Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2021 May 17;37(9):784–794. doi: 10.1002/kjm2.12392

miRNA‐10a‐5p inhibits cell metastasis in hepatocellular carcinoma via targeting SKA1

Duo Shen 1, Hong‐Yu Zhao 2, Ai‐Dong Gu 3, Yin‐Wei Wu 2, Yu‐Hang Weng 4, Shu‐Jie Li 3, Jin‐Yun Song 2, Xue‐Feng Gu 1, Jie Qiu 1,4, Wei Zhao 1,4,✉
PMCID: PMC11896280  PMID: 34002462

Abstract

A variety of microRNAs (miRNAs) are involved in the occurrence and development of hepatocellular carcinoma (HCC). However, the role of miR‐10a‐5p in the progression of HCC remains unclear. Therefore, the purpose of this study was to determine the role of miR‐10a‐5p in the development of HCC and the possible molecular mechanism. miR‐10a‐5p expression in HCC tissues and plasma from patients was detected by quantitative real‐time polymerase chain reaction. Migratory changes in HCC cells were detected after the overexpression of miR‐10a‐5p. Epithelial–mesenchymal transition (EMT)‐related proteins were detected by Western blot. Finally, through luciferase assay and rescue experiments, the mechanism by which miR‐10a‐5p regulates its downstream gene, human spindle and kinetochore‐associated complex subunit 1, SKA1 and the interaction between these molecules in the development of HCC were determined. The expression of miR‐10a‐5p was markedly downregulated in HCC tissues, cell lines, and plasma. The overexpression of miR‐10a‐5p significantly inhibited the migration, invasion, and EMT of HCC cells. Furthermore, SKA1 was shown to be a downstream gene of miR‐10a‐5p. SKA1 silencing had the same effect as miR‐10a‐5p overexpression in HCC. In particular, the overexpression of SKA1 reversed the inhibitory effects of miR‐10a‐5p in HCC. Taken together, low miR‐10a‐5p expression is associated with HCC progression. miR‐10a‐5p inhibits the malignant development of HCC by negatively regulating SKA1.

Keywords: epithelial–mesenchymal transition, hepatocellular carcinoma, miR‐10a‐5p, SKA1

1. INTRODUCTION

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in the world. 1 , 2 At present, although surgical resection, ablation, and liver transplantation are used to treat HCC, the prognosis of patients with HCC is still poor due to the high metastasis and recurrence rates. 3 , 4 , 5 Therefore, it is of great significance to identify potential early biomarkers and effective intervention targets for HCC.

microRNAs (miRNAs) are a class of single‐stranded noncoding RNAs with approximately 22 nucleotides. 6 miRNAs are important factors that regulate gene expression by binding to downstream mRNAs and leads to mediation of mRNA decay and translation inhibition. 7 , 8 miRNAs are involved in many physiological processes, such as cell proliferation, differentiation, and apoptosis. 9 , 10 It is worth noting that miRNAs play an important role in tumorigenesis and development by regulating the expression of oncogenes and tumor suppressor genes. 11 , 12 , 13 For example, miR‐339‐5p inhibited the malignant development of gastric cancer by regulating the expression of ALKBH1. 14 miR‐519d promoted cell apoptosis and autophagy by activating the AMPK signaling pathway via Rab10. 15 Additionally, miR‐10a‐5p inhibited the proliferation of cervical cancer cells by regulating the expression of BDNF. 16 miR‐10a‐5p also exerted antitumor effects in breast cancer. 17 These results suggested that miR‐10a‐5p was related to the regulation of tumor progression. However, the specific mechanism by which miR‐10a‐5p participating in HCC has not been characterized.

