199a attenuates sepsis‐induced acute lung injury by targeting SIRT1. Am J Physiol Cell Physiol. 2018;314(4):C449–55. [DOI] [PubMed] [Google Scholar]
  • 19. Yang X, Xin N, Qu HJ, Wei L, Han Z. Long noncoding RNA TUG1 facilitates cell ovarian cancer progression through targeting MiR‐29b‐3p/MDM2 axis. Anat Rec (Hoboken). 2020;303(12):3024–34. [DOI] [PubMed] [Google Scholar]
  • 20. Sun Y, Qin B. Long noncoding RNA MALAT1 regulates HDAC4‐mediated proliferation and apoptosis via decoying of miR‐140‐5p in osteosarcoma cells. Cancer Med. 2018;7(9):4584–97. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Yang S, Liu L, Xu P, Yang Z. MKL1 inhibits cell cycle progression through p21 in podocytes. BMC Mol Biol. 2015;16(1):1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Wang X, Gao L, Lin H, Song J, Wang J, Yin Y, et al. Mangiferin prevents diabetic nephropathy progression and protects podocyte function via autophagy in diabetic rat glomeruli. Eur J Pharmacol. 2018;824:170–8. [DOI] [PubMed] [Google Scholar]
  • 23. Andres‐Hernando A, Altmann C, Bhargava R, Okamura K, Bacalja J, Hunter B, et al. Prolonged acute kidney injury exacerbates lung inflammation at 7 days post‐acute kidney injury. Physiol Rep. 2014;2(7):e12084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Wang X, Liu J, Zhen J, Zhang C, Wan Q, Liu G, et al. Histone deacetylase 4 selectively contributes to podocyte injury in diabetic nephropathy. Kidney Int. 2014;86(4):712–25. [DOI] [PubMed] [Google Scholar]
  • 25. Liu D, Wang J, Liu M. Long noncoding RNA TUG1 promotes proliferation and inhibits apoptosis in multiple myeloma by inhibiting miR‐29b‐3p. Biosci Rep. 2019;39(3):BSR20182489. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 26. Lin CL, Lee PH, Hsu YC, Lei CC, Ko JY, Chuang PC, et al. MicroRNA‐29a promotion of nephrin acetylation ameliorates hyperglycemia‐induced podocyte dysfunction. J Am Soc Nephrol. 2014;25(8):1698–709. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Gondaliya P, Dasare AP, Jash K, Tekade RK, Srivastava A, Kalia K. miR‐29b attenuates histone deacetylase‐4 mediated podocyte dysfunction and renal fibrosis in diabetic nephropathy. J Diabetes Metab Disord. 2019;19(1):13–27. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1 Identification of podocyte differentiation. A. The protein expression of synaptopodin in differentiated podocytes was determined by western blot. B. The morphological changes of podocytes MPC5 after LPS stimulation. **p < 0.01.

KJM2-37-1069-s001.jpg (1.4MB, jpg)

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES