miR‐451a is downregulated and targets PSMB8 in prostate cancer

Abstract

Abnormal expression of microRNAs (miRNAs) is frequently occurred in prostate cancer (PCa). This study was aimed to investigate the biological roles of miR‐451a in PCa. Quantitative real‐time PCR (qRT‐PCR) and Western blot were employed to investigate the expression levels of miR‐451a and proteasome (prosome, macropain) subunit, beta type, 8 (PSMB8) in PCa cell lines. Luciferase activity reporter assay was used to verify the connection between miR‐451a and PSMB8. in vitro functional experiments were performed to measure the effects of miR‐451a or PSMB8 on PCa cell proliferation, colony formation ability, cell invasion, and cell apoptosis. miR‐451a expression was downregulated, whereas PSMB8 expression was upregulated in PCa cell lines. Luciferase activity reporter assay confirmed the direct connection between miR‐451a and PSMB8. Overexpression of miR‐451a inhibits PCa cell proliferation, colony formation, cell invasion and promotes cell apoptosis, while the overexpression of PSMB8 caused the opposite effects. Moreover, rescue experiments confirmed PSMB8 was a functional target of miR‐451a. In conclusion, this study provides novel insights into the role of miR‐451a in PCa, and the results demonstrated miR‐451a could inhibit PCa progression by targeting PSMB8.

1. INTRODUCTION

Each year, the newly occurred prostate cancer (PCa) cases are 1 ,276 106 worldwide.1 Treatment measures for PCa include surgery, chemotherapy, radiotherapy, and targeted therapy.2 A variety numbers of tumor suppressors or oncogenes were found to play crucial roles in PCa progression.3, 4

MicroRNAs (miRNAs) are short conserved noncoding RNAs that were able to regulate gene expression by 3′‐untranslated region (UTR) binding.5, 6 A single miRNA is able to silence multiple genes expression, and in turn, one gene can be regulated by multiple miRNAs.7 In human cancers, miRNAs affect almost all aspects of cell behaviors.7

miR‐451a is a recently identified miRNA that has crucial roles in cancer progression including breast cancer, renal cell carcinoma, and gastric cancer.8, 9, 10 For instance, it was found miR‐451a overexpression could enhance the response of breast cancer cells to tamoxifen through targeting 14‐3‐3ζ and ERα.8 Moreover, miR‐451a overexpression inhibits renal cell carcinoma cancer cell migration and invasion by targeting phosphomannomutase 2.9 Importantly, miR‐451a was found to be down‐regulated in gastric cancer tissues and cell lines.10 The introduction of miR‐451a mimic significantly reduced cell viability and invasion but increased cell death.10 However, it was not determined whether miR‐451a has a role in PCa.

Proteasome (prosome, macropain) subunit, beta type, 8 (PSMB8) is a predictive marker for locally advanced rectal cancer patients.11 Functional assays revealed that downregulation of PSMB8 suppressed glioma tumor growth in vitro and in vivo via targeting both ERK1/2 and PI3K/AKT signaling pathways.12 Moreover, increased PSMB8 expression was closely associated with depth of invasion, lymph node metastasis, and lower survival rates. Importantly, PSMB8 was found has the potential to be used as cancer‐specific biomarker in gastric cancer.13

In this current study, we aimed to investigate miR‐451a expression level in PCa cell lines. Then, we disclosed the effects of miR‐451a on cell proliferation, colony formation, cell invasion, and cell apoptosis. Moreover, we are interested to investigate the association between miR‐451a and proteasome (prosome, macropain) subunit, beta type, 8 (PSMB8). Also, a series of in vitro experiments were conducted to validated PSMB8 as a functional target of miR‐451a.

2. MATERIALS AND METHODS

2.1. Cell line

PCa cell lines LNCaP, PC‐3 and DU145 and normal prostate epithelial cell line RWPE‐1 were purchased from American Type Culture Collection (ATCC, Manassas, VA). These cell lines were incubated at Dulbecco's Modified Eagle Medium (DMEM, Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA) containing 10% fetal bovine serum (FBS, Invitrogen)14, 15 in a 37°C incubator containing 5% of CO₂.

