Skip to main content
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2020 Mar 20;36(7):501–507. doi: 10.1002/kjm2.12204

Inhibiting ubiquitin conjugating enzyme E2 N by microRNA‐590‐3p reduced cell growth of cervical carcinoma

Ting‐Ting Song 1, Fei Xu 1, Wei Wang 1,
PMCID: PMC11896263  PMID: 32196955

Abstract

The ubiquitin conjugating enzyme E2 N (UBE2N) has been reported to be involved in the tumorigenesis of several tumors, but its function in cervical carcinoma has not been investigated yet. In the present study, UBE2N was found elevated in cervical carcinoma, and patients with high UBE2N had a shorter overall survival than patients with low expression. Additionally, knockdown of UBE2N decreased the activation of MEK1/2 and p38 in cervical carcinoma cells, and UBE2N knockdown also markedly inhibited cervical carcinoma cell growth. Our further studies found that microRNA‐590‐3p (miR‐590‐3p) was significantly decreased in cervical carcinoma, and patients with high miR‐590‐3p had a longer overall survival than patients with low expression. Moreover, miR‐590‐3p expression was found negatively correlated with UBE2N expression in cervical carcinoma, and our further studies showed that miR‐590‐3p targeted UBE2N and inhibited its expression in cervical carcinoma. Overexpression of miR‐590‐3p could inhibit cervical carcinoma cell growth, but enhanced UBE2N could rescue miR‐590‐3p‐induced cell growth inhibition in cervical carcinoma. This study indicated that targeting miR‐590‐3p/UBE2N axis could be a potential strategy for the treatment of cervical carcinoma.

Keywords: cell growth, cervical carcinoma, microRNA‐590‐3p, target, UBE2N

1. INTRODUCTION

Cervical carcinoma is one of the most common gynecological malignancies in the world, which is mainly caused by human papillomavirus infection.1 According to the pathological types, cervical cancer mainly includes squamous cell carcinoma, adenocarcinoma, and adenosquamous cell carcinoma.2 In clinical practice, cervical cancer is mainly treated by surgery, radiotherapy, or chemotherapy.3 In recent years, cervical cytology screening has been widely used in clinic, which makes early detection and treatment of cervical cancer and precancerous lesions, and the incidence and mortality of cervical cancer have been significantly reduced.4 However, its incidence tends to be younger in recent years.5 Therefore, it is still urgent to study its pathogenesis for clinical diagnosis and treatment of cervical carcinoma.

The ubiquitin conjugating enzyme E2 N (UBE2N), also known as Ubc13, is a member of the E2 ubiquitin‐conjugating enzyme family.6 It has been proved that UBE2N heterodimerized with UBE2V1 and UBE2V2, and the heterodimers catalyzed the synthesis of non‐canonical lysine‐63‐linked polyubiquitin chains, which did not lead to proteasome‐dependent protein degradation, but mediated target genes' transcriptional activation.7 And a recent paper found that a tri‐ionic motif provided optimally distributed anchor points that allowed TRIM ligases to wrap an UBE2N‐Ub complex around their RING domains.8 It has been also reported that UBE2N played significant roles in several tumors. UBE2N was identified as an important factor that preserved genomic stability and also played a significant role in the development of colorectal cancer.9 In malignant melanoma, UBE2N was found highly expressed, and UBE2N knockdown markedly inhibited cell proliferation and subcutaneous tumor growth of melanoma by suppressing MEK/FRA1/SOX10 signaling.10 UBE2N was also found necessary for the activation of non‐SMAD signaling via TAK1 and p38 in breast cancer, and UBE2N acted by activating p38α through MAPK3 and TAK1 to induce the metastasis of breast cancer.11

In this study, UBE2N was found elevated in cervical carcinoma, and knockdown of UBE2N markedly suppressed cell growth of cervical carcinoma. We also found that miR‐590‐3p was downregulated in cervical carcinoma and negatively correlated with UBE2N expression. And our further studies showed that miR‐590‐3p targeted UBE2N and inhibited its expression in cervical carcinoma cells. Targeting miR‐590‐3p/UBE2N axis could be as a potential strategy for the treatment of cervical carcinoma.

2. MATERIALS AND METHODS

2.1. Cells, tissues, and cell culture

HeLa, SiHa, and HEK293T were purchased from ATCC (Manassas). HeLa and SiHa cells were cultured in RPMI 1640 medium (Hyclone), and HEK293T cells were cultured in Dulbecco's modification of Eagle's medium (DMEM) (Hyclone). All the media contains 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. The patient samples were collected from Weifang Maternal and Child Health Hospital. The collection and use of human tissues were approved by the Institutional Review Board of Weifang Maternal and Child Health Hospital.

