Abstract
Pancreatic cancer (PC) is a lethal malignancy that threatens human health. Long noncoding RNAs (lncRNAs) act as important mediators in PC development. Our study aimed to investigate the function and mechanism of lncRNA ceramide synthase 6 antisense RNA 1 (CERS6‐AS1) in PC. As shown by RT‐qPCR, CERS6‐AS1 was significantly upregulated in PC cells and tissues. Silencing CERS6‐AS1 suppressed PC cell viability and proliferation while enhancing cell apoptosis according to colony formation assays, EdU assays, and flow cytometry analyses. Mechanistically, CERS6‐AS1 interacted with miR‐195‐5p to elevate the expression level of the WD repeat domain phosphoinositide interacting 2 (WIPI2), which is a downstream target gene of miR‐195‐5p in PC. Moreover, miR‐195‐5p expression was negatively associated with CERS6‐AS1 expression (or WIPI2 expression) in PC tissues. Rescue assays revealed that WIPI2 overexpression rescued the effects of CERS6‐AS1 deficiency on cell viability, proliferation, and apoptosis. In summary, CERS6‐AS1 facilitates PC cell proliferation while inhibiting PC cell apoptosis by upregulating WIPI2 via miR‐195‐5p. This study might provide promising insight into the role of CERS6‐AS1 in PC development.
Keywords: CERS6‐AS1, miR‐195‐5p, pancreatic cancer, WIPI2
1. INTRODUCTION
Pancreatic cancer (PC) is one of the leading causes of cancer death worldwide and occurs in the digestive system. 1 , 2 The mortality of PC nearly equals its incidence rate, and its overall 5‐year survival rate is approximately 10% in the United States. 3 , 4 Even though the diagnosis has improved in recent years, many people die of PC each year. 5 To improve therapeutic strategies for PC, it is necessary to clarify the pathogenic mechanism of PC.
Long noncoding RNAs (lncRNAs) are molecules with over 200 nucleotides that have no protein‐coding capacity. 6 However, lncRNAs can modulate the biological activities of cancer cells, such as cell proliferation, differentiation, metastasis, and apoptosis, by regulating the expression of downstream molecules. 7 Mounting evidence has revealed that lncRNAs are significant regulators implicated in the progression of various types of cancer. Mechanistically, lncRNAs can serve as competing endogenous RNAs (ceRNAs) to regulate the expression of messenger RNAs (mRNAs) by interacting with microRNAs (miRNAs). 8 These mRNAs are direct target genes of miRNAs, and their 3′‐untranslated region (3′‐UTR) was targeted by miRNAs. 9 When lncRNAs interact with miRNAs, the expression of mRNAs is upregulated as the suppressive effect of miRNAs on the degradation and translation of mRNAs is attenuated. 10 Many lncRNAs have been reported to participate in the pathogenesis of PC by serving as oncogenes or antioncogenes following the ceRNA mechanism. 11 For example, lncRNA LINC00514 facilitates the progression of PC by acting as a ceRNA against miR‐28‐5p to elevate Rap1b expression. 12 LncRNA ZEB2‐AS1 contributes to PC cell invasion by serving as a ceRNA for miR‐204 to upregulate HMGB1 expression. 13 Based on bioinformatics analysis, lncRNA ceramide synthase 6 antisense RNA 1 (CERS6‐AS1) shows high expression in pancreatic adenocarcinoma tissues. In addition, previous studies validated CERS6‐AS1 promoting the initiation of pancreatic ductal adenocarcinoma via the miR‐15a‐5p/FGFR1 axis under the ceRNA network. 14 CERS6‐AS1 promotes PC cell proliferation and migration by binding with miR‐15a‐5p and miR‐6838‐5p, and regulating HMGA1. 15 Although the biological function of CERS6‐AS1 in PC has been explored, the downstream genes of CERS6‐AS1 in PC are complex and deserve more investigation.
In conclusion, we focused on the functions and mechanism of CERS6‐AS1 in PC. This study might provide new insight into the role of CERS6‐AS1 in PC development.
2. MATERIALS AND METHODS
2.1. Bioinformatics analysis
High expression of CERS6‐AS1 or WIPI2 in pancreatic adenocarcinoma (PAAD) tissues (n = 179) was predicted from GEPIA (http://gepia.cancer-pku.cn/). 16 Seven miRNAs (miR‐195‐5p, miR‐15a‐5p, miR‐424‐5p, miR‐6838‐5p, miR‐16‐5p, miR‐15b‐5p, and miR‐3911) binding to CERS6‐AS1 were identified from the starBase website (http://starbase.sysu.edu.cn/) under the criterion of CLIP‐Data ≥1. 17 Five candidate genes (KCNC4, WIPI2, AP2B1, SRSF11, and PISD) containing binding sites with miR‐195‐5p were predicted using the starBase website with the screening criteria of CLIP Data ≥5 and Degradome Data ≥3.
2.2. Clinical tissues
Fifty pairs of PC tissues and nontumor tissues were obtained from patients with PC at Hangzhou Xiaoshan No. 1 People's Hospital (Zhejiang, China). The association between CERS6‐AS1 expression and the clinical characteristics of 50 patients with PC is provided in Table 1. High CERS6‐AS1 expression is significantly correlated with positive lymph node metastasis and greater tumor size. Patients had received no other anticancer treatment before surgery, and informed consent was obtained from these patients. All samples were collected after operation and immediately stored at −80°C until use in experiments. This study was approved by the ethics committee of Hangzhou Xiaoshan No. 1 People's Hospital (Zhejiang, China).
TABLE 1.
Association between CERS6‐AS1 expression and clinical characteristics of 50 patients diagnosed with pancreatic cancer
| Clinicopathological characteristics | Low expression (n = 26) | High expression (n = 24) | p value |
|---|---|---|---|
| Age (years old) | 0.944 | ||
| ≤50 | 10 | 9 | |
| >50 | 16 | 15 | |
| Gender | 0.982 | ||
| Male | 14 | 13 | |
| Female | 12 | 11 | |
| TNM stage | 0.258 | ||
| I–II | 15 | 10 | |
| III–IV | 11 | 14 | |
| Lymph nodes metastasis | 0.011 | ||
| Negative | 18 | 8 | |
| Positive | 8 | 16 | |
| Tumor size | 0.01 | ||
| ≤2 cm | 17 | 7 | |
| >2 cm | 9 | 17 |
Note: TNM, tumor, lymph node, metastasis. *p < 0.05.
2.3. Cell lines
Four PC cell lines (Capan‐2, BxPC‐3, AsPC‐1, and PANC‐1) were purchased from the American Type Culture Collection (ATCC; Manassas, VA), and a human pancreatic ductal epithelial cell line (HPDE) was purchased from Otwo Biotech (Shenzhen, Guangdong, China). All of these cell lines were cultured in Dulbecco's modified Eagle's medium (DMEM; Gibco, NY) containing 10% fetal bovine serum (FBS; Gibco). The cell culture was implemented at 37°C in a humidified incubator containing 5% CO2.
2.4. Cell transfection
Short hairpin RNAs (shRNAs) against CERS6‐AS1 (sh‐CERS6‐AS1#1 and sh‐CERS6‐AS1#2) were transfected into cells to silence CERS6‐AS1 expression, and sh‐NC was used as a control. WIPI2 was overexpressed by inserting full‐length WIPI2 into pcDNA3.1 vectors to generate pcDNA3.1/WIPI2, with empty pcDNA3.1 vectors as the negative control. MiR‐195‐5p was overexpressed using miR‐195‐5p mimics with NC mimics as a negative control. The synthesized plasmids and vectors above were purchased from GenePharma Company (Shanghai, China). Lipofectamine 2000 (Invitrogen, Carlsbad, CA) was used for cell transfection following the manufacturer's recommendations. Transfection efficiency was examined by RT‐qPCR 48 h later.
2.5. RNA isolation and reverse transcription quantitative PCR
Total RNA from cancer tissues or cells was extracted using TRIzol reagent (Invitrogen). Extracted RNA was reverse transcribed into complementary DNA (cDNA) utilizing reverse transcription kits (Takara, Tokyo, Japan) following the manufacturer's procedures. RT‐qPCR was conducted using the ViiA 7 real‐time PCR system (Life Technologies, Grand Island, NY). The expression of CERS6‐AS1, miRNAs and target genes was calculated using the 2−ΔΔCt method. 18 GAPDH was an endogenous control for lncRNAs and mRNAs, while the expression of miRNAs was normalized to U6. Primer sequences are provided in Table 2.
TABLE 2.
Sequences of primers used for reverse transcription‐quantitative PCR
| Gene | Sequence (5′ → 3′) |
|---|---|
| CERS6‐AS1 forward | GCTGATAACCAGTTTCAGAGAC |
| CERS6‐AS1 reverse | CAGAAGGATTGCTTAAGCCC |
| miR‐195‐5p forward | TAGCAGCACAGAAATATTGGC |
| miR‐195‐5p reverse | CTCTACAGCTATATTGCCAGCC |
| WIPI2 forward | AAATGTTCAACCAGGGCAG |
| WIPI2 reverse | TTCTGAATTGTGGCTAGCG |
| miR‐15a‐5p forward | TAGCAGCACATAATGGTTTGTG |
| miR‐15a‐5p reverse | CTCTACAGCTATATTGCCAGCC |
| miR‐3911 forward | TGTGTGGATCCTGGAGGAG |
| miR‐3911 reverse | CTCTACAGCTATATTGCCAGCCAC |
| miR‐15b‐5p forward | TAGCAGCACATCATGGTTTACA |
| miR‐15b‐5p reverse | CTCTACAGCTATATTGCCAGCCA |
| miR‐6838‐5p forward | AAGCAGCAGTGGCAAGACTC |
| miR‐6838‐5p reverse | CTCTACAGCTATATTGCCAGCCAC |
| miR‐16‐5p forward | TAGCAGCACGTAAATATTGGCG |
| miR‐16‐5p reverse | CTCTACAGCTATATTGCCAGCCAC |
| miR‐424‐5p forward | CAGCAGCAATTCATGTTTTGAA |
| miR‐424‐5p reverse | CTCTACAGCTATATTGCCAGCCAC |
| KCNC4 forward | CAAGTCTGAGGAGACTTCCC |
| KCNC4 reverse | TTCTGCTTAGAGTCTGCCC |
| AP2B1 forward | AATTCATCATGGGAGCACTG |
| AP2B1 reverse | ATAACCTGAGGCTGTTCCA |
| SRSF11 forward | ACCCACTTACCCAGATTGG |
| SRSF11 reverse | CAAGTTTGCTCCAGGAAGC |
| PISD forward | ATCACTACCGCAACCTCAG |
| PISD reverse | ATCCGATGGGCTAATCACG |
| GAPDH forward | GATCATCAGCAATGCCTCC |
| GAPDH reverse | TCCACGATACCAAAGTTGTC |
| U6 forward | ACTTTGGCAGCACATATACC |
| U6 reverse | CTCATTCAGAGGCCATGCT |
2.6. Western blotting
Cells were lysed using RIPA buffer containing protease and phosphatase inhibitors (Roche, Shanghai, China). Protein was quantified using BCA Protein Assay Kits (Pierce, Appleton, WI) followed by separation using 10% SDS–PAGE. Next, the protein was transferred to a PVDF membrane, and the membrane was blocked in 5% skim milk and then incubated with primary antibodies (Abcam, Cambridge, UK), including anti‐Bcl‐2 (ab32124, 1:1000), anti‐WIPI2 (1:1000, ab105459), anti‐Bax (ab32503, 1:1000), and anti‐GAPDH (ab8245, 1:500), overnight at 4°C. GAPDH was set as the loading control. Then, the protein was incubated with secondary antibodies (Abcam) for over 2 h at room temperature following the manufacturer's recommendations. The bands were visualized utilizing an enhanced chemiluminescence system (ECL; Pierce, Rockford, IL) and analyzed by ImageJ software v. 1.49.
2.7. Ethynyl deoxyuridine incorporation assay
Ethynyl deoxyuridine (EdU) assay kits (RiboBio, Guangzhou, China) were employed for cell proliferation detection. The transfected cells were plated in 96‐well plates and cultured for 2 h at 37°C. Subsequently, cells were stained with DAPI solution (Sigma‐Aldrich, St. Louis, MO) for 5 min at room temperature and then visualized under an inverted fluorescence microscope (Olympus, Tokyo, Japan).
2.8. Colony formation assay
After inoculation into 6‐well plates (1000 cells/well), cells were incubated with DMEM containing 10% FBS. The medium was changed every 3 days. After incubation, phosphate‐buffered saline (PBS) washing was performed twice. Next, the colonies were immobilized by methanol for 10 min and then stained with crystal violet (Beyotime, Shanghai, China) for 5 min. Finally, colonies (a diameter ≥100 μm) were counted manually under a microscope (Olympus).
2.9. Flow cytometry analysis
After culturing in 6‐well plates for 48 h, the cells were washed and resuspended in PBS. Annexin V‐fluorescein isothiocyanate/propidium iodide kits (BD Bioscience, Franklin Lakes, NJ) were applied for cell apoptosis detection. Finally, cell apoptosis was examined by flow cytometry (BD Biosciences).
2.10. Luciferase reporter assay
The wild‐type (Wt) or mutant (Mut) interacting sequence of CERS6‐AS1 or WIPI2 3′‐UTR sharing a binding area with miR‐195‐5p was subcloned into pmirGLO luciferase vectors (Promega, Madison, WI) to establish CERS6‐AS1‐Wt/Mut reporters. Phusion site‐directed mutagenesis kits (Thermo Fisher Scientific) were utilized to mutate the predicted binding site. CERS6‐AS1‐Wt/Mut reporters were co‐transfected with miR‐195‐5p mimics or NC mimics into BxPC‐3 or PANC‐1 cells, while WIPI2‐Wt/Mut reporters were co‐transfected with miR‐195‐5p mimics, pcDNA3.1/CERS6‐AS1 vectors or NC mimics into cells. The relative luciferase activities of the above reporters were examined by the luciferase reporter assay system (Promega).
2.11. RNA immunoprecipitation assay
The binding capacity between miR‐195‐5p and CERS5‐AS1 (or WIPI2) was examined using RNA immunoprecipitation (RIP) kits (Geneseed, Guangzhou, China). The treated cells were lysed with RIPA buffer and then incubated with magnetic beads coated with anti‐Argonaute‐2 (anti‐Ago2; 1:30, ab186733, Abcam) or the control anti‐IgG (1:100, ab109761, Abcam). Proteinase K was used to isolate immunoprecipitated RNAs. After RNA purification, the enrichment of RNAs was subjected to RT‐qPCR detection.
2.12. RNA pull‐down assay
RNA pull‐down assays were performed to estimate the relationship between CERS6‐AS1 and miR‐195‐5p. Wt‐miR‐195‐5p and NC‐miRNA were labeled with biotin and transfected into BxPC‐3 and PANC‐1 cells. Then, the cells were lysed in lysis buffer, and the cell lysates were incubated on ice for 5 min followed by centrifugation. Next, the supernatant was incubated at 4°C with streptavidin magnetic beads (Thermo Fisher Scientific) for 4 h. Subsequently, the beads were rinsed with precooled lysis buffer and salt buffer. Pull‐down RNAs were isolated to measure miR‐195‐5p levels.
2.13. Subcellular fractionation assay
Cytoplasmic and nuclear RNA purification kits (Invitrogen) were utilized to separate the nuclear and cytosolic portions of PC cells. Briefly, cells were incubated with lysis solution for 10 min on ice followed by centrifugation at 12,000g for 2 min. Finally, the expression levels of CERS6‐AS1, GAPDH (cytoplasm control), and U6 (nucleus control) were detected by RT–qPCR. The relative ratios of CERS6‐AS1, GAPDH, and U6 in the cytoplasm or nucleus are presented as percentages of the total RNA. GAPDH was used as a control for the cytoplasm, while U6 was used for the nucleus.
2.14. Statistical analysis
SPSS 20.0 Software (Chicago, IL) was employed for statistical analyses. To identify gene expression correlations in PC tissues, Spearman's correlation analysis was conducted. Differences between two or more genes were compared by Student's t tests or one‐way ANOVA and Tukey's post hoc analyses. Data are shown as the mean ± standard deviation. Each assay was performed at least three times. The p < 0.05 was defined as statistically significant.
3. RESULTS
3.1. CERS6‐AS1 exhibits high expression in PC tissues and cells
Based on GEPIA analysis, CERS6‐AS1 was highly expressed in 179 pancreatic adenocarcinoma (PAAD) tissues compared with 171 normal tissues (Figure 1A). RT‐qPCR showed that CERS6‐AS1 was highly expressed in 50 PC tissues compared with 50 adjacent nontumor tissues (Figure 1B). Patients with high CERS6‐AS1 levels had shorter overall survival than those with low CERS6‐AS1 levels, as shown by a Kaplan–Meier survival curve (Figure 1C). Similarly, high CERS6‐AS1 expression was observed in four PC cell lines (AsPC‐1, Capan‐2, BxPC‐3, and PANC‐1) compared with that in the control HPDE cell line, as shown by RT‐qPCR (Figure 1D). Additionally, high expression of CERS6‐AS1 was more significant in PANC‐1 and BxPC‐3 cell lines than in the other two cell lines. Thus, BxPC‐3 and PANC‐1 cells were identified for subsequent experiments. Later, CERS6‐AS1 expression was silenced in cells transfected with sh‐CERS6‐AS1#1/2 (Figure 1E). As shown by colony formation assays and EdU assays, downregulation of CERS6‐AS1 decreased the number of colonies and EdU‐positive cells, indicating that the viability and proliferation of PC cells were suppressed by silencing CERS6‐AS1 (Figure 1F,G). Furthermore, as indicated by flow cytometry analyses, cell apoptosis was decreased by CERS6‐AS1 depletion (Figure 1H). According to Western blotting, depletion of CERS6‐AS1 reduced the Bcl‐2 protein levels while upregulating the protein level of Bax in cells (Figure 1I). Overall, CERS6‐AS1 is highly expressed in pancreatic tissues and cells, and CERS6‐AS1 deficiency inhibits cell viability and proliferation while enhancing cell apoptosis in PC.
FIGURE 1.
CERS6‐AS1 exhibits high expression in PC tissues and cells. (A) CERS6‐AS1 expression in pancreatic adenocarcinoma (PAAD) was predicted from the GEPIA website. (B) RT‐qPCR was performed to test CERS6‐AS1 expression in 50 PC tissues and noncancerous tissues. (C) The Kaplan–Meier analysis of the correlation between CERS6‐AS1 level and overall survival of 50 patients with PC is shown. (D) CERS6‐AS1 expression in the normal pancreatic cell line HPDE and four cancerous cell lines was measured by RT‐qPCR analysis. (E) Knockdown efficiency of CERS6‐AS1 in PC cells was examined by RT‐qPCR. (F) EdU assays were conducted to examine the effect of silenced CERS6‐AS1 on cell viability. (G) The influence of CERS6‐AS1 deficiency on cell proliferation was measured by colony formation assays. (H) Cell apoptosis after transfection with sh‐CERS6‐AS1#1/2 was probed by flow cytometry. (I) Protein levels of apoptotic markers in PC cells were evaluated by Western blotting. *p < 0.05, ***p < 0.001
3.2. CERS6‐AS1 interacts with miR‐195‐5p in PC
First, we conducted subcellular fractionation assays to detect the distribution of CERS6‐AS1 in cells. As a result, CERS6‐AS1 was mainly located in the cytoplasm, indicating that CERS6‐AS1 functions post‐transcriptionally (Figure 2A). Then, we sought possible miRNAs binding with CERS6‐AS1 using starBase and identified seven putative miRNAs under the screening condition of CLIP‐Data ≥1 (Figure 2B). RT–qPCR was utilized to examine the expression levels of candidate miRNAs in BxPC‐3, PANC‐1, and the control HPDE cell lines, suggesting that only miR‐195‐5p was significantly expressed at low levels in PC cells (Figure 2C). Afterwards, the predicted binding sequence site between CERS6‐AS1 and miR‐195‐5p was searched at the starBase website, and the sequence of CERS6‐AS1 was mutated (Figure 2D). The overexpression efficiency of miR‐195‐5p in cells was examined by RT–qPCR. As shown in Figure 2E, miR‐195‐5p expression was markedly upregulated in cancer cells. As shown by luciferase reporter assays, the luciferase activity of CERS6‐AS1‐Wt was significantly decreased by miR‐195‐5p mimics, while there was no obvious change in the luciferase activity of the CERS6‐AS1‐Mut group (Figure 2F). The results of RNA pull‐down assays revealed that CERS6‐AS1‐Wt upregulation decreased miR‐195‐5p expression in BxPC‐3 and PANC‐1 cells, while CERS6‐Mut upregulation had no obvious influence on miR‐195‐5p expression (Figure 2G). Based on Spearman's correlation coefficient, miR‐195‐5p expression was negatively correlated with CERS6‐AS1 expression in PC tissues (Figure 2H). As shown by RT‐qPCR, miR‐195‐5p expression was decreased in PC tissues (Figure 2I).
FIGURE 2.
CERS6‐AS1 interacts with miR‐195‐5p in PC. (A) CERS6‐AS1 was mainly localized in the cytoplasm of PC cells according to subcellular fractionation assays. (B) The seven miRNAs interacting with CERS6‐AS1 were conjectured by the starBase website. (C) RT‐qPCR was conducted to examine the expression levels of candidate miRNAs in BxPC‐3, PANC‐1, and control HPDE cells. (D) The potential binding region between CERS6‐AS1 and miR‐195‐5p was found using the starBase website. (E) The overexpression efficiency of miR‐195‐5p mimics in cells was examined by RT–qPCR. (F) Luciferase reporter assays were conducted to examine the luciferase activity of CERS6‐AS1‐Wt/Mut in BxPC‐3 and PANC‐1 cells transfected with NC mimics or miR‐195‐5p mimics. (G) A pull‐down assay was conducted to estimate the reaction between miR‐195‐5p and CERS6‐AS1‐Wt or CERS6‐AS1‐Mut. (H) Correlation between CERS6‐AS1 expression and miR‐195‐5p expression in PC tissues was identified by Spearman's correlation analysis. (I) miR‐195‐5p expression in tissues was detected by RT–qPCR. ***p < 0.001
3.3. CERS6‐AS1 upregulates WIPI2 by interacting with miR‐195‐5p
Subsequently, we searched downstream targets of miR‐195‐5p using starBase. We identified five candidate genes (KCNC4, WIPI2, AP2B1, SRSF11, and PISD) interacting with miR‐195‐5p according to the criteria of CLIP Data ≥5 and Degradome Data ≥3 (Figure 3A). Next, we detected the expression of candidate genes in cells transfected with miR‐195‐5p mimics or NC mimics using RT‐qPCR. We discovered that only WIPI2 expression was markedly decreased by miR‐195‐5p overexpression (Figure 3B). Thereafter, WIPI2 was identified for further study. GEPIA revealed high expression of WIPI2 in 179 PAAD tissue samples compared with 171 noncancerous tissue samples (Figure 3C). In addition, CERS6‐AS1 expression positively correlated with WIPI2 expression in PAAD tissues according to the GEPIA analysis (Figure 3C). RT‐qPCR illustrated that knockdown of CERS6‐AS1 reduced the expression of WIPI2 in cells (Figure 3D). Moreover, WIPI2 was highly expressed in 50 pancreatic tissues (Figure 3E). Spearman's correlation analysis suggested that WIPI2 expression was negatively associated with miR‐195‐5p expression but positively correlated with CERS6‐AS1 expression in pancreatic tissues (Figure 3F). In addition, WIPI2 expression at both the mRNA and protein levels was upregulated in pancreatic cell lines (Figure 3G). The binding area between miR‐195‐5p and WIPI2 was obtained from starBase (Figure 3H). As shown by luciferase reporter assays, overexpressing miR‐195‐5p reduced the luciferase activity of the WIPI2‐Wt reporter, while CERS6‐AS1 overexpression partially rescued the decrease, and the luciferase activity of WIPI2‐Mut exhibited no significant changes compared with that in the NC mimic group (Figure 3I). Additionally, CERS6‐AS1, miR‐195‐5p, and WIPI2 were abundantly enriched in the anti‐Ago2 group but not in the anti‐IgG control group, indicating that CERS6‐AS1, miR‐195‐5p, and WIPI2 coexisted in RNA‐induced silencing complexes (Figure 3J).
FIGURE 3.
CERS6‐AS1 upregulates WIPI2 by binding with miR‐195‐5p. (A) Five candidate downstream target genes for CERS6‐AS1 were predicted from the starBase website. (B) Expression levels of these mRNAs in PC cells transfected with miR‐195‐5p mimics or NC mimics were examined by RT–qPCR analysis. (C) The GEPIA database showed high expression of WIPI2 in pancreatic adenocarcinoma (PAAD) tissues (n = 179) and a positive correlation between CERS6‐AS1 and WIPI2 in PAAD tissues. (D) RT–qPCR was conducted to measure the effect of sh‐CERS6‐AS1#1/2 on WIPI2 expression in cells. (E) WIPI2 expression in PC tissues was determined by RT–qPCR. (F) Based on Spearman's correlation coefficient, the expression relationship between WIPI2 and miR‐195‐5p (or CERS6‐AS1) in PC tissues was identified. (G) The mRNA and protein levels of WIPI2 in PC cells were detected by RT–qPCR and Western blotting. (H) The potential binding site between miR‐195‐5p and WIPI2 was conjectured by starBase. (I) Luciferase reporter assays were conducted to determine the luciferase activity of WIPI2‐Wt reporters and WIPI2‐Mut reporters in cells transfected with miR‐195‐5p mimics, miR‐195‐5p mimics + pcDNA3.1/CERS6‐AS1, or NC mimics. (J) RIP assays were conducted to explore whether CERS6‐AS1, miR‐195‐5p, and WIPI2 can be enriched in RNA‐induced silencing complexes. ***p < 0.001
3.4. CERS6‐AS1 promotes cell proliferation while inhibiting cell apoptosis by upregulating WIPI2 in PC
To investigate whether CERS6‐AS1 affected cell viability, proliferation and apoptosis by regulating WIPI2 in PC, we performed rescue assays. WIPI2 was successfully overexpressed by pcDNA3.1/WIPI2 in PC cells (Figure 4A). Colony formation assays suggested that WIPI2 overexpression partially rescued the inhibitory effect of silencing CERS6‐AS1 on cell viability (Figure 4B). EdU assays showed that overexpression of WIPI2 rescued the repressive effect of silenced CERS6‐AS1 on cell proliferation (Figure 4C,D). Moreover, the enhancement of CERS6‐AS1 depletion on cell apoptosis was partially reversed by pcDNA3.1/WIPI2, as shown by flow cytometry analysis (Figure 4E,F). Downregulation of Bcl‐2 protein levels and the increase in Bax protein levels mediated by CERS6‐AS1 knockdown in cells were reversed by WIPI2 overexpression according to the Western blot analysis (Figure 4G). In conclusion, CERS6‐AS1 promotes cell proliferation while suppressing cell apoptosis by upregulating WIPI2 in PC.
FIGURE 4.
CERS6‐AS1 promotes cell proliferation while inhibiting cell apoptosis by upregulating WIPI2 in PC. (A) The overexpression efficiency of pcDNA3.1/WIPI2 in PC cells was revealed by RT–qPCR. (B‐D) Colony formation assays and EdU assays were conducted to measure the viability and proliferation of PC cells transfected with sh‐CERS6‐AS1#1, sh‐CERS6‐AS1#1 + pcDNA3.1/WIPI2, or sh‐NC. (E‐F) Flow cytometry analyses were conducted to detect cell apoptosis. (G) Protein levels of apoptotic markers in PC cells were determined by Western blotting. **p < 0.01, ***p < 0.001
3.5. Diagram of the ceRNA network mediated by CERS6‐AS1 in PC
The ceRNA network mediated by CERS6‐AS1 is depicted in Figure 5. CERS6‐AS1 functions as a ceRNA to upregulate WIPI2 by interacting with miR‐195‐5p, thus promoting PC cell proliferation and inhibiting cell apoptosis.
FIGURE 5.
Graphical abstract of the CERS6‐AS1/miR‐195‐5p/WIPI2 regulatory network in PC cells. The CERS6‐AS1 and WIPI2 expression levels are high, while miR‐195‐5p expression is decreased in PC cells. WIPI2 is a direct target gene of miR‐195‐5p. CERS6‐AS1 functions as a ceRNA to upregulate WIPI2 by interacting with miR‐195‐5p, thus promoting PC cell proliferation while inhibiting cell apoptosis
4. DISCUSSION
Recently, increasing sequencing data have demonstrated that multiple lncRNAs are dysregulated in various diseases, including PC. 19 , 20 In the current study, lncRNA CERS6‐AS1 was abnormally highly expressed in PC tissues and cells. Silencing CERS6‐AS1 inhibits cell viability and proliferation while enhancing cell apoptosis in PC. Therefore, CERS6‐AS1 plays an oncogenic role in PC.
According to the ceRNA hypothesis, lncRNAs exert their biological effects on the development of cancers by acting as ceRNAs to upregulate the expression of target genes of miRNAs post‐transcriptionally. 21 Herein, CERS6‐AS1 was primarily localized in the cytoplasm, suggesting that CERS6‐AS1 functions at the posttranscriptional level. Subsequently, we investigated downstream molecules of CERS6‐AS1 under the ceRNA mechanism.
MicroRNAs (miRNAs) are short, single‐stranded RNA molecules containing 18–25 nucleotides that regulate biological processes post‐transcriptionally. 22 A previous study reported that CERS6‐AS1 upregulation and correlation with poor prognosis in patients with hepatocellular carcinoma might be a potential lncRNA that binds to miR‐195‐5p. 23 In this study, miR‐195‐5p was identified as the downstream miRNA of CERS6‐AS1 in PC. Previously, it was reported that miR‐195‐5p acts as an antioncogene in many types of cancer, including colon, 24 bladder, 25 lung, 26 and esophageal cancer. 27 For example, lncRNA BANCR was reported to promote the tumorigenesis of PC by targeting miR‐195‐5p and regulating the Wnt/β‐catenin signaling pathway. 28 LINC00473 interacts with miR‐195‐5p to elevate PD‐L1 expression, thereby promoting the progression of PC. 29 In our study, miR‐195‐5p expression was decreased in PC cells and tissues. MiR‐195‐5p expression correlates negatively with CERS6‐AS1 expression in PC tissues. Moreover, CERS6‐AS1 interacts with miR‐195‐5p to enhance WIPI2 expression.
Furthermore, WIPI2 is a direct target for miR‐195‐5p. As a member of the WD‐repeat protein family, WIPI2 is essential for regulation of the cell cycle and apoptosis. 30 WIPI2 regulates the proliferation of hepatocellular carcinoma cells by activating AMPK signaling. 31 Our results showed that WIPI2 exhibits high expression in PC cells and tissues. WIPI2 expression was positively associated with CERS6‐AS1 expression but negatively correlated with miR‐195‐5p expression in PC tissues and cells. Moreover, overexpressing WIPI2 rescues the inhibitory effect of CERS6‐AS1 depletion on cell proliferation and viability and reverses the enhancement of cell apoptosis mediated by CERS6‐AS1 deficiency.
In summary, our study indicated that CERS6‐AS1 promotes PC cell proliferation and represses cell apoptosis by interacting with miR‐195‐5p to increase WIPI2 expression. This study might provide novel insight into the ceRNA role of CERS6‐AS1 in PC.
CONFLICT OF INTEREST
The authors announce no conflicts of interest in this study.
Gao K‐F, Zhao Y‐F, Liao W‐J, Xu G‐L, Zhang J‐D. CERS6‐AS1 promotes cell proliferation and represses cell apoptosis in pancreatic cancer via miR‐195‐5p/WIPI2 axis. Kaohsiung J Med Sci. 2022;38(6):542–553. 10.1002/kjm2.12522
REFERENCES
- 1. Chen Y, Ren B, Yang J, Wang H, Yang G, Xu R, et al. The role of histone methylation in the development of digestive cancers: a potential direction for cancer management. Signal Transduct Target Ther. 2020;5(1):143. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Garg SK, Chari ST. Early detection of pancreatic cancer. Curr Opin Gastroenterol. 2020;36(5):456–61. [DOI] [PubMed] [Google Scholar]
- 3. Wang Y, Ding X, Hu H, He Y, Lu Z, Wu P, et al. Long non‐coding RNA lnc‐PCTST predicts prognosis through inhibiting progression of pancreatic cancer by downregulation of TACC‐3. Int J Cancer. 2018;143(12):3143–54. [DOI] [PubMed] [Google Scholar]
- 4. Mizrahi JD, Surana R, Valle JW, Shroff RT. Pancreatic cancer. Lancet. 2020;395(10242):2008–20. [DOI] [PubMed] [Google Scholar]
- 5. Bouvier AM, Uhry Z, Jooste V, Drouillard A, Remontet L, Launoy G, et al. Focus on an unusual rise in pancreatic cancer incidence in France. Int J Epidemiol. 2017;46(6):1764–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6. Sui J, Yang X, Qi W, Guo K, Gao Z, Wang L, et al. Long non‐coding RNA Linc‐USP16 functions as a tumour suppressor in hepatocellular carcinoma by regulating PTEN expression. Cell Physiol Biochem. 2017;44(3):1188–98. [DOI] [PubMed] [Google Scholar]
- 7. Zhu H, Shan Y, Ge K, Lu J, Kong W, Jia C. LncRNA CYTOR promotes pancreatic cancer cell proliferation and migration by sponging miR‐205‐5p. Pancreatology. 2020;20(6):1139–48. [DOI] [PubMed] [Google Scholar]
- 8. Bhan A, Soleimani M, Mandal SS. Long noncoding RNA and cancer: a new paradigm. Cancer Res. 2017;77(15):3965–81. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Yonemori K, Kurahara H, Maemura K, Natsugoe S. MicroRNA in pancreatic cancer. J Hum Genet. 2017;62(1):33–40. [DOI] [PubMed] [Google Scholar]
- 10. Lou W, Ding B, Fu P. Pseudogene‐derived lncRNAs and their miRNA sponging mechanism in human cancer. Front Cell Dev Biol. 2020;8:85. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Weng W, Zhang Z, Huang W, Xu X, Wu B, Ye T, et al. Identification of a competing endogenous RNA network associated with prognosis of pancreatic adenocarcinoma. Cancer Cell Int. 2020;20:231. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Han Q, Li J, Xiong J, Song Z. Long noncoding RNA LINC00514 accelerates pancreatic cancer progression by acting as a ceRNA of miR‐28‐5p to upregulate Rap1b expression. J Exp Clin Cancer Res. 2020;39(1):151. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Gao H, Gong N, Ma Z, Miao X, Chen J, Cao Y, et al. LncRNA ZEB2‐AS1 promotes pancreatic cancer cell growth and invasion through regulating the miR‐204/HMGB1 axis. Int J Biol Macromol. 2018;116:545–51. [DOI] [PubMed] [Google Scholar]
- 14. Yun Z, Meng F, Li S, Zhang P. Long non‐coding RNA CERS6‐AS1 facilitates the oncogenicity of pancreatic ductal adenocarcinoma by regulating the microRNA‐15a‐5p/FGFR1 axis. Aging (Albany NY). 2021;13(4):6041–54. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Shen R, Wang X, Wang S, Zhu D, Li M. Long noncoding RNA CERS6‐AS1 accelerates the proliferation and migration of pancreatic cancer cells by sequestering MicroRNA‐15a‐5p and MicroRNA‐6838‐5p and modulating HMGA1. Pancreas. 2021;50(4):617–24. [DOI] [PubMed] [Google Scholar]
- 16. Tang Z, Li C, Kang B, Gao G, Li C, Zhang Z. GEPIA: a web server for cancer and normal gene expression profiling and interactive analyses. Nucleic Acids Res. 2017;45(W1):W98–102. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Li JH, Liu S, Zhou H, Qu LH, Yang JH. starBase v2.0: decoding miRNA‐ceRNA, miRNA‐ncRNA and protein‐RNA interaction networks from large‐scale CLIP‐Seq data. Nucleic Acids Res. 2014;42:D92–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real‐time quantitative PCR and the 2(‐delta delta C[T]) method. Methods. 2001;25(4):402–8. [DOI] [PubMed] [Google Scholar]
- 19. Harrow J, Frankish A, Gonzalez JM, Tapanari E, Diekhans M, Kokocinski F, et al. GENCODE: the reference human genome annotation for the ENCODE project. Genome Res. 2012;22(9):1760–74. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Peng JF, Zhuang YY, Huang FT, Zhang SN. Noncoding RNAs and pancreatic cancer. World J Gastroenterol. 2016;22(2):801–14. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Tay Y, Rinn J, Pandolfi PP. The multilayered complexity of ceRNA crosstalk and competition. Nature. 2014;505(7483):344–52. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Xu B, Liu J, Xiang X, Liu S, Zhong P, Xie F, et al. Expression of miRNA‐143 in pancreatic cancer and its clinical significance. Cancer Biother Radiopharm. 2018;33(9):373–9. [DOI] [PubMed] [Google Scholar]
- 23. Zhang J, Lou W. A key mRNA‐miRNA‐lncRNA competing endogenous RNA triple sub‐network linked to diagnosis and prognosis of hepatocellular carcinoma. Front Oncol. 2020;10:340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Gu H, Xu Z, Zhang J, Wei Y, Cheng L, Wang J. circ_0038718 promotes colon cancer cell malignant progression via the miR‐195‐5p/Axin2 signaling axis and also effect Wnt/β‐catenin signal pathway. BMC Genom. 2021;22(1):768. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. Wang H, Niu X, Jiang H, Mao F, Zhong B, Jiang X, et al. Long non‐coding RNA DLX6‐AS1 facilitates bladder cancer progression through modulating miR‐195‐5p/VEGFA signaling pathway. Aging (Albany, NY). 2020;12(16):16021–34. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Xiong S, Li D, Wang D, Huang L, Liang G, Wu Z, et al. Circular RNA MYLK promotes glycolysis and proliferation of non‐small cell lung cancer cells by sponging miR‐195‐5p and increasing glucose transporter member 3 expression. Cancer Manag Res. 2020;12:5469–78. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Shen S, Li K, Liu Y, Liu X, Liu B, Ba Y, et al. Silencing lncRNA AGAP2‐AS1 upregulates miR‐195‐5p to repress migration and invasion of EC cells via the decrease of FOSL1 expression. Mol Ther Nucleic Acids. 2020;20:331–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Wu X, Xia T, Cao M, Zhang P, Shi G, Chen L, et al. LncRNA BANCR promotes pancreatic cancer tumorigenesis via modulating MiR‐195‐5p/Wnt/β‐catenin signaling pathway. Technol Cancer Res Treat. 2019;18:1–13. [DOI] [PMC free article] [PubMed] [Google Scholar] [Retracted]
- 29. Zhou WY, Zhang MM, Liu C, Kang Y, Wang JO, Yang XH. Long noncoding RNA LINC00473 drives the progression of pancreatic cancer via upregulating programmed death‐ligand 1 by sponging microRNA‐195‐5p. J Cell Physiol. 2019;234(12):23176–89. [DOI] [PubMed] [Google Scholar]
- 30. Yu TW, Mochida GH, Tischfield DJ, Sgaier SK, Flores‐Sarnat L, Sergi CM, et al. Mutations in WDR62, encoding a centrosome‐associated protein, cause microcephaly with simplified gyri and abnormal cortical architecture. Nat Genet. 2010;42(11):1015–20. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Liu C, Li F, Li X, Cao M, Feng G, Yuan X, et al. WIPI2 depletion inhibits the growth of hepatocellular carcinoma cells through the AMPK signaling pathway. Oncol Rep. 2020;43(5):1467–78. [DOI] [PMC free article] [PubMed] [Google Scholar]