2.2. Cell transfection

miR‐451a mimic (5′‐AAACCGUUACCAUUACUGAGUU‐3′) and corresponding negative control (miR‐NC, 5′‐AUCUGAACGGAUCCUUAUUAAC‐3′) were synthesized by RiboBio Inc. (Guangzhou, Guangdong, China). pcDNA3.1 containing open reading frame of PSMB8 (pPSMB8) was constructed by GenScript (Nanjing, Jiangsu, China). Lipofectamine 2000 (Invitrogen) was used for cell transfection (miRNA: 100 nM; expression vector: 4 μg). Following 48 hours of transfection, cells were harvested to measure transfection efficacy.

2.3. Quantitative real‐time PCR

Total RNA was isolated from cells using TRIzol reagent (Invitrogen) according to the manufacturer's protocol. PrimeScript II first Strand complementary DNA (cDNA) Synthesis Kit (Takara, Dalian, Liaoning, China) was used to reverse transcribe RNA into cDNA. SYBR Prime Script miRNA RT‐PCR kit (Takara) was used to measure the expression level of miR‐451a at ABI 7500 system (Applied Biosystems, Foster City, CA). SYBR Green Mix was used to measure the expression level of PSMB8. Relative expression level of miR‐451a or PSMB8 was analyzed with 2^−ΔΔCt method. Primers were as follows: miR‐451a: F: 5′‐ACACTCCAGCTGGGAAACCGTTACCATTACT‐3′, R: 5′‐CTGGTGTCGTGGAGTCGGCAA‐3′; U6 snRNA: F: 5′‐GCTTCGGCAGCACATATACTAAAAT‐3′, R: 5′‐CGCTTCAGAATTTGCGTGTCAT‐3′; PSMB8: F: 5′‐GCTGCCTTCAACATAACATCA‐3′, R: 5′‐CTGCCACCACCACCATTA‐3′; GAPDH: F: 5′‐TCCATGACAACTTTGGTATCG‐3′, R: 5′‐TGTAGCCAAATTCGTTGTCA‐3′.

2.4. Western blot

Radioimmunoprecipitation assay (RIPA) buffer containing 50 nM Tris (pH 7.0), 0.5% sodium dodecyl sulfate, 10 mM EDTA (pH 8.0), and protease and phosphatase inhibitor cocktail, EDTA‐free solution (all purchased from Beyotime, Haimen, Jiangsu, China) was used to isolate total protein from cultured cells. Equal amount of protein sample was separated at 10% SDS‐PAGE and transferred to PVDF membranes. Subsequently, membranes were probed with primary antibodies (anti‐PSMB8: ab180606; anti‐E‐Cadherin: ab40772; anti‐N‐Cadherin: ab76011; anti‐GAPDH: ab181602; purchased from Abcam, Cambridge, MA). Then, membranes were incubated with HRP‐conjugated goat anti‐rabbit secondary antibody (ab6721, Abcam). Signals were detected with BeyoECL kit (Beyotime) and analyzed with Image J 1.38 software (NIH, Bethesda, MD).

2.5. Cell counting kit‐8 assay

Cells (1000 cells/well) were seeded in 96‐well plate and incubated for 0, 1, 2, or 3 days. CCK‐8 reagent was added to each well at the above‐mentioned time points. Optical density at 450 nm was measured with ELISA plate reader after further incubation for 4 hours.

2.6. Colony formation assay

The 1000 cells were seeded at 12‐well plate and then incubated for 2 weeks in the above‐mentioned condition. Then, cells were fixed with 4% paraformaldehyde, stained with 0.1% crystal violet, and counted under microscope.

2.7. Cell apoptosis assay

Cell apoptosis was determined with Annexin V‐FITC/PI kit (Beyotime). The 2 × 10⁶ cells were fixed in 70% ethanol for overnight, washed with PBS and incubated in Annexin V‐FITC/PI reagent at 37°C for 15 minutes. Cell apoptosis was evaluated using a BD LSRFortessa analyzer (BD Biosciences, San Jose, CA) after the collection of 10  000 cells. Three independent experiments were repeated.

2.8. Transwell invasion assay

The 1 × 10⁴ cells in serum‐free DMEM were plated into the upper chamber of 150 μL/cm² Matrigel (BD Bioscience) precoated insert. DMEM containing 10% FBS was filled into the lower chamber. After incubation for 24 hours, cells in the upper chamber were gently removed. Invasive cells were fixed by 4% paraformaldehyde, stained with 0.1% crystal violet, and counted under microscope.