Human spindle and kinetochore‐associated complex subunit 1 (SKA1) can interact with tubulin via multiple contact points and promote chromosome segregation. 18 , 19 SKA1 is upregulated in a variety of cancers, and its carcinogenic effects, including its participation in the cell cycle, proliferation, and metastasis, have been confirmed. 20 , 21 , 22 Therefore, interference with SKA1 expression may inhibit cancer progression. Some studies have shown that the expression of miR‐10a‐5p in HCC tissues is lower than that in paracancerous tissues, but the specific mechanism has not been studied. 23 In this study, we found that miR‐10a‐5p was significantly downregulated in HCC tissues, plasma, and cell lines. The overexpression of miR‐10a‐5p could inhibit the proliferation, migration, and invasion of HCC cells by targeting SKA1. These findings revealed that the miR‐10a‐5p/SKA1 axis might play a critical role in regulating the progression of HCC.

2. MATERIALS AND METHODS

2.1. Sample collection

A total of 30 paired HCC and nontumorous tissues were collected during surgery. The tissues were immediately frozen in liquid nitrogen and stored in an ultralow temperature refrigerator at −80°C until further analysis. All the patients were diagnosed with HCC by pathology. In addition, plasma samples were collected from 32 patients with HCC and 32 healthy controls. None of the patients received preoperative radiotherapy or chemotherapy. All the patients provided written informed consent before participation, and the ethical review committee of Nanjing Second Hospital approved the study (Approval No. 2018‐LS‐ky020).

2.2. Cell culture and transfection

The human HCC HepG2, Hep3B, SMMC7721, Sk‐Hep‐1 cell lines, and the immortalized human hepatocyte LO2 cell line were purchased from the Cell Bank of Chinese Academy of Medical Science (Shanghai, China). All the cell lines were maintained in DMEM (Gibco, NY) supplemented with 10% fetal bovine serum (Gibco), 100 μg/ml streptomycin, and 100 U/ml penicillin (Gibco) and were cultured in an atmosphere with 5% CO2 in a 37°C incubator. Next, miR‐10a‐5p mimics, an miR‐10a‐5p inhibitor, and the relevant negative controls were purchased from RiboBio (Guangzhou, China). The SKA1 siRNA and transfection plasmids were purchased from GenePharma (Shanghai, China). The cells were grown to 60–70% confluence and then transfected using Lipofectamine 3000 (Invitrogen, Carlsbad, CA).

2.3. Quantitative real‐time polymerase chain reaction

Total RNA was extracted using TRIzol reagent (Invitrogen). Quantitative real‐time polymerase chain reaction (qRT‐PCR) analysis of SKA1 was performed using SYBR® Green Mixture (Takara, Shanghai, China). Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used as the internal control. qRT‐PCR analysis of miR‐10a‐5p was performed using a TaqMan MicroRNA Assay Kit (Applied Biosystems, Carlsbad, CA). miR‐10a‐5p was normalized by U6. The primers were purchased from RiboBio (Guangzhou, China). The primer sequences were as follows: SKA1: forward: 5′‐GGTTTCACCGTGTTAGCC‐3′, reverse: 5′‐GCGTATTCAGCAGGTAGTT‐3′; GAPDH: forward: 5′‐TCTCTGCTCCTCCTGTTC‐3′, reverse: 5′‐GGTTGAGCACAGGGTACTTTATTGA‐3′.

2.4. Cell proliferation assays

For the clonogenic assay, tumor cells (600 cells per well) were seeded into 6‐well plates and cultured for 14 days. The colonies on the plates were fixed with 4% paraformaldehyde for 15 min and stained with 0.1% crystal violet, and the number of colonies was counted.

2.5. Transwell assays

Transwell chambers were used to assess cell migration and invasion. For the cell invasion assay, the upper chamber was coated with 50 μL Matrigel (BD Biosciences). After 24 hours of incubation at 37°C, the migrated cells were then fixed with 4% paraformaldehyde for 15 min and stained with crystal violet for 20 min. To quantify cell migration and invasion, images were obtained from five random fields per sample.

2.6. Dual luciferase assay

The pGL3‐basic vectors containing the 3′‐UTRs of WT‐SKA1 and MUT‐SKA1 were constructed (RiboBio, Guangzhou, China). HepG2 and SMMC7721 cells (1 × 105 cells/well) were inoculated into 24‐well plates and then cotransfected with miR‐10a‐5p mimics/mimic NC and WT‐SKA1/MUT‐SKA1. After incubation for 48 h, the firefly and Renilla luciferase activities were measured by dual‐luciferase reporter assay (Promega, Madison, WI).

2.7. Western blot

The protein samples were extracted using radioimmunoprecipitation assay (RIPA) lysis buffer (Beyotime, Shanghai, China). The primary antibodies used to detect the proteins of interest were anti‐SKA1 (1:1000, Abcam), anti‐E‐cadherin (1:2000, ProteinTech, Rosemont, IL), anti‐N‐cadherin (1:2000, ProteinTech), anti‐Vimentin (1:2000, ProteinTech), and anti‐GAPDH (1:20,000, ProteinTech). The proteins were separated on a 10% sodium dodecyl sulfate polyacrylamide gel and transferred to polyvinylidene fluoride membranes (Millipore, Bedford, MA). The membranes were blocked in 5% nonfat milk. The membranes were incubated with specific primary antibodies in dilution buffer overnight at 4°C. Next, the membranes were washed with tris‐buffered saline‐tween 20 (TBST) and then incubated with goat anti‐rabbit immunoglobulin G (IgG) or goat anti‐mouse IgG (1:4000) for 1 h at room temperature. The specific protein expression levels were detected using enhanced chemiluminescence (ECL) reagent (Thermo Fisher Scientific).

2.8. Tumor formation assay

Male nude mice, 4 weeks old, were purchased from Slac Laboratories (Shanghai, China). 4 × 106 HepG2 cells transfected with miR‐10a‐5p mimics or NC mimics were subcutaneously injected into the flanks of mice to complete tumor formation analysis (n = 6 per group). The tumor volume was measured every 5 days, and the tumor volume was calculated using the following formula: length × width2/2. After 25 days, the animals were sacrificed and the tumors were harvested and weighed. The tumor tissues were collected for qRT‐PCR and western blot (WB) detection. Care of experimental animals was performed in accordance with the Southeast University Institutional Animal Care and Use Committee protocols.

2.9. Statistical analysis

All the experimental data were analyzed using GraphPad Prism 7.0 (GraphPad Software, Inc., La Jolla, CA) and SPSS 22.0 (IBM, SPSS, Chicago, IL). All the data are shown as the mean ± SD from at least three independent experiments. Receiver operator characteristic (ROC) curves were generated to determine diagnostic potential of miR‐10a‐5p and α‐fetoprotein (AFP). To analyze the difference of the distribution of high expression or low expression of miR‐10a‐5p in the HCC patients with different clinicopathological characteristics, chi‐square test was used. The difference between two groups was analyzed by Student's t‐test. A P‐value of <0.05 was considered statistically significant.

3. RESULTS

3.1. Decreased miR‐10a‐5p expression was identified in HCC

To explore the role of miR‐10a‐5p in HCC, qRT‐PCR was used to detect the expression of miR‐10a‐5p in tumor tissues, plasma, and cell lines. The expression of miR‐10a‐5p in HCC tissues was lower than that in nontumorous tissues (Figure 1A). In addition, a significant downregulation of miR‐10a‐5p was verified in TNM III–IV stage compared with TNM I–II stage (Figure 1B). We also found that the expression of miR‐10a‐5p in HCC with metastasis was lower than that without metastasis (Figure 1C). We examined the plasma miR‐10a‐5p level in 32 HCC patients and 32 healthy controls. The results indicated that the miR‐10a‐5p level in the plasma of HCC patients was downregulated compared with that in the plasma of healthy controls (Figure 1D). ROC curve was plotted according to plasma miR‐10a‐5p expression. The plasma miR‐10a‐5p was distinguishing HCC patients from healthy controls (Figure 1E). As soon as the cutoff value reached 12.254, the ROC showed that plasma miR‐10a‐5p revealed a good classifier with an area under curve (AUC) of 0.855 (95% CI 0.763–0.947) exhibiting a sensitivity of 70.0% and a specificity of 83.3%. The AUC of AFP was 0.728 (95% CI 0.599–0.856) exhibiting a sensitivity of 76.7% and specificity of 70.0%. The AUC of plasma miR‐10a‐5p and AFP was 0.884 (95% CI 0.800–0.969) exhibiting a sensitivity of 93.3% and a specificity of 76.7%. Further analysis between miR‐10a‐5p expression and the clinicopathological conditions of HCC patients showed that low expression of miR‐10a‐5p was related to TNM stage and lymph node involvement (Table 1). Interestingly, we found that miR‐10a‐5p expression was not significantly influenced by the age, the gender, and the conditions of HBV infection (Table 1). In addition, the levels of miR‐10a‐5p in human HCC cell lines, including HepG2, Hep3B, SMMC7721, and Sk‐Hep‐1, were also significantly reduced compared with those in immortalized human hepatocyte LO2 cells (Figure 1F). These results suggested that the downregulation of miR‐10a‐5p might be related to the tumorigenesis of HCC.

