Long noncoding RNA HCP5 promotes osteosarcoma cell proliferation, invasion, and migration via the miR‐29b‐3p‐LOXL2 axis

Abstract

Osteosarcoma (OS) is the second most common primary malignant bone tumors in adolescents that causes cancer‐related deaths. Previous studies have confirmed the promoting role of lncRNA HCP5 in the development of OS, but the specific mechanism is still not well understood. MiRNA levels were measured via RT‐qPCR and protein expression was detected via western blotting. Cell proliferation was analyzed by CCK‐8 assays and colony formations assay were conducted to measure colony formation ability. Dual‐luciferase reporter assay was performed to detect the targeting relationship between HCP5 and miR‐29b‐3p, and between miR‐29b‐3p and LOXL2. Wound healing assays and Transwell assays were conducted to verify the migration and invasion abilities of OS cells. Correlations between the levels of HCP5 and miR‐29b‐3p, and between miR‐29b‐3p and LOXL2 were determined by Pearson correlation coefficient analysis. MiR‐29b‐3p expression was decreased and HCP5 and LOXL2 levels were increased in OS tissues and cell lines. MiR‐29b‐3p could directly act on LOXL2 and knockdown of LOXL2 restrained the proliferation, migration, and invasion of OS cells. Moreover, transfection with sh‐HCP5‐1 and sh‐HCP5‐2 suppressed the malignant biological behavior of OS cells. HCP5 directly targeted miR‐29b‐3p, and promoted OS proliferation, migration, and invasion via the miR‐29b‐3p/LOXL2 axis. The lncRNA HCP5 may upregulate LOXL2 expression by targeting miR‐29b‐3p, thereby promoting OS proliferation, migration, and invasion.

1. INTRODUCTION

Osteosarcoma (OS) is the second most common primary malignant bone tumor in the osteopathic department of medicine and is prone to occur in children and adolescents. ¹ , ² OS commonly occurs in the metaphyseal region of the long tubular bone of the extremities, and tumors in the distal femur and proximal tibia account for ~50% of the total cases. ³ OS has the characteristics of strong local destructibility, a high disability rate, and a high mortality rate, and is extremely prone to distant metastasis, with the lung being the most commonly involved organ, which has attracted extensive attention from researchers. ⁴ Although the combination of surgery and multidrug chemotherapy has some effects, patients with OS who develop resistance to chemotherapy and relapse have a poor prognosis. ⁵ Therefore, the identification of novel biomarkers of OS may possibly improve the diagnosis and prognosis of OS patients.

Lysyl oxidase like‐2 (LOXL2) protein has been shown to be an important molecule and has been widely studied in tumors in recent years. LOXL2 is highly expressed in many tumors and participates in the malignancy process. For instance, in lung squamous cell carcinoma (SCC) clinical specimens, LOXL2 was overexpressed and served as an oncogene to promote cell invasion and migration. ⁶ LOXL2 was demonstrated to be involved in the progression of mesenchymal phenotype maintenance, and promoted the epithelial mesenchymal transformation (EMT) process and invasion ability of pancreatic cancer cells. ⁷ As demonstrated in a previous report, the expression of LOXL2 was elevated in human OS cells transfected with Wingless/integrase 7B (WNT7B) or Wingless/integrase 9A (WNT9A) vectors, indicating that LOXL2 is a vital functional factor in the development of OS regulated by the Wnt signaling pathway. ⁸ However, current studies on the LOXL2 mechanism in OS are relatively rare.

In recent years, the important role of long noncoding RNAs (lncRNAs) in the early diagnosis and prognosis prediction of various tumors has received increasing attention. Studies have found that lncRNA HCP5 can act as a carcinogenic lncRNA in multiple cancer types, such as cervical cancer, ⁹ follicular thyroid carcinoma, ¹⁰ and ovarian cancer, ¹¹ and promote cancer progression. Previous studies have revealed that the expression of lncRNA HCP5 is upregulated in OS cells and promotes OS development. ¹² This suggests that lncRNA HCP5 may be an important prognostic biomarker in OS. In addition, the expression level of miR‐29b is lower in OS tissues, which suppresses the proliferation and migration of OS cells. ¹³ Furthermore, exogenous miR‐29b was found to inhibit cell proliferation, promote cell apoptosis, and increase the sensitivity of OS cells to chemotherapy by directly targeting matrix metallopeptidase 9 (MMP‐9). ¹⁴ However, there are few studies on the specific mechanism of miR‐29b‐3p in OS regulation. As predicted by StarBase and RNAInter websites, lncRNA HCP5 was found to bind to miR‐29b‐3p, and miR‐29b‐3p had specific binding sites in LOXL2 mRNA. Therefore, we speculated that lncRNA HCP5 might regulate the OS process via a miR‐29b‐3p/LOXL2 axis.

The purpose of this study was to investigate the regulatory effect of lncRNA HCP5 on miR‐29b‐3p‐mediated LOXL2 expression to promote OS cell proliferation, invasion, and migration.

2. MATERIALS AND METHODS

2.1. Cell culture and tumor specimens

The normal human normal osteoblasts hFOB1.19 and human OS cell lines SJSA‐1, U2OS, R‐1059‐D, Saos2, 143B, and MG63 were obtained from the Shanghai Institute of Cells, Chinese Academy of Sciences. The cells were cultured in RPMI‐1640 medium (Gibco‐BRL) supplemented with 10% fetal bovine serum (FBS, Life Technologies) and 1% penicillin–streptomycin (Gibco‐BRL) in a humidified incubator at 37°C with 5% CO₂. When the cells reached approximately 80% density, routine cell passage was carried out.

This study was approved by the ethics committee of our hospital (ethics number: Med‐Eth‐Re [2021]122). Surgically resected OS specimens from 20 cases were collected as the study group. Matched paracancerous normal bone tissues were collected as the control group. Tissue samples were stored in liquid nitrogen.

2.2. Cell transfection

The cell lines were inoculated into a six‐well plate and grown to 70%–80% density. Then cell transfection was conducted using Lipofectamine 2000 reagent (Invitrogen) according to the manufacturer's protocol. ShRNAs targeting HCP5 (sh‐HCP5‐1, sh‐HCP5‐2), shRNAs targeting LOXL2 (sh‐LOXL2‐1, sh‐LOXL2‐2), sh‐negative control (NC), miR‐29b‐3p mimics, miR‐29b‐3p inhibitor, mimics negative control (NC), and inhibitor NC were designed and provided by GenePharma (Shanghai, China). After transfection for 48 h, the cells were collected for relevant experiments.

2.3. Cell counting kit‐8 assay

Cell proliferation activity was determined using a CCK‐8 kit (Dojindo, Japan). MG63 and 143B cells were incubated in a 96‐well plate at a density of 5 × 10³ cells/ml and cultured at 37°C with 5% CO₂. After 24, 48 and 72 h of incubation, 10 μl of CCK‐8 solution was added to each well, and the cells were cultured at 37°C for another 2 h. The absorbance at 490 nm was detected using the microwell reader (Analytik Jena AG, Germany) at room temperature.

2.4. Quantitative reverse transcript‐PCR

Total RNA was extracted from the normal human osteoblasts hFOB1.19, and OS cell lines, OS specimens, and paracancerous normal tissues were extracted using TRIzol reagent (Sigma) according to the manufacturer's instructions. Reverse transcription of miR‐29b‐3p was conducted using a TaqMan advanced miRNA cDNA synthesis kit (Applied Biosystem). HCP5 and LOXL2 were reversely transcribed using a Takara reverse transcription kit (Takara, China). The relative expression levels were determined via RT‐qPCR using SYBR Green Taq Mix (Takara, China) according to the manufacturer's protocol. GAPDH and U6 were served as the internal references for mRNA and miRNA, respectively. Gene‐specific primers for RT‐qPCR analyses are listed as follows: miR‐29b‐3p‐F, 5′‐TGCGGTAGCACCATTTGAAAT‐3′, and miR‐29b‐3p‐R, 5′‐CCAGTGCAGGGTCCGAGGT‐3′; HCP5‐F, 5′‐CCGCTGGTCTCTGGACACATACT‐3′, and HCP5‐R, 5′‐CTCACCTGTCGTGGGATTTTGC‐3′; LOXL2‐F, 5′‐GGGCCCTTGGAAGTACAAAT‐3′, and LOXL2‐R, 5′‐CCAACAAGTGACAGCCATTA‐3′; GAPDH‐F, 5′‐CTGACATGCCGCCTGGAGA‐3′, and GAPDH‐R, 5′‐ATGTAGGCCATGAGGTCCAC‐3’. U6‐F, 5′‐GCGGGTGCTCGCTTCGGCAGC‐3′, U6‐R, 5′‐CAGTGCAGGGTCCGAGGT‐3′.

2.5. Protein extraction and western blotting

OS cells were lysed in the cold RIPA reagent in the presence of a protease inhibitor (Beyotime, China) and protein concentrations were quantified with a bicinchoninic acid (BCA) protein assay kit (Bio‐Rad Laboratories). The protein samples were separated via SDS‐PAGE and transferred to PVDF membranes (Invitrogen). Then, the membranes were incubated with TBST buffer containing 5% skim milk for 1 h at room temperature. Subsequently, a rabbit anti‐LOXL2 antibody (1:1000 dilution, Abcam, UK) was incubated with the membranes at 4°C overnight. Then, the membranes were rinsed with TBST buffer three times for 10 min each time. Goat horseradish peroxidase (HRP)‐conjugated anti‐rabbit IgG serum was applied to match the primary antibody for 1 h at room temperature, and the membranes were rinsed with TBST buffer. The target protein was visualized with enhanced chemiluminescence reagent. A rabbit anti‐GAPDH antibody (Abcam, China) was used as the internal control. The density of protein bands was analyzed using the ImageJ software.

2.6. Dual‐luciferase reporter gene detection

The wild‐type LOXL2 3′‐UTR sequence (LOXL2 3′‐UTR‐WT) involving the possible binding site and the corresponding mutant‐type LOXL2 3′‐UTR sequence (LOXL2 3′‐UTR‐Mut) were cloned into a pmirGLO firefly luciferase plasmid (GenePharma, China). MG63 and 143B cells were cotransfected with LOXL2 3′ ‐UTR‐WT or LOXL2 3′‐UTR‐Mut and miR‐29b‐3p mimics or miR‐29b‐3p inhibitor using Lipofectamine 3000 reagent (Invitrogen). Meanwhile, fragments of HCP5 with the predicted miR‐29b‐3p binding site or the mutant site were also cloned into the pmirGLO vector. MG63 and 143B cells were cotransfected with miR‐29b‐3p mimics or miR‐29b‐3p inhibitor and the luciferase reporter plasmid using Lipofectamine 3000. Luciferase activity was measured with a dual‐luciferase reporter system (Promega) and the regulatory effects of miR‐29b‐3p on LOXL2 and of HCP5 on miR‐29b‐3p were assessed by determining the relative Rluc/Luc ratio.

2.7. Colony formation assay

MG63 and 143B cells transfected for 48 h were inoculated into a six‐well plate at a density of 500 cells per well and cultured in 5% CO₂ at 37°C for 2 weeks. The cells were fixed with paraformaldehyde for 30 min, and stained with 0.5% crystal violet. Subsequently, excess crystal violet was wiped off, and the cells were rinsed with PBS buffer. The cells were photographed and visible colonies were counted using ImageJ software.

2.7.1. Wound healing assay

After the cells were cultured to confluence, they were scratched using a sterile pipette tip. Then the plates were rinsed twice with fresh medium and incubated at 37°C with 5% CO₂. The cells migrated from the wound edge and the distance between the two sides of the wound was monitored with a microscope. The cell migration degree was quantified by assessing the ratio of the gap distance at 24 h to that at 0 h.

2.7.2. Transwell assay

The invasion ability of the MG63 and 143B cell lines was detected with Transwell assay using a chamber (Corning Costar, Inc.; 8 μm pore size) with the addition of 10 μl Matrigel (BD Biosciences) at a 1:3 dilution. After transfection for 48 h, MG63 and 143B cells were seeded at 5 × 10⁵/well on a polycarbonate membrane with a fibronectin coating inserted into the upper Transwell chamber. Then, the cells were fixed with 4% paraformaldehyde and stained with 0.1% crystal violet for 15 min. Subsequently, the number of invasive cells was counted under a microscope in five different fields.

2.8. Statistical analysis

All the tests conducted were repeated at least three times with similar results. The relevant data in this study were analyzed using the SPSS 22.0 statistical software and the measurement data are presented as the means ± standard deviation (SD). A t test was used for pairwise comparisons, and one‐way ANOVA test was applied for multigroup comparisons. Correlations between the levels of HCP5 and miR‐29b‐3p and between miR‐29b‐3p and LOXL2 were determined using Pearson correlation coefficient analysis. p < 0.05 indicates that a difference is statistically significant.

3. RESULTS

3.1. HCP5 and LOXL2 expression is increased and miR‐29b‐3p expression is decreased in OS tissues and cell lines

Firstly, RT‐qPCR assays were carried out to determine the mRNA expression levels of HCP5, LOXL2, and miR‐29b‐3p in 20 pairs of OS tissues and adjacent bone tissues. It was found that miR‐29b‐3p levels were decreased and HCP5 and LOXL2 levels were increased in OS tissues compared with levels in adjacent normal tissues (Figure 1A). Moreover, compared with the expression of miR‐29b‐3p in the hFOB1.19 cell line, miR‐29b‐3p expression in the SJSA‐1, U2OS, R‐1059‐D, Saos2, 143B, and MG63 cell lines was downregulated, and was lowest in 143B and MG63 cells (Figure 1B). In constrast, HCP5 and LOXL2 levels were elevated in OS cell lines and were highest in 143B and MG63 cells (Figure 1B). Therefore, 143B and MG63 cells were selected for subsequent experiments. LOXL2 protein expression was increased in OS cell lines (Figure 1C). Pearson correlation coefficient analysis was carried out to assess correlations between the levels of HCP5 and miR‐29b‐3p and between miR‐29b‐3p and LOXL2. As shown in Figure 1D, HCP5 was negatively correlated with miR‐29b‐3p, while LOXL2 was negatively correlated with miR‐29b‐3p. All the above data indicate that HCP5, LOXL2, and miR‐29b‐3p might play regulatory roles in OS.

FIGURE 1.

HCP5 and LOXL2 expression levels were increased and miR‐29b‐3p levels were decreased in osteosarcoma tissues and cells. (A) The expression levels of HCP5, LOXL2 and miR‐29b‐3p in clinical osteosarcoma samples and paracancerous tissues from 20 osteosarcoma patients were detected via RT‐qPCR. (B) The expression levels of HCP5, LOXL2 and miR‐29b‐3p in osteosarcoma cells were detected via RT‐qPCR. (C) LOXL2 protein expression in osteosarcoma cells was detected by western blotting. (D) Correlations between the levels of HCP5 and miR‐29b‐3p, and between miR‐29b‐3p and LOXL2 were determined by Pearson correlation coefficient analysis. The measurement data are expressed as the mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001. All the above assays were executed at least three times

3.2. Knockdown of LOXL2 suppresses OS proliferation, migration, and invasion

To verify the effect of LOXL2 on the proliferation, migration, and invasion of OS cells, MG63 and 143B cell lines were transfected with sh‐LOXL2‐1, sh‐LOXL2‐2, or the negative control sh‐NC. As shown in Figure 2A,B, the LOXL2 mRNA and protein expression levels were downregulated when LOXL2 was knocked down. Subsequently, cell proliferation ability was detected with CCK‐8 assays, and the results showed that transfection with sh‐LOXL2‐1 and sh‐LOXL2‐2 reduced the cell proliferation ability of MG63 and 143B cells (Figure 2C). Colony formation assay revealed that cell colony formation decreased in MG63 and 143B cells transfected with sh‐LOXL2‐1 and sh‐LOXL2‐2 (Figure 2D). Moreover, wound healing assays and Transwell assays were conducted to measure cell migration and invasion abilities. The results indicated that knockdown of LOXL2 depressed cell migration and invasion (Figure 2E,F). These results suggest that knockdown of LOXL2 can suppress the proliferation, migration and invasion of OS cells.

FIGURE 2.

LOXL2 knockdown suppresses cell proliferation, migration and invasion of osteosarcoma cells. (A, B) The LOXL2 mRNA and protein expression levels after LOXL2 knockdown were measured via RT‐qPCR and western blotting, respectively. (C) The cell proliferation activities in MG63 and 143B cells transfected with sh‐LOXL2‐1 and sh‐LOXL2‐2 were determined usingCCK‐8 assays. (D) A colony formation assay was performed to measure the colony formation ability of MG63 and 143B cells. (E, F) THE migration (E) and invasion (F) abilities of MG63 and 143B cells transfected with sh‐LOXL2‐1 and sh‐LOXL2‐2 were measured with wound healing and Transwell assays. The measurement data are presented as the mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001. All the above assays were executed independently at least three times

3.3. MiR‐29b‐3p binds to LOXL2 and regulate OS proliferation, migration, and invasion

To further explore the mechanism of miR‐29b‐3p in OS progress, MG63 and 143B cell lines were transfected with miR‐29b‐3p mimics or miR‐29b‐3p inhibitor. As shown in Figure 3A, the expression level of miR‐29b‐3p was increased after transfection with miR‐29b‐3p mimics, but decreased after transfection with the miR‐29b‐3p inhibitor. Furthermore, LOXL2 expression levels were decreased when MG63 and 143B cells were transfected with miR‐29b‐3p mimics, while the miR‐29b‐3p inhibitor increased LOXL2 levels (Figure 3B). Bioinformatics analysis revealed that miR‐29b‐3p can bind directly to the 3′‐UTR of LOXL2 (Figure 3C). Dual‐luciferase reporter detection was carried out in MG63 and 143B cells. As expected, the fluorescence intensity was decreased when the cells were cotransfected with LOXL2 3′‐UTR‐WT and miR‐29b‐3p mimics (Figure 3D). In addition, the miR‐29b‐3p inhibitor increased the fluorescence intensity in cells transfected with LOXL2 3′ ‐UTR‐WT but had little effect on the fluorescence intensity in cells transfected with LOXL2 3′‐UTR‐Mut (Figure 3D). These results suggest that miR‐29b‐3p can directly bind to LOXL2 and negatively regulate its expression.

FIGURE 3.

MiR‐29b‐3p directly binds to LOXL2 and inhibits LOXL2 expression. (A) The expression level of miR‐29b‐3p was detected by RT‐qPCR after transfection with miR‐29b‐3p mimics or inhibitor. (B) LOXL2 expression was measured via RT‐qPCR in MG63 and 143B cells transfected with miR‐29b‐3p mimics or inhibitor. (C) StarBase software was used to predict the interaction between LOXL2 and miR‐29b‐3p. (D) A dual‐luciferase reporter assay was carried out in MG63 and 143B cells to determine the correlation between LOXL2 and miR‐29b‐3p. The measurement data are expressed as the mean ± standard deviation. *p < 0.05; **p < 0.01. All the above assays were executed at least three times

3.4. Knockdown of HCP5 inhibits OS proliferation, migration and invasion

To investigate the effect of HCP5 on biological behavior of OS, MG63, and 143B cell lines were transfected with sh‐HCP5‐1, sh‐HCP5‐2, and the negative control sh‐NC. RT‐qPCR results showed that the HCP5 level decreased in MG63 and 143B cells after transfection with sh‐HCP5‐1 and sh‐HCP5‐2 (Figure 4A). In addition, knockdown of HCP5 decreased cell proliferation ability (Figure 4B). As shown in Figure 4C, colony formation assays indicated that HCP5 knockdown reduced cell colony formation. Furthermore, transfection with sh‐HCP5‐1 and sh‐HCP5‐2 dramatically inhibited the migration ability and invasion ability of MG63 and 143B cells (Figure 4D,E). Collectively, these results indicate that HCP5 knockdown can inhibit the proliferation, migration, and invasion of OS cells.

FIGURE 4.

Knockdown of HCP5 inhibits osteosarcoma cell proliferation, migration and invasion. (A) The expression of HCP5 after transfection with sh‐HCP5‐1 and sh‐HCP5‐2 was measured via RT‐qPCR. (B) The cell proliferation ability in MG63 and 143B cells with HCP5 knockdown was determined using CCK‐8 assays. (C) the colony formation ability of MG63 and 143B cells transfected with sh‐HCP5‐1 and sh‐HCP5‐2 was determined with colony formation assays. (D, E) The migration (D) and invasion (E) abilities of MG63 and 143B cells transfected with sh‐HCP5‐1 and sh‐HCP5‐2 were measured with wound healing and Transwell assays. The measurement data are presented as the mean ± standard deviation. *p < 0.05; **p < 0.01. All the above assays were executed independently at least three times

3.5. HCP5 promotes OS proliferation, migration and invasion via the miR‐29b‐3p/LOXL2 axis

To determine whether HCP5 regulates the proliferation migration and invasion of OS cells through miR‐29b‐3p/LOXL2 axis, further experiments were divided into the following groups: control group, sh‐HCP5 group, miR‐29b‐3p inhibitor group, and sh‐HCP5 + miR‐29b‐3p inhibitor group. Transfection with sh‐HCP5 significantly enhanced the miR‐29b‐3p level and reduced the LOXL2 level (Figure 5A,B). Bioinformatics analysis predicted that HCP5 could bind directly to a specific region in miR‐29b‐3p (Figure 5C). Dual‐luciferase reporter detection was conducted and showed that the fluorescence intensity was decreased when the cells were cotransfected with HCP5‐WT and miR‐29b‐3p mimics (Figure 5D). In addition, the miR‐29b‐3p inhibitor increased the fluorescence intensity in HCP5‐WT cells but had little effect on the fluorescence intensity in cells transfected with HCP5‐Mut (Figure 5D). The cell proliferation ability was enhanced in cells transfected with the miR‐29b‐3p inhibitor, while the effect was reversed after HCP5 or LOXL2 knockdown, and HCP5 knockdown counteracted the trend observed in the miR‐29b‐3p inhibitor + shLOXL2 inhibitor group (Figure 5E). As shown in Figure 5F, the miR‐29b‐3p inhibitor led to increased cell colony formation, while transfection with sh‐HCP5 or sh‐LOXL2 counteracted this effect, and the trend in the miR‐29b‐3p inhibitor + shLOXL2 inhibitor group was reversed after HCP5 knockdown (Figure 5F). Furthermore, in the miR‐29b‐3p inhibitor group, cell migration, and invasion were increased, and in the sh‐HCP5 or sh‐LOXL2 group, cell migration and invasion were decreased. However, cotransfection with the miR‐29b‐3p inhibitor and sh‐HCP5 reversed the increased migration and invasion caused by the miR‐29b‐3p inhibitor, and HCP5 knockdown counteracted the trend observed in the miR‐29b‐3p inhibitor + shLOXL2 inhibitor group (Figure 5G,H). Western blotting assays showed that LOXL2 protein levels were increased in cells transfected with the miR‐29b‐3p inhibitor, while the effect was reversed after HCP5 or LOXL2 knockdown, and the trend in the miR‐29b‐3p inhibitor + shLOXL2 inhibitor group was counteracted after cotransfection with sh‐HCP5 (Figure 5I). Taken together, these results indicate that HCP5 promotes the proliferation, migration, and invasion of OS cells through the miR‐29b‐3p/LOXL2 axis.

FIGURE 5.

HCP5 exerts a pro‐oncogene role by upregulating LOXL2 expression via recruitment of miR‐29b‐3p. (A, B) miR‐29b‐3p and LOXL2 mRNA expression after HCP5 knockdown was measured by RT‐qPCR. (C) StarBase software was used to predict the interaction between HCP5 and miR‐29b‐3p. (D) A dual‐luciferase reporter assay was conducted in MG63 and 143B cells transfected with miR‐29b‐3p mimics or inhibitor to determine the correlation between HCP5 and miR‐29b‐3p. (E) MG63 and 143B cell proliferation activity was determined using CCK‐8 assays after cotransfection with miR‐29b‐3p inhibitor, sh‐HCP5 and sh‐LOXL2. (F) The colony formation ability of MG63 and 143B cells cotransfected with miR‐29b‐3p inhibitor, sh‐HCP5 and sh‐LOXL2 was determined with colony formation assays. (G, H) the migration (G) and invasion (H) abilities of MG63 and 143B cells cotransfected with miR‐29b‐3p inhibitor, sh‐HCP5 and sh‐LOXL2 were measured using wound healing and Transwell assays. (I) Western blotting was performed to detect the LOXL2 protein level in cells cotranfected with miR‐29b‐3p inhibitor, sh‐HCP5 and sh‐LOXL2. The measurement data are presented as the mean ± standard deviation. *p < 0.05; **p < 0.01; ***p < 0.001. All the above assays were executed independently at least three times

4. DISCUSSION

OS, which actes as primary malignant bone tumor, ranks second. OS cells can produce tumor osteoid tissue and bone tissue directly through the cartilage stage; thus, OS tumor grow rapidly. ¹⁵ In addition, OS is prone to early metastasis, and 20% of OS patients have metastatic disease at the first visit, most of which is located in the lung. ¹⁶ Based on the above pathological features, patients with OS often have a poor prognosis and high mortality and disability rates. A comprehensive understanding of the molecular regulation mechanisms in OS will improve therapeutic strategies and the survival rate of patients with OS.

Previous studies have reported that knockdown of lncRNA HCP5 promotes apoptosis of triple‐negative breast cancer (TNBC) cells, and suppresses cell proliferation and migration, while the effects were rescued after transfection with miR‐219a‐5p inhibitor or BIRC3. ¹⁷ HCP5 has been shown to be dramatically upregulated in follicular thyroid carcinoma (FTC) and functions as a competing endogenous RNA (ceRNA) to promote cell proliferation, migration, invasion, and angiogenesis in FTC cells. ¹⁰ The upregulation of HCP5 could promote the development of osteosarcoma. ¹² However, the specific molecular regulatory mechanism by which HCP5 functions in cancer are complex and diverse, thus our research focused on the possible mechanism of HCP5 in OS. In this work, it was found that HCP5 levels were elevated in OS cell lines and knockdown of HCP5 suppressed the cell proliferation, migration, and invasion of OS cells (Figures 1A,B and 4). However, because the functions of lncRNAs are still largely unknown, whether lncRNA HCP5 has other functions in regulating OS progression will be investigated in future studies.

The expression levels of miR‐29 family, including miR‐29a, miR‐29b, and miR‐29c, are down‐regulated in tumor tissues compared with levels in normal tissues. ¹⁸ , ¹⁹ A previous study indicated that miR‐29 can restrain OS proliferation and promote apoptosis by down‐regulating the expression of signal transducer and activator of transcription 3 (STAT3). ²⁰ The expression of miR‐29b in OS tissues was markedly reduced, and a low level of miR‐29b was remarkably correlated with large tumor size, advanced TNM stage, distant metastasis, tumor grade, and shorter overall survival time; moreover, miR‐29b was demonstrated to be an independent prognostic marker in OS patients. ²¹ In our study, the miR‐29b‐3p level was decreased in OS tissues and cell lines, and cell proliferation, colony formation, migration and invasion abilities were enhanced in cells transfected with the miR‐29b‐3p inhibitor (Figure 5E–H). As an oncogene, LOXL2 was epigenetically regulated by tumor‐suppressive microRNAs, miR‐26a and miR‐26b in renal cell carcinoma. ²² MiR‐29a was downregulated in clinical specimens of lung cancer and idiopathic pulmonary fibrosis, and led to overexpression of LOXL2. ²³ Further experimental studies in our work demonstrated that knockdown of LOXL2 could inhibit the proliferation, migration, and invasion of OS cells (Figure 2). It has been reported that the miR‐29 family suppresses cell proliferation, migration, and invasion in lung squamous cell carcinoma by directly targeting LOXL2. ⁶ Similarly, our data showed that the miR‐29b‐3p mimics led to decreased LOXL2 expression in MG63 and 143B cells, while the miR‐29b‐3p inhibitor increased LOXL2 levels via direct interaction (Figure 3). The association of immunohistochemical (IHC) staining of LOXL2 expression in clinical samples with clinicopathological features is necessary for the confirmation of Western blot assay. However, considering the limitations of the samples we extracted, only RT‐qPCR assay was performed (as shown in Figure 1A,D), and western blotting and IHC were not carried out. These are the limitations of our study. As reported by Matsuoka et al., the protein expression of LOXL2 was elevated in OS cell lines. ⁸ Re‐collection of clinical tissue for western blotting and IHC staining are also areas where we need to further improve and complement in later study.

As demonstrated by Ling Wang, et al., HCP5 might facilitate the malignant biological behaviors of ovarian cancer (OC) cells via miR‐525‐5p/polycomb repressive complex 1 (PRC1) crosstalk, and the Wnt/β‐catenin signaling pathway. ¹¹ In the present work, we first identified that HCP5 knockdown obviously increased the mRNA expression level of miR‐29b‐3p and reduced the LOXL2 level (Figure 5A,B). In addition, bioinformatics prediction and dual‐luciferase reporter detection confirmed that HCP5 contained potential binding sites for miR‐29b‐3p (Figure 5C,D). Further analysis revealed that the miR‐29b‐3p inhibitor enhanced cell proliferation ability, colony formation, migration, and invasion abilities, as well as LOXL2 protein expression in OS cells, while these effects were reversed after HCP5 or LOXL2 knockdown, and the trend in the miR‐29b‐3p inhibitor + shLOXL2 inhibitor group was counteracted after HCP5 knockdown (Figure 5E–I). These findings illustrate that HCP5 regulates the miR‐29b‐3p/LOXL2 axis, thus promoting OS cell proliferation, invasion, and migration.

Overall, this work demonstrates that HCP5 regulates LOXL2 expression, providing a mechanistic explanation as to how the regulation of OS cell proliferation, invasion, and migration is achieved. This is partially accomplished by the involvement of HCP5 in miR‐29b‐3p inhibition, while miR‐29b‐3p inhibition enhances the LOXL2 level, which in turn modulates OS progression. Taken together, these results demonstrate that the HCP5‐modulated signaling pathway is responsible for increased expression of LOXL2, to thereby promoting OS cell progression. These findings provide a new perspective for the study of OS.

5. CONCLUSIONS

We report for the first time that lncRNA HCP5 plays a pro‐oncogenic role and accelerates cell proliferation, migration, and invasion abilities by upregulating LOXL2 expression via recruitment of miR‐29b‐3p (Figure 6), which provides a new insight into the mechanism of HCP5 in OS development.

FIGURE 6.

Cartoon demonstrating the working mechanism of the manuscript

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Abbreviations

ceRNA

competing endogenous RNA

FTC

follicular thyroid carcinoma

lncRNA

long noncoding RNA

LOXL2

lysyl oxidase like‐2

MP‐9

matrix metallopeptidase 9

OS

osteosarcoma

SCC

squamous cell carcinoma

TNBC

triple‐negative breast cancer

Tan J‐D, Zhou M‐F, Yang S, Lin J‐P. Long noncoding RNA HCP5 promotes osteosarcoma cell proliferation, invasion, and migration via the miR‐29b‐3p‐LOXL2 axis. Kaohsiung J Med Sci. 2022;38(10):960–970. 10.1002/kjm2.12577