2.9. Luciferase reporter assay

Bioinformatic analysis showed PSMB8 was a potential target of miR‐451a. Previously reports showed PSMB8 plays a crucial role in human cancers progression.11, 12, 13 For luciferase assays, wild type or mutate 3'‐UTR of PSMB8 were cloned into pGL3 vector (Promega, Madison, WI) to obtain wt‐PSMB8 or mt‐PSMB8. Cells were co‐transfected with synthetic miRNAs or luciferase reporters using Lipofectamine 2000. Dual‐luciferase activity reporter system (Promega) was used to measure relative luciferase activity after 48 hours transfection.

2.10. Statistical analysis

Data was analyzed at SPSS 22.0 software (IBM Corporation, Armonk, NY) and presented as mean ± SD. Differences in groups were analyzed using Student's t‐test or one‐way ANOVA and Tukey's post hoc test. P < .05 was regarded as statistically significant difference.

3. RESULTS

3.1. Downregulation of miR‐451a and upregulation of PSMB8 in PCa cell lines

We investigated the expression level of miR‐451a in PCa cell lines and normal cell line by qRT‐PCR. An obviously lower miR‐451a expression level was observed in PCa cell lines compared with normal prostate epithelial cell line RWPE‐1 (Figure 1A). Moreover, we showed PSMB8 expression in PCa cells was significantly higher than that in normal cell line (Figure 1B). Since PC‐3 and DU145 has the first and second lowest miR‐451a expression level; hence, these two cells were selected for following analyses.

Figure 1.

qRT‐PCR showed, A, miR‐451a expression was decreased, and, B, PSMB8 expression was increased in PCa cell lines compared with the normal prostate epithelial cell line RWPE‐1. Experiments were repeated in triplicates. ***P < .001l; **P < .01. miR‐451a: microRNA‐451a; PCa: Prostate cancer; qRT‐PCR: Quantitative real‐time PCR; PSMB8: proteasome (prosome, macropain) subunit, beta type, 8

3.2. Overexpression of miR‐451a inhibits PCa cell proliferation, colony formation, invasion but promotes apoptosis

To determine the role of miR‐451a, the growth and invasion abilities of PCa cells transfected with miR‐451a mimic were analyzed. Transfection of miR‐451a mimic increased the levels of miR‐451a in both PCa cell lines (Figure 2A). CCK‐8 assay revealed miR‐451a mimic transfection decreased cell proliferation ability compared with miR‐NC (Figure 2B). The results of colony formation assay validated the results of CCK‐8 assay (Figure 2C). Transwell invasion assay indicated transfection of miR‐451a mimic decreased PCa cell invasion ability (Figure 2D). Moreover, we detected the expression of E‐Cadherin and N‐Cadherin in the miRNAs transfected cells. We found E‐Cadherin was increased, while N‐Cadherin was decreased in miR‐451a mimic transfected cells (Figure 2E). Flow cytometry analysis showed cell apoptosis was elevated by miR‐451a mimics (Figure 2F).

Figure 2.

Overexpression of miR‐451a inhibits PCa cell growth and invasion. A, miR‐451a expression, B, cell proliferation, C, Colony formation, D, cell invasion, E, E‐cadherin and N‐cadherin expression, F, cell apoptosis in PCa cells transfected with synthetic miRNAs. Experiments were repeated in triplicates. ***P < .001, **P < .01 miR‐451a: microRNA‐451a; PCa: prostate cancer; miR‐NC: Negative control miRNA

3.3. miR‐451a regulates PSMB8 expression by 3'‐UTR binding

Bioinformatic analysis showed 3'‐UTR of PSMB8 contains a binding site for miR‐451a (Figure 3A). To validate miR‐451a directly bind with the 3'‐UTR of PSMB8, luciferase activity reporter assay was conducted. It was found introduction of miR‐451a mimic decreased the luciferase activity of cells transfected with wt‐PSMB8 but not mt‐PSMB8 (Figure 3B). Western blot showed PSMB8 was significantly downregulated by miR‐451a mimic (Figure 3C).

Figure 3.

miR‐451a regulates PSMB8 expression by 3'‐UTR binding. A, binding site between miR‐451a and the 3'‐UTR of PSMB8. B, Luciferase activity of cells transfected with synthetic miRNAs or luciferase activity reporter plasmids. C, PSMB8 expression in cells transfected with synthetic miRNAs. Experiments were repeated in triplicates. ***P < .001, **P < .01. miR‐451a, microRNA‐451a; miR‐NC, negative control miRNA; ns, not significant; mt, mutant; PCa, prostate cancer; PSMB8, proteasome (prosome, macropain) subunit, beta type, 8; UTR, untranslated region; wt, wild‐type

3.4. miR‐451a regulates PCa cell behaviors via targeting PSMB8

To study whether PSMB8 was involved in miR‐451a‐mediated cell behaviors, we overexpressed PSMB8 in PCa cell lines using pPSMB8 (Figure 4A). Transfection of pPSMB8 increased PCa cell proliferation, colony formation, cell invasion but decreased cell apoptosis (Figure 4B–E). In addition, we found E‐Cadherin was decreased, while N‐Cadherin was increased in pPSMB8 transfected cells (Figure 4F). Importantly, co‐transfection of pPSMB8 partially reversed the effects of miR‐451a on PCa cell behaviors (Figure 4B‐4F). These results indicated that miR‐451a inhibits PCa cell behaviors through targeting PSMB8.

Figure 4.

miR‐451a regulates PCa cell behaviors through targeting PSMB8. A, PSMB8 expression, B, cell proliferation, C, colony formation, D, cell invasion, E, cell apoptosis, and F, E‐cadherin and N‐cadherin expression in PCa cells transfected with pPSMB8, pcDNA3.1, or pPSMB8 and miR‐451a mimic co‐transfection. Experiments were repeated in triplicates. ***P < .001, ** P < .01, *P < .05 miRNAs. miR‐451a, microRNA‐451a; PCa, prostate cancer; PSMB8, proteasome (prosome, macropain) subunit, beta type, 8

4. DISCUSSION

Numerous abnormally expressed miRNAs have been identified in PCa.16, 17 In this study, we provided evidence that miR‐451a was significantly downregulated in PCa cell lines compared with normal prostate epithelial cell line RWPE‐1. Human cancer is characterized as abnormal status of cell behaviors including growth, metastasis, and angiogenesis.18, 19 In this work, we found overexpression of miR‐451a inhibited PCa cell proliferation, colony formation, and cell invasion but promotes cell apoptosis in vitro. In PC3 cell line, we also found a slight increase in necrosis percentage in number after miR‐451a mimic transfection. We are unsure of the detailed mechanisms behind this phenomenon, which we should explored in our following experiments. These results indicated miR‐451a functions as a tumor suppressor in PCa, which is in consistent with the previously findings.8, 9, 10

Multiple targets of miR‐451a have been identified and validated in previously studies.8, 9, 10 Using TargetScan, novel putative targets of miR‐451a have been predicted. Of these putative targets, PSMB8 was selected for further investigations. Luciferase activity reporter assay confirmed the prediction results of TargetScan. Furthermore, we showed overexpression of PSMB8 could partially reversed the effects of miR‐451a on PCa cell behaviors. Since a miRNA could regulate multiple targets at the same time; therefore, it is easy to understand why overexpression of PSMB8 could only partially reversed the effects of miR‐451a. The limitation of this study was that the roles of miR‐451a were not determined in in vivo model and the mechanisms involved in regulating miR‐451a activity were not addressed. Although we have provided solid evidence that miR‐451a functions as tumor suppressor in PCa, we have to admit the drawback of this work which is that we did not validate the conclusion in human tissues.

In conclusion, we showed miR‐451a was significantly downregulated in PCa cell lines. miR‐451a regulates PCa cell growth, invasion and apoptosis via targeting PSMB8. This work provided evidence that miR‐451a functions as a tumor suppressor in PCa, which will help to develop novel therapeutic targets.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Liu Y, Yang H‐Z, Jiang Y‐J, Xu L‐Q. miR‐451a is downregulated and targets PSMB8 in prostate cancer. Kaohsiung J Med Sci. 2020;36:494–500. 10.1002/kjm2.12196