FIGURE 1.

FIGURE 1

Open in a new tab

The expression of miR‐10a‐5p in patients with HCC and cell lines. (A) The expression of miR‐10a‐5p in HCC and nontumorous tissues was measured by qRT‐PCR. (B) The expression of miR‐10a‐5p in HCC tissues at different TNM stages was measured by qRT‐PCR. (C) The expression of miR‐10a‐5p in HCC tissues with or without lymph node metastasis was measured by qRT‐PCR. (D) The expression of miR‐10a‐5p in plasma of patients with HCC was measured by qRT‐PCR. (E) ROC curve analysis of plasma miR‐10a‐5p and serum AFP to discriminate patients with HCC from healthy controls. (F) The expression of miR‐10a‐5p in HCC cell lines and the immortalized hepatocyte cell line LO2 was measured by qRT‐PCR. AFP, α‐fetoprotein; HCC, hepatocellular carcinoma; qRT‐PCR, quantitative real‐time polymerase chain reaction; ROC, receiver operator characteristic; *p < 0.05; **p < 0.01

TABLE 1.

Relationship between miR‐10a‐5p and clinicopathological parameters

miR‐10a‐5p expression
Parameters Number of patients Low (<median) High (≥median) p value
Number 30 14 16
Gender
Male 23 11 12 1.000
Female 7 3 4
Age (years)
≥Mean (55) 13 6 7 1.000
<Mean (55) 17 8 9
Tumor node metastasis
I and II 19 5 14 0.007*
III and IV 11 9 2
Lymph node involvement
Absent 22 7 15 0.012*
Present 8 7 1
Hepatitis B virus infection
Yes 25 12 13 1.000
No 5 2 3
Open in a new tab

Note: The P value was used to analyze the correlation between the expression levels.

3.2. Overexpression of miR‐10a‐5p suppressed progression of HCC cells

In order to investigate the role of miR‐10a‐5p in HCC, HepG2 and SMMC7721 cells were transfected with miR‐10a‐5p mimics or inhibitors. The miR‐10a‐5p mimics significantly increased the expression of miR‐10a‐5p (Figure 2A), but the expression of miR‐10a‐5p was decreased in HepG2 and SMMC7721 cells treated with miR‐10a‐5p inhibitors (Figure 2B). Colony formation assays showed that the upregulation of miR‐10a‐5p inhibited HepG2 and SMMC7721 cells' growth, while the downregulation of miRNA‐10a‐5p promoted HepG2 and SMMC7721 cells' growth (Figure 2C). Transwell assays showed that the upregulation of miR‐10a‐5p inhibited the migration and invasion of HepG2 and SMMC7721 cells, while the downregulation of miRNA‐10a‐5p enhanced the migration and invasion of HepG2 and SMMC7721 cells (Figure 2D,E). In conclusion, the overexpression of miR‐10a‐5p inhibited the migration and invasion of HCC cells.

FIGURE 2.

FIGURE 2

Open in a new tab

miR‐10a‐5p is associated with HCC cells' progression. (A,B) After miR‐10a‐5p mimic or miR‐10a‐5p inhibitor transfection, the expression of miR‐10a‐5p was analyzed by qRT‐PCR. (C) Colony formation assays were performed to analyze the clonogenic ability of HCC cells after transfection. (D,E) Transwell assays were performed to analyze the migration and invasion ability of HCC cells after transfection. HCC, hepatocellular carcinoma; NC, negative group; qRT‐PCR, quantitative real‐time polymerase chain reaction; **p < 0.01

3.3. Overexpression of miR‐10a‐5p inhibited EMT in HCC cells

To further elucidate the effect of miR‐10a‐5p on HCC metastasis, we detected the expression of EMT markers. We found that the upregulation of miR‐10a‐5p promoted the expression of E‐cadherin and inhibited the expression of N‐cadherin and vimentin (Figure 3A). In contrast, miR‐10a‐5p knockdown reduced the E‐cadherin levels and enhanced the N‐cadherin and vimentin levels (Figure 3B). In summary, the overexpression of miR‐10a‐5p inhibited the EMT of HCC cells.

FIGURE 3.

FIGURE 3

Open in a new tab

miR‐10a‐5p regulates EMT in HCC cells. (A,B) The expression of EMT‐related proteins was quantified by western blot analysis. EMT, epithelial–mesenchymal transition; HCC, hepatocellular carcinoma; NC, negative group; **p < 0.01

3.4. miR‐10a‐5p directly targeted SKA1 in HCC cells

Moreover, we searched the targets of miR‐10a‐5p in the TargetScan database. In particular, SKA1 was selected as a candidate target of miR‐10a‐5p, and SKA1 has binding sites for miR‐10a‐5p (Figure 4A). Then, the prediction results were verified by luciferase reporter experiments. miR‐10a‐5p mimics significantly blocked the luciferase activity of WT‐SKA1 without affecting the luciferase activity of MUT‐SKA1 (Figure 4B). Additionally, the upregulation of miR‐10a‐5p significantly inhibited the expression of SKA1 (Figure 4C) while the downregulation of miR‐10a‐5p promoted the expression of SKA1 in HepG2 and SMMC7721 cells (Figure 4D). Taken together, these results showed that miR‐10a‐5p directly targeted SKA1 and negatively regulated its expression in HCC cells.

FIGURE 4.

FIGURE 4

Open in a new tab

SKA1 is the target gene of miR‐10a‐5p. (A) SKA1 3′‐UTR and miR‐10a‐5p had a conservative matching area. (B) The luciferase reporter assay was measured to evaluate the interaction between SKA1 and miR‐10a‐5p. (C,D) SKA1 expressions in HCC cells with miR‐10a‐5p mimic and inhibitor were measured by qRT‐PCR and western blot analysis. HCC, hepatocellular carcinoma; MUT, mutant; NC, negative group; qRT‐PCR, quantitative real‐time polymerase chain reaction; SKA1, human spindle and kinetochore‐associated complex subunit 1; WT, wild type. **p < 0.01

3.5. The function of SKA1 was identified in HCC

Then, si‐SKA1 was used to block the expression of SKA1 in HepG2 and SMMC7721 cells to study the role of SKA1 in the metastasis and EMT of HCC (Figure 5A). For EMT, si‐SKA1 increased the level of E‐cadherin and decreased the levels of N‐cadherin and vimentin (Figure 5B). In addition, the transwell assay revealed that si‐SKA1 inhibited cell migration (Figure 5C) and invasion (Figure 5D). Collectively, SKA1 played the same role as miR‐10a‐5p overexpression in HCC.

FIGURE 5.

FIGURE 5

Open in a new tab

The function of SKA1 is identified in HCC. (A) SKA1 expression was measured by qRT‐PCR in HCC cells with SKA1 siRNA. (B) The expression of EMT‐related proteins was quantified by western blot analysis in HCC cells with SKA1 siRNA. (C,D) SKA1 siRNA regulated cell migration and invasion. HCC, hepatocellular carcinoma; NC, negative group; qRT‐PCR, quantitative real‐time polymerase chain reaction; SKA1, human spindle and kinetochore‐associated complex subunit 1. **p < 0.01

3.6. Upregulation of SKA1 abolished the inhibitory action of miR‐10a‐5p in HCC

Finally, the SKA1 vector was transfected into HepG2 and SMMC7721 cells and miR‐10a‐5p was overexpressed to further explore the interaction between these molecules. We found that the upregulation of SKA1 reversed the decrease in SKA1 mRNA and the decrease in the protein levels induced by miR‐10a‐5p mimics (Figure 6A,B). Furthermore, the overexpression of SKA1 also eliminated the inhibitory effect of miR‐10a‐5p on the migration and invasion of HCC cells (Figure 6C,D). In conclusion, the upregulation of SKA1 eliminated the miR‐10a‐5p‐mediated inhibition of HCC cell migration and invasion.

FIGURE 6.

FIGURE 6

Open in a new tab

Upregulation of SKA1 blocked the inhibitory action of miR‐10a‐5p in HCC. (A,B) The mRNA and protein expressions of SKA1 were measured by qRT‐PCR and western blot in HCC cells with SKA1 vector and miR‐10a‐5p mimic. (C,D) Cell migration and invasion in HCC cells containing SKA1 vector and miR‐10a‐5p mimic were measured by the transwell assay. HCC, hepatocellular carcinoma; NC, negative group; qRT‐PCR, quantitative real‐time polymerase chain reaction; SKA1, human spindle, and kinetochore‐associated complex subunit 1. **p < 0.01

3.7. miR‐10a‐5p suppressed tumor formation in vivo

A tumor transplant model was established in order to clarify the effect of miR‐10a‐5p on tumor formation in vivo. The tumor size, volume, and weight were significantly reduced in the miR‐10a‐5p mimics‐transfected group compared with the NC mimics‐transfected group (Figure 7A–C). Furthermore, SKA1 expression was markedly downregulated, while miR‐10a‐5p expression showed an opposite trend in tumor tissues from the miR‐10a‐5p mimics‐transfected group compared to the NC mimics‐transfected group (Figure 7D,E). In summary, these findings suggest that miR‐10a‐5p has a negative effect on the tumor formation of HCC in vivo. The possible mechanism may be associated with the negative regulation of miR‐10a‐5p on SKA1.

FIGURE 7.

FIGURE 7

Open in a new tab

miR‐10a‐5p suppresses tumor formation in vivo. (A–C) Tumor tissue, tumor volume, and tumor weight. (D) Relative mRNA level of miR‐10a‐5p and SKA1 was measured by qRT‐PCR. (E) The protein expression of SKA1 was measured by western blot. NC, negative group; qRT‐PCR, quantitative real‐time polymerase chain reaction; SKA1, human spindle and kinetochore‐associated complex subunit 1. *p < 0.05; **p < 0.01

4. DISCUSSION

HCC, as the most common type of primary liver cancer, has high mortality and recurrence rates. Understanding the molecular mechanism of HCC is of great significance for identifying new therapeutic targets. In this study, downregulated miR‐10a‐5p expression was found to be associated with tumor stage and lymph node metastasis. Moreover, miR‐10a‐5p was able to inhibit cell metastasis and EMT in HCC by directly suppressing SKA1. According to these results, we found that miR‐10a‐5p is a critical regulator in the development of HCC.

miRNAs are involved in the progression of human cancer and have carcinogenic or antitumor effects. 12 Therefore, miRNAs have been widely considered to be a cancer‐targeted therapy strategy. In recent years, miR‐10a‐5p has been found to be downregulated in several human cancers. For example, miR‐10a‐5p exerts a potential antitumor effect in cervical cancer. 16 The overexpression of miR‐10a‐5p inhibits the expression of PIK3CA to inhibit the proliferation of breast cancer cells. 17 In addition, the downregulation of miR‐10a‐5p induces the upregulation of TrkB expression and promotes the development of laryngeal carncer. 24 Our research confirmed that miR‐10a‐5p was significantly downregulated in HCC. Moreover, overexpressed miR‐10a‐5p acted as an inhibitor in the progression of HCC.

Emerging evidence has suggested that SKA1 is a candidate oncofoetal protein involved in the development of a series of cancers. For example, SKA1 is significantly overexpressed in gastric cancer tissues and cell lines and could be used as a biomarker for early diagnosis. 25 SKA1 is a target of miR‐10a in clear cell renal cell carcinoma and promotes tumor proliferation and metastasis. 26 In patients with lung adenocarcinoma, the SKA1 expression was upregulated and could act as a promising prognostic biomarker and target. 22 Furthermore, SKA1 was upregulated in HCC tissues, might be involved in the occurrence and development of HCC, and could be used as a prognostic marker. 27 In this study, bioinformatics analysis showed that the 3′‐UTR of SKA1 and miR‐10a‐5p contained complementary binding sequences, and the binding of these molecules was further confirmed by luciferase experiments. In contrast to miR‐10a‐5p, SKA1 was upregulated in HCC tissues and cell lines. The high expression of SKA1 enhanced the malignant biological behavior of HCC cells.

In conclusion, our results indicated that miR‐10a‐5p was significantly downregulated in HCC tissues and cell lines. The overexpression of miR‐10a‐5p significantly inhibited the migration and invasion of HCC cells by directly regulating the expression of SKA1. Furthermore, the miR‐10a‐5p/SKA1 axis is involved in HCC by regulating EMT. Therefore, this study revealed the molecular mechanism by which miR‐10a‐5p regulates the progression of HCC, and these findings suggested that miR‐10a‐5p might be a potential therapeutic target of HCC.

CONFLICT OF INTEREST

All authors declare no potential conflict of interest.

Shen D, Zhao H‐Y, Gu A‐D, et al. miRNA‐10a‐5p inhibits cell metastasis in hepatocellular carcinoma via targeting SKA1 . Kaohsiung J Med Sci. 2021;37:784–794. 10.1002/kjm2.12392

REFERENCES

  • 1. Miller KD, Siegel RL, Lin CC, Mariotto AB, Kramer JL, Rowland JH, et al. Cancer treatment and survivorship statistics. CA Cancer J Clin. 2016;66(4):271–89. [DOI] [PubMed] [Google Scholar]
  • 2. Jemal A, Bray F, Center MM, Ferlay J, Ward E, Forman D. Global cancer statistics. CA Cancer J Clin. 2011;61(2):69–90. [DOI] [PubMed] [Google Scholar]
  • 3. Bruix J, Gores GJ, Mazzaferro V. Hepatocellular carcinoma: clinical frontiers and perspectives. Gut. 2014;63(5):844–55. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Takayama T. Surgical treatment for hepatocellular carcinoma. Jpn J Clin Oncol. 2011;41(4):447–54. [DOI] [PubMed] [Google Scholar]
  • 5. Sun HZ, Song YL, Wang XY. Effects of different anesthetic methods on cellular immune and neuroendocrine functions in patients with hepatocellular carcinoma before and after surgery. J Clin Lab Anal. 2016;30(6):1175–82. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Mohr AM, Mott JL. Overview of microRNA biology. Semin Liver Dis. 2015;35(1):3–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Iwakawa H, Tomari Y. The functions of microRNAs: mRNA decay and translational repression. Trends Cell Biol. 2015;25(11):651–65. [DOI] [PubMed] [Google Scholar]
  • 8. Fabian MR, Sonenberg N, Filipowicz W. Regulation of mRNA translation and stability by microRNAs. Annu Rev Biochem. 2010;79:351–79. [DOI] [PubMed] [Google Scholar]
  • 9. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–97. [DOI] [PubMed] [Google Scholar]
  • 10. Ambros V. The functions of animal microRNAs. Nature. 2004;431(7006):350–5. [DOI] [PubMed] [Google Scholar]
  • 11. Kwak PB, Iwasaki S, Tomari Y. The microRNA pathway and cancer. Cancer Sci. 2010;101(11):2309–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Farazi TA, Spitzer JI, Morozov P, Tuschl T. MiRNAs in human cancer. J Pathol. 2011;223(2):102–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Xie M, Ma L, Xu T, Pan Y, Wang Q, Wei Y, et al. Potential regulatory roles of microRNAs and long noncoding RNAs in anticancer therapies. Mol Ther Nucleic Acids. 2018;13:233–43. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Wang C, Huang Y, Zhang J, Fang Y. MiRNA‐339‐5p suppresses the malignant development of gastric cancer via targeting ALKBH1. Exp Mol Pathol. 2020;115:104449. [DOI] [PubMed] [Google Scholar]
  • 15. Zhang YJ, Pan Q, Yu Y, Zhong XP. MicroRNA‐519d induces autophagy and apoptosis of human hepatocellular carcinoma cells through activation of the AMPK signaling pathway via Rab10. Cancer Manag Res. 2020;12:2589–602. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Zhai L, Li Y, Lan X, Ai L. MicroRNA‐10a‐5p suppresses cancer proliferation and division in human cervical cancer by targeting BDNF. Exp Ther Med. 2017;14(6):6147–51. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Zhang J, Ren L, Yu M, Liu X, Ma W, Huang L, et al. S‐equol inhibits proliferation and promotes apoptosis of human breast cancer MCF‐7 cells via regulating miR‐10a‐5p and PI3K/AKT pathway. Arch Biochem Biophys. 2019;672:108064. [DOI] [PubMed] [Google Scholar]
  • 18. Abad MA, Medina B, Santamaria A, Zou J, Plasberg‐Hill C, Madhumalar A, et al. Structural basis for microtubule recognition by the human kinetochore Ska complex. Nat Commun. 2014;5:2964. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Monda JK, Whitney IP, Tarasovetc EV, Wilson‐Kubalek E, Milligan RA, Grishchuk EL, et al. Microtubule tip tracking by the spindle and kinetochore protein Ska1 requires diverse tubulin‐interacting surfaces. Curr Biol. 2017;27(23):3666–75. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Wang X, Zeng Y, Zhou M, Zhang X, Xu A, Lin J, et al. SKA1 promotes malignant phenotype and progression of glioma via multiple signaling pathways. Cancer Cell Int. 2019;19:324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Li T, Liu X, Xu B, Wu W, Zang Y, Li J, et al. SKA1 regulates actin cytoskeleton remodelling via activating Cdc42 and influences the migration of pancreatic ductal adenocarcinoma cells. Cell Prolif. 2020;53(4):e12799. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Chen C, Guo Q, Song Y, Xu G, Liu L. SKA1/2/3 serves as a biomarker for poor prognosis in human lung adenocarcinoma. Transl Lung Cancer Res. 2020;9(2):218–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Zhu HR, Huang RZ, Yu XN, Shi X, Bilegsaikhan E, Guo HY, et al. Microarray expression profiling of microRNAs reveals potential biomarkers for hepatocellular carcinoma. Tohoku J Exp Med. 2018;245(2):89–98. [DOI] [PubMed] [Google Scholar]
  • 24. Hu X, Zou W, Liu D, Qin G, Jiang L. The down‐regulation of TrkB alleviates the malignant biological behavior and cancer stem‐like property of laryngeal cancer. Cancer Manag Res. 2020;12:6865–75. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
  • 25. Sun W, Yao L, Jiang B, Guo L, Wang Q. Spindle and kinetochore‐associated protein 1 is overexpressed in gastric cancer and modulates cell growth. Mol Cell Biochem. 2014;391(1–2):167–74. [DOI] [PubMed] [Google Scholar]
  • 26. Dong D, Mu Z, Wei N, Sun M, Wang W, Xin N, et al. Long non‐coding RNA ZFAS1 promotes proliferation and metastasis of clear cell renal cell carcinoma via targeting miR‐10a/SKA1 pathway. Biomed Pharmacother. 2019;111:917–25. [DOI] [PubMed] [Google Scholar]
  • 27. Chen Y, Zhao J, Jiao Z, Wang W, Wang D, Yu X, et al. SKA1 overexpression is associated with poor prognosis in hepatocellular carcinoma. BMC Cancer. 2018;18(1):1240. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES