FKBP10 functioned as a cancer‐promoting factor mediates cell proliferation, invasion, and migration via regulating PI3K signaling pathway in stomach adenocarcinoma

Abstract

As documented, the expression, biological roles, and prognostic significance of FKBP10 in stomach adenocarcinoma (STAD) have not been investigated till now. This drives us to detect the biological roles and clinical significance of FKBP10 in STAD. The expression level of FKBP10 was measured based on the data obtained from the TCGA, ONCOMINE, and GEPIA databases, and STAD cell lines. Through in vitro experiments, cell behaviors were investigated to evaluate the effects of FKBP10 on STAD. Moreover, the PI3K‐AKT signaling pathway was measured. Relying on the data of TCGA, ONCOMINE, and GEPIA databases, and cancer cell lines, FKBP10 was up‐regulated in STAD when compared with normals. The patients with low expression of FKBP10 had higher survival rate than those with high FKBP10 expression. After knockdown of FKBP10 in AGS cells, cell vitality, colony formation ability, and the migratory and invasive potential were inhibited. Western blotting analysis exhibited that knockdown of FKBP10 significantly reduced the expression level of p‐AKT, and p‐PI3K, but it did not influence the total expression level of AKT, and PI3K. FKBP10 might serve as a crucial player in gastric cancer, and targeting FKBP10 might provide clinical utility in gastric cancer in future.

1. INTRODUCTION

Gastric cancer is the second main cause of cancer‐induced deaths in the world.1 The 5‐year overall survival rate is only from 20% to 30%, although numerous of anticancer drugs have been utilized.2 Chemotherapy or adjuvant chemotherapy improves the survival rate of patients with gastric cancer to a certain degree, while the effect remains dismal.3, 4 Thus, it is urgently needed to explore novel therapeutic targets and prognostic biomarkers for early diagnosis and survival prolongation in gastric carcinoma.

The gene FKBP10 (FK506 binding protein 10), located at chromosome 17 (17q21.2), is a member of FKBPs which participate in regulating Ca²⁺‐dependent signal transduction and gene expression, influencing chromatin structure, DNA repair, and DNA replication.5 FKBP10 encodes FKBP65 protein, a 65 kDa FK506 binding protein that is a member of the FKBP‐type peptidyl‐prolyl cis/trans isomerase family.6 As documented, FKBP10 has been detected to play important roles in the initiation and progression of cancers. For example, Olesen et al7 used polymerase chain reaction (PCR) to analyze the FKBP10 in 31 colorectal adenocarcinomas and 14 normal colorectal mucosa, who found an obvious up‐regulation of FKBP10 in cancer samples, relative to normal samples. Similarly, FKBP65 was highly expressed in prostate cancer.8 Significantly, FKBP10 was over‐expressed and silencing of FKBP10‐induced cell cycle arrest, and inhibited cell proliferation, and invasion in renal cell carcinoma.9 On the contrary, FKBP10/FKBP65 was underexpression in high‐grade ovarian serous carcinomas and was related with an unfavorable prognosis in patients.10 Nevertheless, the expression, biological roles, and prognosis of FKBP10 in stomach adenocarcinoma (STAD) have not been investigated till now, driving us to reveal the expression and clinical significance of FKBP10 in STAD.

In our study, we first investigated the expression of FKBP10 in STAD cases obtained from TCGA, ONCOMINE, and GEPIA databases. Then, we assessed the correlation of FKBP10 with prognostic value based on the GEPIA database. In addition, the roles of FKBP10 on cell proliferation, colony formation, migration, and invasion of STAD cells were explored using experiments in vitro. Our study was designed to determine for the first time the functions and prognostic significance of FKBP10 in regulating cell proliferation and invasion in an in vitro model of STAD. A better understanding the molecular mechanisms of FKBP10 in STAD progression might open new therapeutic strategies against STAD development.

2. MATERIALS AND METHODS

2.1. Expression of FKBP10 in STAD based on GEPIA, TCGA, and Oncomine

STAD‐relevant data were retrieved from GEPIA (http://gepia.cancer-pku.cn/), which covered the FKBP10 expression level of 408 STAD tissues and 36 normal samples. These data were investigated to detect the ability of predicting overall survival in STAD.

With the goal of increasing the reliability of our results, the online databases TCGA (http://cancergenome.nih.gov/) and Oncomine (https://www.oncomine.org/) were then utilized to examine the expression level of FKBP10 in STAD.

2.2. Cell culture and transfection

The cell lines utilized in our study included three human gastric cancer cell lines (AGS, MKN‐45, and BGC‐823) and normal gastric epithelial cell line GES‐1, which were purchased from Cell Bank of the Chinese Academy of Sciences (Shanghai, China). All cells were routinely cultivated in RPMI‐1640 medium (Gibco, Carlsbad, California) in an atmosphere at 37°C with 5% CO₂, with 10% fetal bovine serum (FBS, Gibco) and 100 U/mL penicillin‐0.1 mg/mL streptomycin (Gibco).

Two small interfering RNAs (siRNAs) targeting FKBP10 (si‐FKBP10) and a negative control (si‐con) were purchased form Genepharma (Shanghai, China) with the sequences as follows: si‐FKBP10#1:5′‐CCACACCTACAATACCTATAT‐3′; si‐FKBP10#2:5′‐CCACTACAATGGCTCCTTGAT‐3′; si‐con: 5’‐TTCTCCGAACGTGTCACGT‐3′. When the cells in the six‐well plate grown to 80% confluency, these cells were transfected with siRNAs based on Lipofectamine 2000 (Invitrogen, Carlsbad) according to the manufacturer's protocol. Then, quantitative real‐time reverse transcription‐PCR (RT‐qPCR) was used to evaluate the interference effect after 48 hours of transfection. The siRNAs with transfection efficacy of more than 80% was used.

2.3. RNA extraction and RT‐qPCR analysis

RT‐qPCR was carried out to examine the expression level of FKBP10. In detail, total RNA was obtained from the cells with TRIzol on the basis of the manufacturer's requirements. After that, cDNA was synthesized using cDNA synthesis kit (Takara biomedical Technology Co, Ltd, Beijing, China), and was amplified with PCR using FKBP10 and GAPDH (internal reference) specific primers. Specific primers for FKBP10 5′‐GTTCACCTCGCATGACTAC‐3′, 5′‐CCTCTCTCCCACACACAT‐3′, and specific primers for GAPDH 5′‐GCTCTCTGCTCCTCCTGTTC‐3′ 5′‐CGACCAAATCCGTTGACTCC‐3′. PCR procedures were shown as follows: 95°C for 5 minutes, followed by 40 cycles at 95°C for 30 seconds, 60°C for 45 seconds, and 72°C for 30 seconds. At the end of the PCR cycles, a melting‐curve analysis was performed. The 2^−ΔΔCT method was used to calculate the expression level of FKBP10 in gastric cancer cells.

2.4. Western blotting analysis

Total proteins were obtained from the harvested cells, and then their concentrations were quantified using BCA kit (Beyotime, Inc, Shanghai, China). After that, 30 μg/well proteins were separated based on SDS‐PAGE (Sigma‐Aldrich, Missouri) and transferred to the PVDF membrane (Sigma‐Aldrich). The nonspecific binding sites of membranes were blocked with 5% non‐fat dried milk, and then the membranes were incubated overnight at 4°C using the following primary antibodies (FKBP10, 1:1000; PI3K, 1:1000; p‐PI3K, 1:1000; AKT, 1:1000; p‐AKT, 1:1000; GAPDH, 1:1000). Subsequently, HRP‐conjugated secondary antibody was added to the membranes to incubate at room temperature for 2 hours. All antibodies were purchased from Abcam (Cambridge, Massachusetts). Ultimately, ECL kit (Beyotime, Inc) was used to visualize the protein bands.

2.5. MTT assay

Cells transfected with si‐con and si‐FKBP10 were cultivated in 96‐well plates and allowed to adhere overnight. Cell proliferation was tested using the 3‐2, 5‐diphenyltetrazoliumbromide (MTT; Solarbio, Beijing, China) assay. Briefly, 10 μL of MTT was added to each well incubated for 4 hours. Next, we removed the cultured medium and added 150 μL fresh DMSO (Beyotime Inc) for 10 minutes. Absorbance (A) at 570 nm was recorded using a microplate reader and absorbance at 630 nm was used as the reference. The cell proliferation rate is shown: relative proliferation rate (%) = (A570‐A630 nm) of transfected group/(A570‐A630 nm) of control group × 100%.