2.2. Quantitative real‐time polymerase chain reaction

The quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed to evaluate UBE2N expression using NovoStartSYBR qPCR SuperMix (Novoprotein, Shanghai, China). Primers used were as follows: UBE2N, forward 5'‐ATCATCAAGGAAACCCAG‐3′ and reverse 5'‐AAGTCCCTCCCTCAAAGG‐3′; GAPDH, forward 5'‐GCACCGTCAAGGCTGAGAAC‐3′ and reverse 5'‐TGGTGAAGACGCCAGTGGA‐3′.

To evaluate miR‐590‐3p expression, qRT‐PCR was used. MicroRNA (miRNA) qRT‐PCR primer sets specific for miR‐590‐3p were synthesized from Shanghai GeneChem (Shanghai, China). Total RNA was extracted using MiRNeasy Mini Kit, and the miRNA bulge‐loop was reverse‐transcribed with the Quantscript RT Kit (QIAGEN, Germany). U6 was used as an internal control.

2.3. Plasmids construction and gene transfection

The miR‐590‐3p mimics and the control were synthesized from Shanghai GeneChem (Shanghai, China). The human UBE2N gene was amplified by PCR, and subcloned into pcDNA3.1 vector with a Myc tag. Cervical carcinoma cells were transfected with miRNAs or plasmids by Lipofectamine2000 (Invitrogen) according to the manufacturer's instruction.

2.4. Lentivirus construction and infection

The lentivirus‐delivered shRNAs against UBE2N (shUBE2N) were synthesized from Shanghai GeneChem Co., Ltd. (Shanghai, China). The target sequences of shUBE2N#1 and shUBE2N#2 were 5′‐TTGGGAAGAATATGTTTAGATAT‐3′ and 5′‐AAGTTGGGAAGAATATGTTTAGA‐3′. And the lentiviral particles were produced in HEK293T cells, and HeLa and SiHa cells were infected with indicated lentivirus as stated previously.12

2.5. Cell growth and viability

HeLa or SiHa cells were infected with indicated lentivirus or transfected with indicated miRNAs or plasmids for indicated time, and cell growth or viability was evaluated by CCK‐8 according to the manufacturer's instructions (Yeason, Shanghai, China).

2.6. Western blot

Western blot was carried out to analyze protein expression as described previously.13 Anti‐UBE2N, anti‐phospho‐MEK1/2, anti‐phospho‐p38, and anti‐GAPDH antibodies were purchased from Cell Signaling Technology, Danvers, Massachusetts.

2.7. Luciferase assay

PCR was used to generate the fragments of UBE2N 3'UTR with predicted miR‐590‐3p binding sites or the mutants, and the fragments were subcloned into pGL3 vector. And then, the plasmids together with miRNAs were transfected into HeLa cells for 3 days, followed by luciferase assay as stated previously.14

2.8. Statistical analysis

Statistical analysis was performed by using SPSS version 17.0 (Chicago, Illinois). Values were expressed as means ± SD when necessary. Student's t test was used to compare two groups, and analysis of variance (ANOVA) was used to compare multigroups. All statistical tests were two‐sided, and P < .05 was considered statistically significant. All experiments were repeated three times in this study.

3. RESULTS

3.1. UBE2N is elevated in cervical carcinoma, and predicts a poor prognosis for patients

The public cancer database GEPIA matched with TCGA and GTEx was used to evaluate UBE2N expression in cervical carcinoma. As shown in Figure 1A, UBE2N was significantly elevated in cervical squamous cell carcinoma and endocervical adenocarcinoma (CESC). And the Kaplan‐Meier Plotter also revealed that cervical squamous cell carcinoma patients with high UBE2N expression had a shorter overall survival than patients with low UBE2N expression, which indicated that UBE2N was a negative index for patients with cervical carcinoma (Figure 1B). Subsequently, to further confirm the expression of UBE2N in cervical carcinoma, 16 pairs of paracancerous normal tissues and tumor tissues of cervical carcinoma were collected for qRT‐PCR analysis. As shown in Figure 1C,D, the results showed that UBE2N was upregulated in cervical carcinoma tumor tissues.

Figure 1.

Figure 1

UBE2N is elevated in cervical carcinoma, and predicts a poor prognosis for patients. A, GEPIA matched with TCGA and GTEx (http://gepia2.cancer‐pku.cn) was used to analyze UBE2N expression. B, Kaplan‐Meier plotter (http://kmplot.com) was used to analyze the overall survival in cervical squamous cell carcinoma. C, Sixteen pairs of paracancerous tissues and tumor tissues of cervical cancer were used for qRT‐PCR. D, Statistical analysis for Figure 1C. *P < .05, **P < .01. CESC, Cervical squamous cell carcinoma and endocervical adenocarcinoma; qRT‐PCR, quantitative real‐time polymerase chain reaction

3.2. Knockdown of UBE2N inhibits cell growth of cervical carcinoma by suppressing MAPK activation

To further investigate the function of UBE2N in cervical carcinoma, UBE2N was knocked down in cervical carcinoma cells by shRNAs (Figure 2A). As shown in Figure 2B,C, knockdown of UBE2N could markedly inhibit the cell growth of cervical carcinoma in both of HeLa and SiHa cells. And it has been reported that UBE2N activated MAPK signaling and promoted cell growth in other tumors,15 therefore, the activation of MAPK proteins was then evaluated in cervical carcinoma cells. As shown in Figure 2D, the phosphorylation levels of MEK1/2 and p38 were markedly decreased when UBE2N was knocked down in HeLa and SiHa cells. Above studies revealed that knockdown of UBE2N inhibited cervical carcinoma cell growth by suppressing MAPK activation, which also further suggested that UBE2N was an oncogene in cervical carcinoma.

Figure 2.

Figure 2

Knockdown of UBE2N inhibits cell growth of cervical carcinoma by suppressing MAPK activation. A, Cells were infected with indicated lentivirus for 3 days, and then infected cells were prepared for qRT‐PCR analysis. B, HeLa and, C, SiHa cells infected with indicated lentivirus were cultured for indicated times, followed by CCK‐8 assay. D, Cells were infected with indicated lentivirus for 48 hours, and then cells were used for western blot. *P < .05, **P < .01; # P < .05, ## P < .01. qRT‐PCR, quantitative real‐time polymerase chain reaction

3.3. MiR‐590‐3p is downregulated in cervical carcinoma, and it targets UBE2N

Our further investigations found that miR‐590‐3p was significantly downregulated in cervical carcinoma tumor tissues (Figure 3A,B). And the Kaplan‐Meier Plotter revealed that cervical carcinoma patients with high miR‐590 expression had a longer overall survival than patients with low expression (Figure 3C). Moreover, the correlation analysis between miR‐590‐3p and UBE2N showed that miR‐590‐3p was negatively correlated with UBE2N expression in cervical carcinoma tumor tissues (Figure 3D).Then, our further studies showed that miR‐590‐3p was predicted to bind to UBE2N 3'UTR (Figure 4A). And overexpression of miR‐590‐3p significantly downregulated both of the mRNA and protein levels of UBE2N in HeLa and SiHa cells (Figure 4B,C). Additionally, the luciferase assay also showed that miR‐590‐3p significantly inhibited wild‐type UBE2N 3'UTR‐driven luciferase activity, but had no effect on mutated UBE2N 3'UTR‐driven luciferase activity (Figure 4D), which further indicated that miR‐590‐3p targeted UBE2N.

Figure 3.

Figure 3

MiR‐590‐3p is downregulated in cervical carcinoma, and negatively correlated with UBE2N. A, Sixteen pairs of paracancerous tissues and tumor tissues of cervical cancer were used for qRT‐PCR to detect miR‐590‐3p expression. B, Statistical analysis for Figure 3B. C, Kaplan‐Meier plotter was used to analyze the overall survival in cervical squamous cell carcinoma. D, Correlation analysis for miR‐590‐3p and UBE2N expression in 16 cervical carcinoma tumor tissues. **P < .01. qRT‐PCR, quantitative real‐time polymerase chain reaction

Figure 4.

Figure 4

MiR‐590‐3p targets UBE2N and inhibits its expression in cervical carcinoma. A, the binding sites of miR‐590‐3p in UBE2N 3'UTR were predicted online (http://www.microrna.org). MiR‐NC or miR‐590‐3p mimics were transfected into HeLa and SiHa cells for 3 days, and then cells were used for, B, qRT‐PCR analysis or, C, western blot. D, HeLa cells were transfected with indicated miRNAs or plasmids. Three days later, cells were lysed for luciferase assay. **P < .01, ## P < .01. N.s. means nonsense. qRT‐PCR, quantitative real‐time polymerase chain reaction; Mut, mutated; WT, wild‐type

3.4. Overexpression of UBE2N rescued miR‐590‐3p‐induced cell growth inhibition in cervical carcinoma

Above studies have shown that miR‐590‐3p was downregulated in cervical carcinoma and predicted as a positive index for patients with cervical carcinoma, but its effect in regulating cervical carcinoma cell growth was not investigated yet. Then, cervical carcinoma cell lines were overexpressed with miR‐590‐3p by mimics (Figure 5A), and the CCK‐8 assay showed that overexpressed miR‐590‐3p markedly inhibited cell growth of cervical carcinoma (Figure 5B,C). In addition, when UBE2N was overexpressed by plasmids in cervical carcinoma cells, miR‐590‐3p‐induced cell growth inhibition could be rescued significantly (Figure 5D), which further suggested that UBE2N was a target gene of miR‐590‐3p in cervical carcinoma.

