Knockdown of ubiquitin‐specific peptidase 13 inhibits cell growth of hepatocellular carcinoma by reducing c‐Myc expression

Abstract

Ubiquitin‐specific peptidase 13 (USP13) has been reported to be involved in the tumorigenesis of several tumors, but its function in tumors is still controversial. In this study, the function of USP13 in hepatocellular carcinoma (HCC) was investigated, and we found that USP13 was significantly upregulated in both of primary HCC tumor tissues and cell lines. And HCC patients with high USP13 expression had a shorter overall survival or relapse‐free survival than patients with low USP13 expression. In HCC cell lines, knockdown of USP13 by shRNAs markedly decreased HCC cell growth, and mechanistic investigations revealed that USP13 knockdown could markedly downregulate the expression levels of c‐Myc. Moreover, overexpression of c‐Myc could significantly attenuate the effects of shUSP13 on HCC cell growth inhibition. In addition, in vivo experiments showed that knockdown of USP13 could significantly inhibit xenograft tumor growth of HCC. Taken together, our present study provided the first evidence that USP13 acted as a novel driver in HCC tumorigenesis by regulating c‐Myc expression, and targeting USP13 could be a promising strategy for HCC therapy.

1. INTRODUCTION

Hepatocellular carcinoma (HCC) accounts for more than 80% of primary liver cancer in the world, which is the most common form of liver cancer. ¹ Although the global medical technology has been improved significantly, the prognosis of HCC patients is very poor, and the 5‐year survival rate is less than 20%. ² HCC is now a major health burden and represents one of the main causes of tumor‐related mortality in the world. ³ Therefore, to further understand the pathogenesis of HCC is very critical for the treatment of HCC in the future.

With the in‐depth study of ubiquitin‐proteasome system in tumors, more and more evidences show that the disorder of deubiquiting enzymes (DUBs) is closely associated with the pathogenesis of HCC. ⁴ A recent paper reported that the DUB proteasome 26S subunit, non‐ATPase 14 (PSMD14) was elevated in HCC, and PSMD14 exerted its oncogenic function by promoting HCC cell growth, migration, and invasion. ⁵ In mechanism, PSMD14 was identified as a DUB of GRB2, an oncoprotein in HCC, and PSMD14 could stabilize GRB2 by reducing its polyubiquitination in HCC cells. ⁵ Another paper reported that the DUB ubiquitin‐specific peptidase 21 (USP21) was highly amplified and overexpressed in HCC, and predicted a negative index for HCC patients. ⁶ In mechanism, USP21 promoted HCC cell proliferation and cell cycle progression by stabilizing MEK2. ⁶ In addition, the DUB ubiquitin‐specific peptidase 16 (USP16) was reported to be downregulated by HBV X protein (HBx), which has been proved to promote HCC tumor growth and metastasis. ⁷

Ubiquitin‐specific peptidase 13 (USP13), studied in this paper, was also an important DUB in several tumors. For example, USP13 was found amplified in non‐small cell lung cancer (NSCLC), and promoted NSCLC cell proliferation by inducing AKT/MAPK signaling, which indicated that USP13 was an oncogene in NSCLC. ⁸ USP13 was also reported to be amplified in ovarian cancer and USP13 could drive ovarian cancer metabolism. ⁹ It was also reported that USP13 could stabilize c‐Myc by reducing its ubiquitination mediated by FBXL14, and then it could maintain glioblastoma stem cells. ¹⁰ Collectively, targeting USP13 could be as a novel strategy for tumor therapy.

2. MATERIALS AND METHODS

2.1. Cell culture

The normal liver cell line L‐02, four human HCC cell lines (Hep3B, Huh‐7, SK‐hep‐1, and SNU‐387) and HEK293T cell line were obtained from ATCC (Manassas, Virginia). HEK293T cells were cultured in DMEM medium (Hyclone), and other liver cell lines were cultured in RPMI 1640 medium (Hyclone). All media were supplemented with 10% fatal bovine serum (FBS) and 1% penicillin/streptomycin.

2.2. Human HCC samples

Sixteen pairs of human HCC samples and their matched normal paracancerous tissues (tissues 2 cm from the focus) were obtained from the Second Affiliated Hospital of Soochow University. Surgical tissues were immediately frozen in liquid nitrogen and stored at −80°C. The collection and use of human HCC tissues were approved by the Institutional Review Board of the Second Affiliated Hospital of Soochow University.

2.3. Quantitative real‐time polymerase chain reaction (qRT‐PCR)

Total RNA in HCC tissues and cells was isolated with Trizol reagent (Invitrogen), and cDNA was subsequently synthesized using reverse transcription kits (RiboBio, Guangzhou, China). Then, qRT‐PCR was performed by using SYBR Green Premix Ex Taq (Takara, Otsu, Japan) according to the manufacturer's instruction. Primers used were as follows: USP13, forward 5′‐ACGTGCCAAGATACCATT‐3′ and reverse 5′‐GGAACCCAGTCAAGACCA‐3′; GAPDH, forward 5′‐TGTGGGCATCAATGGATTTGG‐3′ and reverse 5′‐ACACCATGTATTCCGGGTCAAT‐3′.

2.4. Western blot

Western blot was performed as described previously. ¹¹ The primary antibodies against USP13, GAPDH, and c‐Myc were purchased from Cell Signaling Technology, Danvers, MA. Anti‐HA tag antibody was purchased from Sigma‐Aldrich, Inc.

2.5. Cell growth and viability

Cell viability was analyzed by using 3‐(4,5‐Dimethylthiazol‐2‐yl)‐2,5‐diphenyltetrazolium bromide (MTT) Cell Proliferation and Cytotoxicity Assay Kit (Beyotime, Beijing, China). To analyze cell growth, HCC cells were infected with shNC, shUSP13#1, or shUSP13#2 lentivirus for indicated time, followed by MTT assay according to the manufacturer's instruction.

2.6. DNA constructs, shRNAs, and lentiviral production

The target sequences of shUSP13 were as follows: shUSP13#1 CCGGGCCAGTATCTAAATATGCCAACTCGAGTTGGCATATTTAGATACTGGCTTTTT, shUSP13#2 CCGGCCGGTGAAATCTGAACTCATTCTCGA GAATGAG TTCAGATTTCACCGGTTTTT. shUSP13 lentivirus was produced by using the Thermo Scientific Open Biosystems TransLenti viral packaging system (Thermo Scientific). The human c‐Myc gene was amplified by polymerase chain reaction (PCR), and then cloned into pcDNA3.1 vector with a HA tag. The plasmids were transfected into HCC cells using Lipofectamine2000 (Invitrogen) according to the manufacturer's protocol.

2.7. Xenograft models

SNU‐387 cells stably infected with lentiviral shUSP13#1 or shUSP13#2 were implanted in the right flanks of nude mice (Shanghai SLAC, Shanghai, China). Tumor sizes were measured every other day for continuously 2 weeks (six mice per group). At the end of the experiment, tumors were excised from nude mice. The animal experiments were approved by the Ethics Committee of the Second Affiliated Hospital of Soochow University.

2.8. Statistical analysis

The data were presented as mean ± SD. Analysis of variance test was used to compare the differences between multigroups, and the student t test was used to compare two groups. P < .05 was considered significant.

To analyze USP13 expression in HCC, Gene Expression Profiling Interactive Analysis (GEPIA) database matched with The Cancer Genome Atlas normal data was used online (http://gepia.cancer-pku.cn). To analyze the survival of HCC patients with different expression of USP13, Kaplan‐Meier (KM) Plotter based on the Pan‐Cancer RNA‐seq database was used online (http://kmplot.com). And patients were split by autoselect best cutoff. Cutoff value used in analysis for overall survival was 393, and analysis for relapse‐free survival was 415.

3. RESULTS

3.1. USP13 is elevated in HCC and predicts a negative index for HCC patients

To analyze USP13 expression in HCC, HCC tumor tissues and paired paracancerous tissues were collected. As shown in Figure 1A,B, the qRT‐PCR showed that USP13 was significantly upregulated in HCC tumors. And the Western blot analysis also confirmed that USP13 was elevated in HCC tumor tissues (Figure 1C). Then, to further confirm our findings, the public cancer database GEPIA was used to analyze USP13 expression in HCC. As shown in Figure 1D, USP13 was also significantly upregulated in HCC tumor tissues.

FIGURE 1.

USP13 is elevated in HCC. A, The paracancerous and tumor tissues of HCC were collected for qRT‐PCR against USP13. B, Statistical analysis for Figure 1A. C, The representative HCC tumor tissues were prepared for Western blot analysis against USP13. D, The expression of USP13 in HCC was analyzed by GEPIA database. HCC, hepatocellular carcinoma; qRT‐PCR, quantitative real‐time polymerase chain reaction; USP13, ubiquitin‐specific peptidase 13. *P < .05; **P < .01

Additionally, we also used the public cancer database KM plotter to analyze the survival of HCC patients with different expressions of USP13. As shown in Figure 2A,B, USP13 predicted as a negative index for HCC patients. In specific, HCC patients with high USP13 expression had a shorter overall survival (Figure 2A) or relapse‐free survival (Figure 2B) than patients with low expression. The results above indicated that USP13 was functional in HCC.

FIGURE 2.

USP13 predicts a poor index for patients with HCC. The overall survival A, and relapse‐free survival. B, of HCC patients with low or high expression of USP13 were analyzed by KM plotter. HCC, hepatocellular carcinoma; KM, Kaplan‐Meier; USP13, ubiquitin‐specific peptidase 13

3.2. Knockdown of USP13 inhibits HCC cell growth

Then, to further confirm the function of USP13 in HCC, different HCC cell lines were collected. As shown in Figure 3A,B, both of the qRT‐PCR and Western blot showed that USP13 was markedly upregulated in HCC cell lines compared with the normal liver cell line. Subsequently, USP13 was knocked down by shRNAs in HCC cell lines. As shown in Figure 3C,D, knockdown of USP13 could significantly inhibit the cell growth of Hep3B. And in SNU‐387 cells, USP13 knockdown could also markedly suppress HCC cell growth (Figure 3E,F). These results further confirmed that USP13 was functional in HCC, and may display its effects as a tumor promoter in HCC.

FIGURE 3.

Knockdown of USP13 inhibits HCC cell growth. A and B, Four HCC cell lines and L‐02 were prepared for qRT‐PCR. A, and Western blot B, against USP13. C, Hep3B cells were infected with shNC, shUSP13#1 or shUSP13#2 lentivirus for 72 hours, followed by Western blot against USP13. D, Hep3B cells were infected with shNC, shUSP13#1 or shUSP13#2 lentivirus for indicated times, followed by MTT assay. E, SNU‐387 cells were infected with shNC, shUSP13#1 or shUSP13#2 lentivirus for 72 hours, followed by Western blot. F, SNU‐387 cells were infected with shNC, shUSP13#1 or shUSP13#2 lentivirus for indicated times, followed by MTT assay. HCC, hepatocellular carcinoma; qRT‐PCR, quantitative real‐time polymerase chain reaction; USP13, ubiquitin‐specific peptidase 13. *P < .05; **P < .01; ^$ P < .05; ^$$ P < .01

3.3. Knockdown of USP13 inhibits c‐Myc expression in HCC cells

In order to further analyze the mechanism of USP13 in promoting HCC cell growth, we detected the expression level of the known substrate protein of USP13. As shown in Figure 4A, knockdown of USP13 could markedly inhibit the expression of c‐Myc, a known substrate of USP13, in both of Hep3B and SNU‐387 cells. Moreover, overexpression of c‐Myc could significantly attenuate the effects of shUSP13‐driven HCC cell growth inhibition in both of Hep3B and SNU‐387 cells (Figure 4B,C). And the gene transduction efficiencies of shUSP13 and c‐Myc were determined by Western blot analysis (Figure 4D). These results suggested that USP13 exerted its effects by regulating c‐Myc expression in HCC cells.

FIGURE 4.

Knockdown of USP13 inhibits c‐Myc expression in HCC cells. A, Hep3B and SNU‐387 cells were infected with shNC, shUSP13#1, or shUSP13#2 lentivirus for 72 hours, followed by Western blot. B and C. Hep3B. B, and SNU‐387 C, cells were infected with shUSP13#1 lentivirus or transfected with c‐Myc plasmids for 72 hours, followed by MTT assay. D, Above cells were also prepared for Western blot. HCC, hepatocellular carcinoma; USP13, ubiquitin‐specific peptidase 13. *P < .05; **P < .01

3.4. Knockdown of USP13 inhibits HCC tumor growth in vivo

Above results indicated that knockdown of USP13 inhibited cell growth by reducing c‐Myc expression in HCC cell lines. To further confirm it, the xenograft model was established to evaluate the effects of USP13 in vivo. As shown in Figure 5A, the tumor growth curve showed that knockdown of USP13 could significantly inhibit tumor growth. At the end of the experiment, tumors were excised from nude mice, and we found that the tumor size and weight in shUSP13 groups were significantly decreased compared with the control (Figure 5B,C). Additionally, the excised tumors were lysed for Western blot, and we also found that USP13 knockdown markedly suppressed c‐Myc expression (Figure 5D).

FIGURE 5.

Knockdown of USP13 inhibits HCC tumor growth in vivo. A, The tumor growth curve. B, At the end of the experiment, tumors were excised from nude mice. C, Tumor weight was measured. D, The excised tumors were prepared for Western blot against USP13. HCC, hepatocellular carcinoma; USP13, ubiquitin‐specific peptidase 13. *P < .05; **P < .01; ^$ P < .05; ^$$ P < .01

4. DISCUSSION

In the current study, for the first time, we found that USP13 was elevated in both of HCC tumor tissues and cell lines, and predicted a negative index for HCC patients. And knockdown of USP13 inhibited the cell growth and tumor growth in HCC. Thus, our results indicated that USP13 displayed its oncogenic effects in HCC, which was consistent with previous reports. Previous studies showed that USP13 could be as an oncogene, and promote several cancer progression, such as in NSCLC, glioblastoma, ovarian cancer, and melanoma.8, 9, 10, 12 Additionally, in prostate cancer, the application of Spautin‐1, a known inhibitor of USP10 and USP13, could obviously induce cell death under glucose‐deprivation condition by suppressing EGFR activation and its downstream signals. ¹³ Based on these information, we proposed that inhibiting USP13 could be as a potential therapeutic strategy for the treatment of HCC in the future. In addition, USP13 has been also reported to be a tumor suppressor in oral squamous cell carcinoma and human bladder cancer.14, 15 In oral squamous cell carcinoma, overexpression of USP13 could markedly inhibit cell proliferation in vitro, and suppress tumor growth in vivo by regulating PTEN/AKT signaling. ¹⁴ In human bladder cancer, USP13 was found to interact with PTEN and increase its expression, and loss of USP13 promoted bladder cancer cell proliferation, migration, and invasion. ¹⁵

In this study, we also found that USP13 knockdown inhibited c‐Myc expression in both of HCC cell lines and transplanted tumors. And overexpression of c‐Myc significantly attenuated the effects of shUSP13 on HCC cell growth inhibition. It has been reported that the oncogene c‐Myc was dysregulated and elevated in most tumors, including HCC. ¹⁶ C‐Myc was also proved to be negatively correlated with the prognosis of HCC patients, and promoted HCC tumor development. ¹⁷ Additionally, c‐Myc protein could be polyubiquitinated and degraded into 26S proteasome, which could be induced by the SKP1‐Cullin‐F‐box (SCF) ubiquitin ligase complex in HCC. ¹⁸ It has been also reported that the DUB USP13 could antagonize FBXL14‐mediated ubiquitination‐dependent c‐Myc degradation and maintain glioblastoma stem cells. ¹⁰ Collectively, these information further explained that USP13 exerted its effects by regulating c‐Myc in HCC. However, whether there is a new substrate protein of USP13 in HCC is not known yet, and our next work will focus on this aspect.

5. CONCLUSION

Our present study indicated that USP13 could be as a novel oncogene in HCC. Targeting USP13 may be a novel strategy for the therapy of HCC.

CONFLICT OF INTEREST

The authors declare no potential conflict of interest.

Huang J, Gu Z‐L, Chen W, Xu Y‐Y, Chen M. Knockdown of ubiquitin‐specific peptidase 13 inhibits cell growth of hepatocellular carcinoma by reducing c‐Myc expression. Kaohsiung J Med Sci. 2020;36:615–621. 10.1002/kjm2.12209