2.6. Colony formation assay

Cells transfected with si‐con and si‐FKBP10 were cultured in 60 mm dishes and incubated for 7 days without disturbance. Afterwards, the cells were fixed with 4% paraformaldehyde (Sigma‐Aldrich) for 30 minutes, and stained using 0.5% crystal violet (Sigma‐Aldrich) for 30 minutes. Finally, colonies were counted using the Image J software.

2.7. Transwell assay for determining cell migration and invasion ability

The migration ability was evaluated using transwell chambers having 8 μm pores without Matrigel (BD Biosciences, Franklin Lakes, New Jersey), and the invasion assay were implemented with invasion chamber coated with Matrigel. In detail, the treated cells were cultured to the upper chamber. Medium containing 10% FBS was putted to the lower chamber as the attractant. Then, the cells were incubated at 37°C for 24 hours, and nonmigrated cells in the upper surface were discarded using cotton swabs. The cells adhered to the lower chambers were fixed using 4% paraformaldehyde for 30 minutes and stained using 0.5% crystal violet for 20 minutes. The cells attached to the lower chamber were numbered in five different fields under a microscope.

2.8. Statistical analysis

For statistical analysis, SPSS software, version 22.0 (IBM Corp, Armonk, New York) was used in our study. The chi‐square test was utilized to evaluate the difference of two groups, and one‐way analysis of variance followed by Dunnett's test for post hoc comparisons was used to estimate the statistical difference among multiple groups. The STAD patients were divided into high or low FKBP10 expression groups according to the median value of FKBP10 expression. The P values less than .05 were regarded statistically significant.

3. RESULTS

3.1. Up‐regulation of FKBP10 in STAD was correlated with poor prognosis

The expression of FKBP10 in STAD was analyzed based on the data from three different databases TCGA, GEPIA, and Oncomine. First, the expression level of FKBP10 which was calculated using the data from TCGA database (P = 6.67E‐09, Figure 1A) demonstrated that FKBP10 was significantly up‐regulated in STAD when compared with normal (P < .01). Meanwhile, we implemented an expression calculation of FKBP10 using two datasets of DErrico Gastric and Cui Gastric cohorts from Oncomine. In these two cohorts, the FKBP10 expression level was highly expressed in gastric cancer tissues as compared to normal samples (Figure 1B,C). Moreover, based on the GEPIA data, we observed that the FKBP10 expression was remarkably over‐expressed in gastric cancer group as compared with the normal tissues (P < .01, Figure 1D).

Figure 1.

Overexpression of FKBP10 induced the unfavorable prognosis of STAD. A, Data from TCGA database containing 32 normal cases and 375 tumor cases, P = 6.67E‐09. B and C, Datasets of Cui gastric and DErrico gastric cohorts from Oncomine. The horizontal line represents the medians. D, Data from GEPIA database. Red column is STAD samples (n = 408), and gray column stands for normal group (n = 36). E, High expression of FKBP10 is connected with a poor overall survival in STAD patients. Kaplan‐Meier curves of overall survival were plotted based on GEPIA, P = .013. F, Relative expression of FKBP10 in four cell lines, **P < .01. STAD, stomach adenocarcinoma

The association of FKBP10 with overall survival in 384 STAD patients was analyzed using Kaplan‐Meier method. According to the median expression value of FKBP10, STAD patients were classified into high (n = 192) and low (n = 192) expression groups, respectively. The survival curve exhibited that patients with low expression of FKBP10 had higher survival rate than those with high FKBP10 expression (P = .013, Figure 1E), which implied that up‐regulation of FKBP10 was associated with an unfavorable prognosis in patients with STAD. Additionally, analysis of the correlation between clinical characteristics and FKBP10 expression in STAD showed that Grade of STAD patients was associated with FKBP10 expression, which verified that FKBP10 might act as a prognostic biomarker (P < .05, Table 1).

Table 1.

Correlations between clinical characteristics and FKBP10 expression in STAD

Characteristics	Expression of FKBP10
	Low	High	P value
Age			1.000
<60	50	50
≥60	107	107
Gender			.295
Female	64	55
Male	93	102
Grade			.035*
G1 + G2	48	66
G3	109	91
Pathologic‐stage			.820
I + II	71	69
III + IV	86	88
Pathologic‐T			.238
T1 + T2	34	43
T3 + T4	123	114
Pathologic‐N			.221
N0	53	43
N1 + N2 + N3	104	114
Pathologic‐M			.377
M0	148	144
M1	9	13

Abbreviations: T, tumor status; N, regional lymph node status; M, metastasis status; STAD, stomach adenocarcinoma.

*P < .05.

3.2. FKBP10 was highly expressed in gastric cancer cells

To further validate the expression of FKBP10 in gastric cancer, we analyzed the mRNA level in normal gastric epithelial cell line GES‐1 and human gastric cancer cell lines (AGS, MKN‐45, and BGC‐823), by means of RT‐qPCR. As exhibited in Figure 1F, the FKBP10 expression in cancer cell lines was significantly higher than that in the normal cells (all P < .01). These results drawn from the cell lines were in line with the conclusion obtained from the database analysis. Of note, the FKBP10 level in AGS cells was the highest among all examined cancer cell lines. Thus, AGS cells were applied in vitro experiments subsequently.

3.3. Reduced proliferation of FKBP10‐silenced AGS cells

To better understand the biological roles of FKBP10 on the progression of gastric cancer, si‐FKBP10#1, and si‐FKBP10#2 were transfected into AGS cells. Later, the expression of FKBP10 mRNA and protein in AGS cells was examined using RT‐qPCR and western blotting to evaluate the transfection efficiency of si‐FKBP10#1 and si‐FKBP10#2. From Figure 2A‐C, we found that both sequences of si‐FKBP10 significantly decreased the mRNA and protein expression of FKBP10 in AGS cells, with interference efficiencies were over 80% (P < .01). Moreover, compared with sequence #1 of si‐FKBP10, the transfection rate of sequence #2 of si‐FKBP10 was more efficient. Therefore, sequence #2 of si‐FKBP10 was used to study the effect of FKBP10 on gastric cancer cells.

Figure 2.

Knockdown of FKBP10 inhibited the proliferation and colony formation of AGS cells. A, The mRNA expression level of FKBP10 were examined using RT‐qPCR, **P < .01. B and C, The protein expression level of FKBP10 in AGS cells was investigated using western blot, **P < .01. D, Down‐regulation of FKBP10 inhibited the AGS cell viability as determined by a MTT assay. E and F, FKBP10 knockdown suppressed colony formation of AGS cells examined by colony formation assay, **P < .01

To reveal the biological roles of FKBP10 in gastric cancer, we first examined the cell growth activity using MTT assay. Knockdown of FKBP10 significantly decreased the growth rate of AGS cells when compared with the control group at 2 and 3 days (all P < .01, Figure 2D). Next, we carried out the colony formation assay. From Figure 2E,F, we observed that AGS cells transfected with si‐FKBP10 formed fewer clones, relative to control group (P < .01). Overall, the results of MTT and colony assay demonstrate that FKBP10 plays important roles in cancer cell proliferation.

3.4. Transfection of si‐FKBP10 blocked the migration and invasion of AGS cells

With the goal of exploring the effect of FKBP10 on the migration and invasion capacity of AGS cells, transwell assays were implemented. As shown in Figure 3A,B, AGS cells with si‐FKBP10#2 transfection significantly attenuated the ability of migration and invasion, when compared to the control group (P < .01). These data suggest that FKBP10 knockdown can obviously inhibit the metastatic properties of AGS cells.

Figure 3.

FKBP10 knockdown blocked the migration and invasion ability of AGS cells. A and B, Transwell assay was implemented to investigate the migratory and invasive prosperities of AGS cells with or without si‐FKBP10, **P < .01

3.5. FKBP10 knockdown suppressed the activation of phosphatidylinositol 3‐kinase signaling of AGS cells

In order to confirm whether the aberrant expression of FKBP10 influences the phosphatidylinositol 3‐kinase (PI3K) signaling pathway, we examined the expression level of a series of key biomarkers (AKT, p‐AKT, PI3K, and p‐PI3K) using western blotting method.

Figure 4 exhibited that FKBP10 silence remarkably inhibited the expression level of p‐AKT, and p‐PI3K of AGS cells (P < .01), but it did not influence the total expression level of AKT, and PI3K, which implied that FKBP10 mediated the gastric cancer cell proliferation and metastasis, partially via regulating the PI3K/AKT signaling pathway.

Figure 4.

Western blotting was used to determine the expression levels of PI3K, p‐PI3K, AKT, and p‐AKT in AGS cells after FKBP10 knockdown. GAPDH was utilized to be as internal reference, **P < .01

4. DISCUSSION

Gastric cancer is a malignant tumor with an unsatisfactory prognosis. More worriedly, chemotherapy and radiotherapy have not obtained an effective effect on the survival of patients with advanced gastric cancer.11 Consequently, it is urgently needed to detect novel and available therapeutic targets. Recently, aberrant expression of genes has been reported to be associated with cancer progression and patient prognosis. Significantly, dys‐regulation of FKBP10 has been reported in various types of cancers. However, its function in cancer is controversy. Some studies demonstrated that FKBP10 had oncogenic role in some cancers, for example, colorectal adenocarcinomas7 and prostate cancer.8 However, several evidences suggested that FKBP10 was underexpression in high‐grade serous carcinomas.10 As we all know, there is no study showing the biological roles and prognostic value of FKBP10 in gastric cancer. In our work, for the first time, we observed that the expression of FKBP10 was significantly higher in STAD tissues than that of control samples using TCGA, GEPIA, and Oncomine data. Moreover, the FKBP10 level was highly expressed in cancer cell lines when compared with the GES‐1 cells. Importantly, the STAD patients with low level of FKBP10 had better prognosis, compared to those with high expression of FKBP10. The in vitro functional studies demonstrated that decreased expression of FKBP10 in AGS cells led to a remarkable inhibitory effect on cell growth, colony formation, migration, and invasion. Taken these results together, FKBP10 might act as a gastric cancer‐inducing gene, and is a promising novel diagnostic signature and therapeutic target for gastric cancer in the future. Moreover, this might be a supplement to the existing paradox of FKBP10 in different cancers.

To better understand the molecular mechanisms of FKBP10 as a cancer‐inducing gene, we used western blotting to examine the expression level of protein biomarkers of PI3K signaling pathway (PI3K, p‐PI3K, AKT, and p‐AKT). Former studies have demonstrated that the PI3K/AKT signaling pathway exerts important functions in cell proliferation12 and this pathway is frequently activated in many cancer types.13 Of note, PI3K/AKT signaling pathway is activated in gastric cancer, and this pathway plays key roles in cell survival.14, 15, 16 Activated PI3K provokes the recruitment of AKT to p‐AKT which is activated.17 AKT, as a crucial regulatory hub in the PI3K pathway, participates in the progression of cancer via enhancing cell proliferation and angiogenesis, promote migration and invasion, and suppressing apoptosis.18, 19 The proliferation and invasion capacity of gastric cancer cells has been reported to be increased and these cells showed promoted the expression level of p‐AKT1 and p‐AKT2.20 Moreover, decreased p‐PI3K and p‐AKT have been demonstrated to suppress cancer cell proliferation, and invasion.21, 22 Our results were in line with those findings descried above, we found that the level of p‐AKT, and p‐PI3K in AGS cells were obviously reduced after silencing FKBP10. Accordingly, results indicated that FKBP10 might influence the progression of gastric cancer by inactivating the PI3K/AKT signaling pathway. However, we do not yet know how FKBP10 regulates the PI3K/AKT signaling pathway, directly regulated or indirectly by binding to other genes. Therefore, we should focus on the specific mechanism between FKBP10 and PI3K/AKT signaling pathway in the future.

5. CONCLUSIONS

In summary, our study indicated that up‐regulation of FKBP10 had potential as prognostic signature in gastric cancer. Increased expression of FKBP10 was found in gastric cancer tissues and cell lines. Moreover, survival analysis showed highly expressed FKBP10 was correlated with unfavorable prognosis in gastric cancer patients. Knockdown of FKBP10 inhibited cell proliferation, colony formation, migration, and invasion. Mechanistically, the effects of FKBP10 on gastric cancer cells might be linked with the PI3K/AKT signaling pathway. Our studies on the molecular mechanisms of FKBP10 may improve the clinical management for gastric cancer.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Wang R‐G, Zhang D, Zhao C‐H, Wang Q‐L, Qu H, He Q‐S. FKBP10 functioned as a cancer‐promoting factor mediates cell proliferation, invasion, and migration via regulating PI3K signaling pathway in stomach adenocarcinoma. Kaohsiung J Med Sci. 2020;36:311–317. 10.1002/kjm2.12174