Figure 5.

Figure 5

Overexpression of UBE2N rescued miR‐590‐3p‐induced cell growth inhibition in cervical carcinoma, A,. HeLa and SiHa cells were transfected with miR‐NC or miR‐590‐3p mimics for 3 days, followed by qRT‐PCR. B, HeLa and, C, SiHa cells were transfected with miR‐NC or miR‐590‐3p mimics for indicated times, followed by CCK‐8. D, HeLa cells were transfected with miR‐NC, miR‐590‐3p mimics, or Myc‐UBE2N plasmids for 3 days, followed by CCK‐8. *P < .05, **P < .01, ## P < .01. qRT‐PCR, quantitative real‐time polymerase chain reaction

4. DISCUSSION

Protein ubiquitination is a common form of post‐translational modification, which can regulate the degradation or activity of protein substrates in different cells.16 And the process of ubiquitination is catalyzed by the sequential actions of ubiquitin‐activating enzyme E1, ubiquitin‐conjugating enzyme E2, and ubiquitin ligase E3, whose dysregulation is closely associated with tumorigenesis.17 And UBE2N introduced in this study is a kind of E2, which has been reported to act together with the E3 ligases in the K63‐linked poly‐ubiquitination.8 For example, UBE2N acted in concert with the E3 ligase TRIM5 to produce K63‐linked poly‐ubiquitin chains that activated the MAP3K7/TAK1 complex, which in turn enhanced NF‐κB and MAPK signalings.8 In this study, we also confirmed UBE2N knockdown obviously inhibited MAPK activation in cervical carcinoma cells, including MEK1/2 and p38.

In recent years, UBE2N has been considered as a promising target for the treatment of melanoma, neuroblastoma, breast cancer, and B‐cell lymphoma.15 In melanoma, UBE2N promoted cell growth by regulating MEK/FRA1/SOX10 signaling.10 And UBE2N controlled breast cancer metastasis through a TAK1‐p38 MAPK cascade.11 Additionally, NSC697923, a novel UBE2N inhibitor, induced neuroblastoma cell death via activation of p53 and JNK pathways.18 And in this study, UBE2N was found elevated in cervical carcinoma, and patients with high UBE2N expression had a poor prognosis. Moreover, UBE2N knockdown significantly inhibited cervical carcinoma cell growth, which further suggested UBE2N was an oncogene in cervical carcinoma, and could be a novel target for cervical carcinoma therapy.

It is known that the abnormal expression of miRNAs is closely related to tumor development.19 In this study, miR‐590‐3p was found downregulated in cervical carcinoma, and its overexpression markedly suppressed cervical carcinoma cell growth. Our further studies showed that miR‐590‐3p targeted UBE2N and inhibited its expression in cervical carcinoma cells. Nowadays, several other miRNAs have been also identified to target UBE2N in other tumor types. In hepatocellular carcinoma, miR‐147b promoted tumor growth via targeting UBE2N.14 In breast cancer, miR‐205 acted as a tumor radiosensitizer by targeting ZEB1 and Ubc13.20 In view of these results, we speculated that decreased expression of miR‐590‐3p may be one reason for the elevated expression of UBE2N in cervical carcinoma, and other reported miRNAs may also participate in it, which would be investigated in our future work.

5. CONCLUSION

Our study indicated that UBE2N displayed oncogenic function in cervical carcinoma. Targeting miR‐590‐3p/UBE2N axis could be a potential strategy for cervical carcinoma therapy.

CONFLICT OF INTEREST

The authors declare no potential conflict of interest.

