CircPTK2 accelerates tumorigenesis of colorectal cancer by upregulating AKT2 expression via miR‐506‐3p

Abstract

With the rapid increase in its incidence in the last decade, colorectal cancer (CRC) is becoming one of the most life‐threatening cancers. Circular RNA PTK2 (circPTK2) has multiple functions in oncogenesis, including in CRC. However, it remains elusive if circPTK2 also plays an important role in CRC malignancy. The levels of circPTK2, miR‐506‐3p, and AKT serine/threonine kinase 2 (AKT2) were measured by qPCR. The protein level of AKT2 was evaluated by western blotting assay. The proliferation, migration, and invasion of CRC cancer cells were evaluated by MTT, colony formation, wound‐healing, and transwell assays. The interaction between circPTK2 and miR‐506‐3p and between miR‐506‐3p and AKT2 mRNA were verified by dual‐luciferase reporter assay. The expressions of circPTK2 and AKT2 were elevated in CRC cells, with a concomitant reduction of miR‐506‐3p. The knockdown of circPTK2 suppressed the proliferation, migration, and invasion of CRC cells. CircPTK2 targeted miR‐506‐3p and negatively regulated its expression. Furthermore, miR‐506‐3p overexpression suppressed the CRC progression by downregulating the AKT2 expression. AKT2 overexpression or miR‐506‐3p inhibition restored the suppression of growth and invasiveness of CRC cancer cells caused by circPTK2 silencing. The circPTK2/miR‐506‐3p/AKT2 axis plays a novel and essential role in promoting CRC progression, providing potential targets for CRC therapeutic modality.

1. INTRODUCTION

As a malignant disease that develops in the colon or rectum, most colorectal cancers (CRCs) start from an aberrant crypt, which evolves into a polyp, a neoplastic precursor lesion, and eventually progresses to CRC. ¹ The number of CRC cases, accounting for approximately 10% of cancer cases annually, ² is rapidly increasing in the last decade and is the fourth cause of cancer‐associated mortality with 900,000 annual deaths. ¹ The global new CRC cases are predicted to increase to 2.5 million in the year 2035. ³ Metastatic CRC is common, with approximately 20% of newly diagnosed cases being metastatic and another 20% developing into metastatic CRCs. ⁴ Patients with metastatic CRC are expected to have a 5‐year overall survival rate of approximately 10%. ⁵ Surgery is the primary method for treating resectable CRCs, while systemic treatments including fluoropyrimidine‐based chemotherapy are available for CRC. ¹ However, recurrence and metastasis occur in patients receiving standard treatments, due to a lack of more effective therapy and incomplete knowledge of the pathogenesis and metastasis of CRC. Our study investigated the role of circular RNA (circRNA) in CRC progression to understand the underlying mechanisms and identify potential targets for CRC treatment.

Studies focusing on the function of abnormally expressed circular RNAs (circRNAs) in cancers are recently emerging. Many studies have indicated that circRNAs exert a versatile role in oncogenesis, including malignant cell growth and proliferation, cellular invasiveness, and drug resistance. ⁶ , ⁷ CircPTK2 (hsa_circ_0005273) promoted the proliferation and migration of bladder cells, accelerated gastric cell proliferation, and reduced apoptosis in gastric carcinoma. ⁶ , ⁸ However, in the context of CRC, the role of circPTK2 in malignancy remains largely unexplored. Recently, Yang et al. ⁹ demonstrated that circPTK2 was elevated in CRC and it promoted epithelial–mesenchymal transition (EMT) by binding to vimentin. MicroRNA (miRNA), a short non‐protein‐coding RNA type, plays a critical role in multiple disease initiation and progression by regulating post‐transcriptional mRNA expression. ¹⁰ , ¹¹ MiRNAs act as tumor oncogenes or suppressors that participate in the oncogenesis of CRC. ¹² , ¹³ MiR‐506‐3p inhibited tumorigenesis in various cancers, ¹⁴ , ¹⁵ , ¹⁶ , ¹⁷ and its expression in tumor tissues in patients with CRC is significantly downregulated. ¹⁴ A biological software analysis indicated the interaction between circPTK2 and miR‐506‐3p; however, the mechanistic insight and regulatory roles of the circPTK2/miR‐506‐3p in CRC progression are unclear.

AKT serine/threonine kinase 2 (AKT2) plays a critical role in regulating cell metabolism and controlling cell cycle progression, and it is highly expressed in many cancers and promotes tumor progression. ¹⁸ AKT2 signaling also exerted important tumor‐promoting roles in CRC development ¹⁸ and was negatively regulated by several miRNAs. ¹⁹ , ²⁰ However, intensive studies are still needed to fully understand the mechanism driving AKT2 dysregulation in cancers. Besides, bioinformatic prediction results suggested that miR‐506‐3p might directly bind to AKT2 mRNA, exerting its tumor suppressor activity by regulating AKT2 expression.

Here, we hypothesized that circPKT2 might sponge miR‐506‐3p to limit its tumor suppressor activity. We first verified the interaction between miR‐506‐3p/circPTK2 and miR‐506‐3p/AKT2, establishing a novel circPTK2/miR‐506‐3p/AKT2 regulatory pathway in CRC, and our results indicated that circPTK2 promoted CRC progression by mediating the miR‐506‐3p/AKT2 axis, providing novel therapeutic targets for anti‐CRC treatment.

2. MATERIALS AND METHODS

2.1. Cell culture

Human normal colon epithelial cell NCM460 (Cat. #NCM460D, INCELL) and CRC cell lines HT29 (Cat. #HTB‐38, ATCC), HCT116 (Cat. #CCL‐247, ATCC), SW480 (Cat. #CCL‐228, ATCC), SW837 (Cat. #CCL‐235, ATCC), SW48 (Cat. #CCL‐231, ATCC), and SW620 (Cat. #CCL‐227, ATCC) were cultured in a Roswell Park Memorial Institute 1640 medium (RPMI 1640, Cat. #11875093, Gibco) with 10% fetal bovine serum, 100 U/ml penicillin, and 100 μg/ml streptomycin (Cat. #10378016, Gibco) at 37°C cell incubator with 5% CO₂.

2.2. Plasmid construction and cell transfection

To structure the AKT2 overexpression plasmid, the open reading frame of AKT2 was inserted into the pcDNA3.1 vector (Addgene). miR‐506‐3p mimics (Cat. #4464066) and inhibitor (Cat. #4464084) were obtained from Genepharma. CircPTK2‐targeting shRNA were cloned into shRNA expressing pLKO.1‐puro vector (Addgene). CRC cells were seeded into a new plate 1 day before transfection. Approximately, 2.5 μg plasmid per well was transfected into cells by Lipofectamine 3000 (Cat. #L3000008, Invitrogen).

2.3. Wound‐healing assay

Cells were cultured in a 12‐well plate. The single layer of cell was scraped by using a 1‐mm pipette tip. Detached cells were pipetted out before adding 1.5 ml of a serum‐free medium. Cells were imaged at 0 h under a microscope and imaged again after culturing for an additional of 24 h. The migration distance of the CRC cells was calculated by measuring the change in the length of the gap.

2.4. Transwell invasion assay

Cells were suspended in a 0.5 ml serum‐free medium and cultured in a Matrigel‐coated chamber (BD Biosciences), and a 0.5 ml complete medium was placed into the bottom well, followed by 24‐h incubation. After washing with PBS, cell fixation was performed in 4% paraformaldehyde, followed by staining in 1% crystal violet solution. Cells inside the chambers were gently removed, and the cell number on the outer surface was counted and imaged under a microscope.

2.5. MTT assay

Cells were plated into a 96‐well plate for treatment. At the endpoint, FBS‐free media (50 μl) was mixed with MTT reagent (1 mg/ml; 50 μl) before adding into each well. After a 3‐h incubation, DMSO (150 μl) was added. The plate wrapped in foil was shook for 15 min at room temperature. Absorbance at 490 nm was recorded within 1 h. The proliferation rate was calculated as follows: % proliferation = 100 × (OD 490_sample/OD 490_control).

2.6. Colony formation assay

Cells at an initial density of 600 cells per well were plated in six‐well plates for 2 weeks of culturing. Four percent paraformaldehyde was added to fix the cell, followed by staining with 0.2% crystal violet solution (Cat. #C0775, Sigma). The excess staining reagent was washed out with PBS and cells were imaged with a ChemiDoc scanner (BioRad). Colonies were counted by ImageJ software.

2.7. Western blotting analysis

The RIPA buffer with protease inhibitor cocktail (Cat. #11697498001, Roche) was used to extract the cellular protein, and protein concentration was quantified with the Bradford assay (Cat. #5000201, Bio‐Rad). Proteins were separated using SDS‐PAGE (10%) electrophoresis and transferred onto a polyvinylidene difluoride membrane. BSA‐containing TBST (5% m/v) buffer was used to block unspecific binding, followed by overnight incubation with primary antibody. Horseradish peroxidase‐conjugated secondary antibodies were used for blot developing. Blot was developed using enhanced chemiluminescence kits (Cat. #1705060S, BIO‐RAD) and was analyzed by using a ChemicDoc XRS system (Bio‐Rad). The relative protein levels were calculated using ImageJ software. The following antibodies were diluted for 1000 times and used for the Western blotting experiment: AKT2 (Cat. #3063, Cell Signaling Technology) and GAPDH (Cat. #2118, Cell Signaling Technology).

2.8. qPCR analysis

The RNeasy Mini Kit (Cat. no. 74104, Qiagen) was used to extract RNA, and the High‐Capacity cDNA Reverse Transcription Kit (Cat. #4368814, Applied Biosystems) was used to synthesize cDNA. SsoAdvanced Universal SYBR Green Supermix (Cat. #1725270, Bio‐Rad) was used to quantify gene expression. GAPDH and U6 served as reference genes. The relative gene expression was calculated by 2^−ΔΔCt. The primers for individual genes are listed in Table 1.

TABLE 1.

The primer sequences used in this study

Gene	Forward primer (5′‐3′)	Reverse primer (5′‐3′)
CircPTK2	ACCATTGCGGAGAATATGGCT	AAGTTGGGGTCAAGGTAAGCA
miR‐506‐3p	GCCCTAAGGCACCCTTCTG	GTCGTATCCAGTGCAGGGTCCGAG GTATTCGCACTGGATACGAC
AKT2	TGCCGGTGACAGGTGAATAC	ATCCACTCCTCCCTCTCGTC
GAPDH	CCAGGTGGTCTCCTCTGA	GCTGTAGCCAAATCGTTGT
U6	CTCGCTTCGGCAGCACA	AACGCTTCACGAATTTGCGT

2.9. Luciferase assay

The potential miR‐506‐3p binding region and corresponding mutant motif in circPTK2 and AKT2 mRNA were cloned into the psiCHECK2 luciferase reporter vector (Promega). HEK293T cells were transfected miR‐506‐3p mimic/mimics NC with wild type (WT) or mutant (MUT) circPTK2 or AKT2 for 48 h. Then, the luciferase activity assay (Cat. #E1910, Promega) was used to test the activity of luciferase. Twenty microliters of cell lysate was added in 100 μl of LAR II reagent, followed by immediate recording of the firefly luciferase activity. Then, 100 μl of Stop & Glo Reagent was added, and the Renilla luciferase activity was measured. Normalization of the Renilla luciferase activity against the firefly luciferase activity was performed to calculate the relative luciferase activity.

2.10. Statistical analysis

The experiment was repeated for no less than three times. Data are shown as mean ± standard deviation. Statistical analysis was performed using one‐way analysis of variance or Student's t‐test with GraphPad Prism 7 software (GraphPad Software Inc.). A p value of <0.05 is considered statistically significant.

3. RESULTS

3.1. The expression levels of circPTK2, miR‐506‐3p, and AKT2 in CRC cells

We profiled the expression of these molecules in colon epithelial cell NCM460 and CRC cells HT29 (APC frameshift insertion E1554fs and P53 R273H), HCT116 (APC WT, P53 WT), SW480 (APC WT, P53 P309S, and R273H), SW837 (APC WT and P53 R248W), SW48 (APC R2714C and P53 WT), and SW620 (APC WT, P53 P309S, and R273H). The level of circPTK2 was markedly increased in CRC cells (Figure 1A). Of note, HT116 and SW480 cells showed the highest expression of circPTK2 (Figure 1A). On the contrary, CRC cells showed a significantly downregulated expression of miR‐506‐3p than NCM460 (Figure 1B). AKT2 mRNA, as well as protein, was enhanced in CRC cells (Figure 1C,D). These data demonstrated that circPTK2, miR‐506‐3p, and AKT2 are dysregulated in CRC.

FIGURE 1.

Profiling of circPTK2, miR‐506‐3p, and AKT2 expressions in CRC cells. (A–C) The qPCR assay detected circPTK2 (A), miR‐506‐3p (B), and AKT2 (C) levels in normal and CRC cells. (D) Western blotting was used to measure the AKT2 expression levels in the normal and CRC cells. *p < 0.05, **p < 0.01, ***p < 0.001. AKT2, AKT serine/threonine kinase 2; circPTK2, circular RNA PTK2; CRC, colorectal cancer; qPCR, real‐time quantitative PCR

3.2. Knockdown of circPTK2 inhibited the proliferation, migration, and invasion of CRC cells

To investigate the roles of circPTK2 in the growth and invasion of CRC cells, we knocked down circPTK2, which was highly expressed in HT116 and SW480 cells with circPTK2 targeting shRNA. The levels of circPTK2 in both cell lines were downregulated (Figure 2A). The proliferation of HT116 and SW480 with a lower expression of circPTK2 was drastically suppressed (Figure 2B). Sh‐NC‐expressing HT116 and SW480 formed significantly more colonies than cells expressing sh‐circPTK2 (Figure 2C). The migratory capacity of HT116 and SW480 cells was suppressed along with the downregulation of circPTK2 expression (Figure 2D). Silencing of circPTK2 attenuated the invasiveness of HT116 and SW480 cells (Figure 2E). Collectively, these findings demonstrated that circPTK2 plays a crucial role in expediting CRC progression.

FIGURE 2.

Knockdown of circPTK2 inhibited the proliferation, migration, and invasion of CRC cells. Control or circPTK2 targeting shRNA were expressed in HCT116 and SW480. (A) qPCR assay detected circPTK2 expression. (B) MTT assay was used to assess the viability of HCT116 and SW480 cells. (C) Colony formation assay was used to analyze the proliferation of HCT116 and SW480 cells. (D) Wound‐healing assay was used to test the migration of HCT116 and SW480 cells. (E) Transwell assay was used measured the invasion ability of HCT116 and SW480 cells. **p < 0.01, ***p < 0.001. AKT2, AKT serine/threonine kinase 2; circPTK2, circular RNA PTK2; CRC, colorectal cancer; MTT, 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide; qPCR, real‐time quantitative PCR

3.3. circPTK2 upregulated AKT2 by targeting miR‐506‐3p

To identify the downstream effector(s) that mediates the tumor‐promoting activity of circPTK2, we exploited a bioinformatic tool to predict its potential targets. We found a miR‐506‐3p binding region in circPTK2 (Figure 3A). MiR‐506‐3p mimics inhibited the luciferase activity of WT circPTK2 but not MUT circPTK2 (Figure 3B), suggesting an interaction between circPTK2 and miR‐506‐3p. MiR‐506‐3p also potentially bound to AKT2 gene (Figure 3C). The luciferase activity in cells expressing WT AKT2 was drastically suppressed by miR‐506‐3p mimics, while MUT AKT2 was not affected (Figure 3D), indicating that AKT2 was a target gene of miR‐506‐3p. To verify whether circPTK2 regulates AKT2 expression via miR‐506‐3p, circPTK2 was knocked down with shRNA, and the expression of miR‐506‐3p and AKT2 was determined. Interestingly, miR‐506‐3p was upregulated following circPTK2 knockdown, and the mRNA and protein levels of AKT2 were downregulated (Figure 3E,F). The addition of miR‐506‐3p mimics suppressed AKT2 expression (Figure 3G,H). Collectively, these data demonstrated that circPTK2 in CRC cells acts as sponge for miR‐506‐3p and attenuates its regulatory role in AKT2.

FIGURE 3.

circPTK2 upregulated AKT2 by targeting miR‐506‐3p. (A) Schematic of the binding region of circPTK2 and miR‐506‐3p. (B) Dual‐luciferase reporter assay was used to measure the luciferase activity of WT or MUT miR‐506‐3p reporter. (C) Schematic of the potential binding region between AKT2 mRNA and miR‐506‐3p. (D) Dual‐luciferase reporter assay was used to measure the luciferase activity of WT or MUT AKT2 reporter. (E) MiR‐506‐3p and AKT2 expressions were quantified by qPCR in HCT116 and SW480 cells after being transfected with control or circPTK2‐targeting shRNA. (F) Western blotting was used to test the AKT2 protein in HCT116 and SW480 cells after being transfected with control or circPTK2‐targeting shRNA. (G) qPCR assay detected miR‐506‐3p and AKT2 expressions in HCT116 and SW480 cells treated with control or miR‐506‐3p mimics. (H) Western blotting was used to measure the AKT2 protein in HCT116 and SW480 cells treated with control or miR‐506‐3p mimics. *p < 0.05, **p < 0.01, ***p < 0.001. AKT2, AKT serine/threonine kinase 2; circPTK2, circular RNA PTK2; MUT, mutant; qPCR, real‐time quantitative PCR; WT, wild type

3.4. miR‐506‐3p suppressed the proliferation, migration, and invasion of CRC cells by downregulating the AKT2 expression

To clarify whether miR‐506‐3p regulates AKT2 expression in CRC, the qPCR assay is performed. Moreover, the results showed that the AKT2 level increased after overexpression of AKT2 in HCT116 and SW480 cells (Figure 4A,B). Cell growth was inhibited in the presence of miR‐506‐3p mimics, which was rescued by AKT2 overexpression (Figure 4C). The overexpression of miR‐506‐3p reduced the number of CRC colonies, while the overexpression of AKT2 increased the CRC growth (Figure 4D). Similarly, the migration of CRC cells was attenuated by miR‐506‐3p mimics; its cotransfection with overexpressed AKT2 dramatically facilitated HCT116 and SW480 cell migration (Figure 4E). AKT2 elevation reversed the inhibition of invasion, which resulted from miR‐506‐3p mimic treatment in the CRC cells (Figure 4F). Our data demonstrated that miR‐506‐3p exerts its suppressive activity on CRC progression by inhibiting the AKT2 expression.

FIGURE 4.

miR‐506‐3p attenuated the proliferation, migration, and invasion of CRC cells by downregulating AKT2. HCT116 and SW480 were transfected with control or AKT2 overexpression plasmid. (A) qPCR assay was used to test the mRNA level of AKT2. (B) Western blotting was used to estimate the protein level of AKT2. HCT116 and SW480 treated miR‐506‐3p mimics or co‐transfected with AKT2 overexpression. (C) Cell viability was tested with the MTT assay. (D) Colony formation assay was used to measure cell proliferation. (E) Wound‐healing assay was used to test for cell migration. (F) Transwell assay was performed to detect the invasion ability. *p < 0.05, **p < 0.01, ***p < 0.001. AKT2, AKT serine/threonine kinase 2; CRC, colorectal cancer; MTT, 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide; qPCR, real‐time quantitative PCR

3.5. Overexpression of AKT2 or inhibition of miR‐506‐3p rescued the inhibition of circPTK2 knockdown on CRC progression

To further elaborate their relation, the effects of miR‐506‐3p and AKT2 on circPTK2 knockdown were evaluated. CircPTK2‐targeting shRNA suppressed the AKT2 expression, while miR‐506‐3p upregulated its expression in sh‐circPTK2 cells. In addition, the overexpression of AKT2 also increased the expression of AKT2 in sh‐circPTK2 cells (Figure 5A). Knockdown of circPTK2 reduced HCT116 and SW480 cell growth, while AKT2 overexpression or miR‐506‐3p inhibition promoted cell proliferation in sh‐circPTK2‐expressing cells (Figure 5B). Concomitantly, the formation of CRC colonies was decreased in cells with sh‐circPTK2 and increased in cells with AKT2 overexpression or miR‐506‐3p inhibition (Figure 5C). The attenuated migration ability of sh‐circPTK2 CRC cells was rescued by AKT2 overexpression or miR‐506‐3p inhibition (Figure 5D). AKT2 overexpression or miR‐506‐3p inhibition facilitated the invasion of CRC cells in the absence of circPTK2 (Figure 5E). These data demonstrated that the inhibition of miR‐506‐3p or overexpression of AKT2 can rescue CRC progression in the absence of circPTK2. In addition, we examined the role of circPTK2/miR‐506‐3p/AKT2 axis on apoptosis and EMT in CRC. As shown in Figure S1A, knockdown of circPTK2 induced cell apoptosis, while the promotion of sh‐circPTK2 on apoptosis was reversed after being transfected with miR‐506‐3p inhibition or AKT2 overexpression. Overexpression of AKT2 or inhibition of miR‐506‐3p inhibited the increase in Bax levels and decrease in Bcl‐2 levels induced by circPTK2 knockdown (Figure S1B). Knockdown of circPTK2 increased the E‐cadherin levels and decreased the N‐cadherin levels, while cotransfection with AKT2 overexpression or miR‐506‐3p inhibition had opposite results (Figure S1C).

FIGURE 5.

AKT2 overexpression or miR‐506‐3p inhibition rescued the inhibition of CRC progression caused by sh‐circPTK2. AKT2 overexpression or miR‐506‐3p inhibition and sh‐circPTK2 were co‐transfected into CRC cells HCT116 and SW480. (A) Western blotting assay was used to determine the protein level of AKT2. (B) MTT assay was used to detect cell viability. (C) Colony formation assay was used to test for cell growth. (D) Wound‐healing assay was used to measure cell migration. (E) Transwell assay was used to test for cell invasion ability. *p < 0.05, **p < 0.01, ***p < 0.001. AKT2, AKT serine/threonine kinase 2; circPTK2, circular RNA PTK2; CRC, colorectal cancer; MTT, 3‐(4,5‐dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide

4. DISCUSSION

CRC is a deadly type of cancer and the number of new CRC cases is rapidly increasing in the last decade; however, the tumorigenesis of CRC is poorly understood. Herein, we identified a novel tumor‐promoting circPTK2/miR‐506‐3p/AKT2 axis through which circPTK2 sponged miR‐506‐3p and thus liberated AKT2 from miR‐506‐3p‐mediated suppression, resulting in facilitated proliferation, migration, and invasion of CRC cells. The current study provides novel promising therapeutic targets for anti‐CRC treatment.

The roles of circRNAs are relatively poorly explored in cancers. A previous study showed that circWHSC1 overexpression facilitated the progression of endometrial cancer by regulating the miR‐646‐NPM1 axis. ²¹ CircRNA_0000392 expression is positively associated with CRC malignancy, and knockdown of circRNA_0000392 attenuated the growth and invasiveness of CRC. ²² CircPTK2 plays a context‐dependent role in malignancy, ⁶ , ⁷ , ²³ but it consistently exerts oncogenic activities in CRC. With higher expression in tumor tissues in CRC patients, circPTK2 promoted the development of CRC. ⁹ Another study showed a similar pro‐tumorigenesis function of circPTK2 in CRC by accelerating cancer cell progression and chemoresistance by targeting miR‐136‐5p. ²⁴ Consistent with the abovementioned results, our study showed an increase in circPTK2 expression in CRC cells, implying its pro‐tumor functions. Furthermore, the loss of circPTK2 attenuated the progression features of CRC, suggesting that circPTK2 played a critical role in promoting CRC.

Among the versatile mechanisms of action, circRNA is well known as a sponge for miRNA and is involved in regulating cell growth, migration, and therapy resistance of CRC. ²⁵ Circ‐CDYL bound to miR‐150‐5p to downregulate PTEN and suppressed phosphorylation of PI3K, AKT, JAK2, and STAT5. ²⁶ Moreover, circPTK2 was reported to interact with miR‐196‐3p, miR‐429, and so on, ⁷ , ²⁷ while its miRNA targets in CRC cells remain unknown. Employing the bioinformatic analysis, we demonstrated that circPTK2 sponged miR‐506‐3p, and the inhibition of miR‐506‐3p reversed the inhibitory effect of circPTK2 silencing on cell progression and migration in CRC. MiRNAs are important regulators of CRC progression. ¹² miR‐144 reduced the progression and migration of CRC cell by regulating GSPT1, ²⁸ while miR‐483 contributed to the development of CRC as an oncogenic gene. ²⁹ As a well‐known tumor suppressor, miR‐506‐3p inhibited CRC progression via EZH2. ¹⁴ Herein, we consistently confirmed that miR‐506‐3p inhibited cell proliferation and invasion during CRC progression.

P53 is a potent tumor suppressor and its mutation is among the most frequent alterations in human cancers, ³⁰ with approximately 50% of all CRC cases exhibiting p53 mutations. Different p53 statuses are closely associated with tumor development, prognosis, and responsiveness to treatment. ³¹ The crosstalk between p53 and circPTK2 is not well established, but a previous study on laryngeal squamous cell carcinoma reported that circPTK2 suppressed the expression of p53. ³² Contrarily, reciprocal suppression between p53 and AKT signaling was well recognized in many cancers. ³³ , ³⁴ In the present study, most of the colorectal cancer cell lines we used had p53 mutation, while HCT116 and SW48 were WT p53. In addition, we did not investigate the involvement of p53 in the regulation of circPTK2/miR‐506‐3p/AKT2 axis in our current study, but it would be worthwhile to explore their crosstalk in CRC in the further.

AKT2 was upregulated in various cancers to promote tumor development. ¹⁸ , ³⁵ Moreover, AKT2 accelerated CRC metastasis by upregulating the metastasis suppressor 1 gene or cooperating with PTEN loss. ¹⁸ , ³⁶ Several miRNAs have been reported to suppress AKT2 signaling. ¹⁹ , ²⁰ We identified AKT2 as a target gene of miR‐506‐3p and demonstrated that the loss of miR‐506‐3p led to AKT2 upregulation, which was reduced by miR‐506‐3p overexpression. Furthermore, knockdown of circPTK2 suppressed CRC progression, but this phenomenon was rescued by miR‐506‐3p inhibition or AKT2 overexpression, indicating that both miR‐506‐3p and AKT2 are important mediators downstream of circPTK2 that regulate CRC cancer cell proliferation, migration, and invasion. Wnt signaling, which is mainly driven by loss of APC, plays an important role in the carcinogenesis of CRC. ³⁷ The loss of circPTK2 suppressed the Wnt signaling by downregulating the expression of β‐catenin and cyclin D1, ²⁴ while miR‐506‐3p was indicated to suppress Wnt/β–catenin signaling by abrogating the expression of β‐catenin or semaphorins 6D. ³⁸ , ³⁹ However, we did not examine the involvement of Wnt signaling in our current study; thus, further studies investigating on whether the Wnt signaling pathway is regulated by the circPTK2/miR‐506‐3p axis and contributes to the pathogenesis of CRC are warranted. Although we did not validate our findings in animal models, and there may exist other targets of circPTK2 and miR‐506‐3p in CRC, our current study, for the first time, identified a novel circPTK2/miR‐506‐3p/AKT2 axis that is essential for CRC progression, providing novel insights for anti‐CRC therapy. Further studies are warranted to evaluate the role and potential therapeutic application of circPTK2/miR‐506‐3p/AKT2 axis in CRC.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Supporting information

Figure S1 CircPTK2 silencing induced the apoptosis and inhibited EMT in CRC by regulating the miR‐506‐3p/AKT2 axis. (A) The apoptosis was detected by flow cytometry. (B) The expression level of Bax and Bcl‐2 were detected by Western blotting. (C) The expression levels of E‐cadherin and N‐cadherin were measured by Western blotting. *p < 0.05, **p < 0.01, ***p < 0.001AKT2, AKT serine/threonine kinase 2; EMT, epithelial–mesenchymal transition; circPTK2, circular RNA PTK2; CRC, colorectal cancer.

Gong S‐X, Yang F‐S, Qiu D‐D. CircPTK2 accelerates tumorigenesis of colorectal cancer by upregulating AKT2 expression via miR‐506‐3p. Kaohsiung J Med Sci. 2022;38(11):1060–1069. 10.1002/kjm2.12589