Song T‐T, Xu F, Wang W. Inhibiting ubiquitin conjugating enzyme E2 N by microRNA‐590‐3p reduced cell growth of cervical carcinoma. Kaohsiung J Med Sci. 2020;36:501–507. 10.1002/kjm2.12204

Funding information Weifang Maternal and Child Health Hospital, Grant/Award Number: Q201404

REFERENCES

  • 1. Balasubramaniam SD, Balakrishnan V, Oon CE, Kaur G. Key molecular events in cervical cancer development. Medicina (Kaunas). 2019;55:e384. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Yokoi E, Mabuchi S, Takahashi R, Matsumoto Y, Kuroda H, Kozasa K, et al. Impact of histological subtype on survival in patients with locally advanced cervical cancer that were treated with definitive radiotherapy: adenocarcinoma/adenosquamous carcinoma versus squamous cell carcinoma. J Gynecol Oncol. 2017;28:e19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Sarenac T, Mikov M. Cervical cancer, different treatments and importance of bile acids as therapeutic agents in this disease. Front Pharmacol. 2019;10:484. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Li N, Tian YW, Xu Y, Meng DD, Gao L, Shen WJ, et al. Combined treatment with autologous CIK cells, radiotherapy and chemotherapy in advanced cervical cancer. Pathol Oncol Res. 2019;25:691–696. [DOI] [PubMed] [Google Scholar]
  • 5. Diaz Del Arco C, Jimenez Ayala B, Garcia D, Sanabria C, Fernandez Acenero MJ. Distribution of cervical lesions in young and older women. Diagn Cytopathol. 2019;47:659–664. [DOI] [PubMed] [Google Scholar]
  • 6. Bailey J, Davis S, Shaw A, Diotallevi M, Fischer R, Benson MA, et al. Tetrahydrobiopterin modulates ubiquitin conjugation to UBC13/UBE2N and proteasome activity by S‐nitrosation. Sci Rep. 2018;8:14310. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Hodge CD, Spyracopoulos L, Glover JN. Ubc13: the Lys63 ubiquitin chain building machine. Oncotarget. 2016;7:64471–64504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Kiss L, Zeng J, Dickson CF, Mallery DL, Yang JC, McLaughlin SH, et al. A tri‐ionic anchor mechanism drives Ube2N‐specific recruitment and K63‐chain ubiquitination in TRIM ligases. Nat Commun. 2019;10:4502. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Gemoll T, Miroll E, Klein O, Lischka A, Eravci M, Thorns C, et al. Spatial UBE2N protein expression indicates genomic instability in colorectal cancers. BMC Cancer. 2019;19:710. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10. Dikshit A, Jin YJ, Degan S, Hwang J, Foster MW, Li CY, et al. UBE2N promotes melanoma growth via MEK/FRA1/SOX10 signaling. Cancer Res. 2018;78:6462–6472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Wu X, Zhang W, Font‐Burgada J, Palmer T, Hamil AS, Biswas SK, et al. Ubiquitin‐conjugating enzyme Ubc13 controls breast cancer metastasis through a TAK1‐p38 MAP kinase cascade. Proc Natl Acad Sci U S A. 2014;111:13870–13875. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Hotta A, Cheung AY, Farra N, Garcha K, Chang WY, Pasceri P, et al. EOS lentiviral vector selection system for human induced pluripotent stem cells. Nat Protoc. 2009;4:1828–1844. [DOI] [PubMed] [Google Scholar]
  • 13. Kim B. Western blot techniques. Methods Mol Biol. 2017;1606:133–139. [DOI] [PubMed] [Google Scholar]
  • 14. Zhang E, Liu Q, Wang Y, Wang H, He L, Jin X, et al. MicroRNA miR‐147b promotes tumor growth via targeting UBE2N in hepatocellular carcinoma. Oncotarget. 2017;8:114072–114080. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Dikshit A, Zhang JY. UBE2N plays a pivotal role in maintaining melanoma malignancy. Oncotarget. 2018;9:37347–37348. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Xu X, Huang A, Cui X, Han K, Hou X, Wang Q, et al. Ubiquitin specific peptidase 5 regulates colorectal cancer cell growth by stabilizing Tu translation elongation factor. Theranostics. 2019;9:4208–4220. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Manohar S, Jacob S, Wang J, Wiechecki KA, Koh HWL, Simoes V, et al. Polyubiquitin chains linked by lysine residue 48 (K48) selectively target oxidized proteins in vivo. Antioxid Redox Signal. 2019;31:1133–1149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Cheng J, Fan YH, Xu X, Zhang H, Dou J, Tang Y, et al. A small‐molecule inhibitor of UBE2N induces neuroblastoma cell death via activation of p53 and JNK pathways. Cell Death Dis. 2014;5:e1079. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Bertoli G, Cava C, Castiglioni I. MicroRNAs: new biomarkers for diagnosis, prognosis, therapy prediction and therapeutic tools for breast cancer. Theranostics. 2015;5:1122–1143. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Zhang P, Wang L, Rodriguez‐Aguayo C, Yuan Y, Debeb BG, Chen D, et al. miR‐205 acts as a tumour radiosensitizer by targeting ZEB1 and Ubc13. Nat Commun. 2014;5:5671. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES