Cullin 4B regulates cell survival and apoptosis in clear cell renal cell carcinoma as a target of microRNA‐217

Abstract

Cullin 4B (CUL4B) was reported to be closely related to the progression of some tumors, but its function in clear cell renal cell carcinoma (ccRCC) has not been reported. Our present study found CUL4B was upregulated in ccRCC, and CUL4B knockdown markedly inhibited ccRCC cell growth and induced apoptosis. In addition, CUL4B knockdown markedly inhibited antiapoptotic proteins' expression in ccRCC cells, including Mcl‐1 and Bcl‐2, and silenced CUL4B also induced the cleavages of PARP, an important index of apoptosis. We also confirmed microRNA‐217 (miR‐217) was downregulated in ccRCC tumor tissues, and negatively correlated with CUL4B expression. Further investigations revealed miR‐217 targeted CUL4B and markedly inhibited its expression in ccRCC cells. In addition, overexpression of miR‐217 by mimics significantly suppressed ccRCC cell growth. In contrast, enforced expression of CUL4B significantly abolished miR‐217‐induced cell survival inhibition in ccRCC cells. In conclusion, our present results suggested targeting miR‐217‐CUL4B axis would be a promising strategy for ccRCC treatment.

1. INTRODUCTION

Clear cell renal cell carcinoma (ccRCC) is a common malignant tumor in human kidney, which mainly originates from renal tubular epithelium and occurs in renal parenchyma. ¹ And the incidence rate of ccRCC is increasing every year. For early ccRCC patients, surgery is the best strategy, and the survival rate of patients is very high. ² After operation, the 5‐year survival of early‐stage ccRCC patients is more than 90%, and the 5‐year survival of middle‐stage patients is about 80%. ³ However, for late‐stage patients, the survival rate is only about 20%, and patients are not sensitive to radiotherapy and chemotherapy. ⁴ Therefore, it is very important to find new pathogenesis for the early diagnosis and treatment of ccRCC.

Cullin 4B (CUL4B) protein is the skeleton protein of Cullin4B‐RING E3 ligase (CRL4B) complex, which belongs to the largest known ubiquitin ligases of the ubiquitin‐proteasome system (UPS). ⁵ UPS has been considered to be the most important way of protein degradation, and it is involved in many important life processes, such as cell cycle regulation, signal transduction, tumorigenesis and so on. ⁶ In human beings, there are eight members in Cullin family, namely CUL1, CUL2, CUL3, CUL4A, CUL4B, CUL5, CUL7, and PARC, and they are characterized with a Cullin‐homology domain. ⁷ Among them, the E3 ligases Cullin 4 family have been demonstrated to play emerging roles in tumorigenesis. ⁸ In prostate cancer, CUL4B was reported to be markedly upregulated in tumor tissues compared with the benign prostatic tissues, and CUL4B overexpression resulted in a poor prognosis for prostate cancer patients. ⁹ And overexpressed CUL4B promoted prostate cancer cell proliferation and aggressiveness by regulating miR‐33b/C‐MYC axis. ⁹ In addition, CUL4B was also reported to promote the development of colon cancer by maintaining the tumor stem‐like features through repressing miR34a expression, and elevated CUL4B was also confirmed in the tumor tissues of colon cancer, which also indicated a poor overall survival for colon cancer patients. ¹⁰

Our present study confirmed that CUL4B was elevated in ccRCC, and knockdown of CUL4B inhibited cell growth and induced cell apoptosis in ccRCC cells. Moreover, miR‐217 was found to target CUL4B and inhibit its expression in ccRCC cells. Targeting miR‐217/CUL4B axis may be a potential strategy for ccRCC treatment.

2. MATERIALS AND METHODS

2.1. Cells, cell culture, and tissues

HK‐2, 786‐O, ACHN, Caki‐2, and UM‐RC‐2 were obtained from ATCC, Manassas, USA. All cells were cultured in RPMI‐1640 medium containing 1% penicillin/streptomycin and 10% FBS. The ccRCC tumor tissues and corresponding normal tissues (n = 15 pairs) were obtained from Sunshine Union Hospital, and the use of the samples was approved by the Institutional Review Board of Sunshine Union Hospital.

2.2. Western blot

Total protein of equal amounts was separated by polyacrylamide/acrylamide gel electrophoresis, and transferred to PVDF membrane. Then, specific antibodies were used to detect protein expression. Among them, anti‐CUL4B antibody was purchased from Abcam, Massachusetts, USA. Anti‐PARP, Mcl‐1, Bcl‐2, and β‐actin antibodies were purchased from CST, Massachusetts.

2.3. RT‐qPCR

To evaluate CUL4B mRNA levels, real‐time quantitative PCR (RT‐qPCR) was performed. Briefly, the total RNA was extracted using Trizol Reagent (TaKaRa Bio, Dalian, China), and then reverse transcribed into cDNA by using First‐Strand cDNA Synthesis Kit (TaKaRa Bio, Dalian, China). Then, cDNA was prepared for RT‐qPCR analysis using SYBR Green Mix (Roche, Basel, Switzerland). Primers used were as follows: CUL4B, forward 5′‐CCTGGAGTTTGTAGGGTTTGAT‐3′ and reverse 5′‐GAGACGGTGGTAGAAGATTTGG‐3′; β‐actin, forward 5′‐TTAGTTGCGTTACACCCTTTC‐3′ and reverse 5′‐ACCTTCACCGTTCCAGTTT‐3′. To analyze miR‐217 expression, the miRNA RT‐qPCR Primer Sets specific for miR‐217 were synthesized by Ruibo Biotechnology Co., Ltd (Guangzhou, China). Total RNA was extracted with the MiRNeasy Mini Kit purchased from QIAGEN, Hilden, Germany. Then, miRNA bulge‐loop was reverse‐transcribed by using Quantscript RT Kit (QIAGEN, Hilden, Germany). U6 was used as an internal control.

2.4. SiRNA, miRNA, and plasmid transfection

The siRNAs against CUL4B and miR‐217 mimics were synthesized by Ruibo Biotechnology Co., Ltd (Guangzhou, China). The siRNAs and miRNA mimics were transfected into ccRCC cells with LipofectamineRNAiMAX Transfection Reagent (Thermo, MA, USA) according to the manufacturer's instructions.

The human CUL4B gene was amplified by PCR and subcloned into pcDNA3.1 vector. The fragments containing wild‐type (WT) and mutated CUL4B 3'UTR were synthesized by Sagan Biotechnology Co., Ltd (Shanghai, China), and then subcloned into PGL3 vector. These recombinant plasmids were transfected into ccRCC cells by using Lipofectamine2000 (Thermo, MA, USA).

2.5. Cell growth and survival assay

To detect cell growth and survival, ccRCC cells transfected with siRNAs or miRNA mimics were treated with CCK‐8 according to the manufacturer's instructions (Dojindo, Kyushu, Japan). The corresponding absorbance was measured at 450 nm.

2.6. Cell apoptosis assay

To analyze cell apoptosis, Annexin V‐FITC cell apoptosis detection kit was used (Beyotime, Beijing, China). The ccRCC cells were transfected with siNC or siCUL4B‐1 for 72 hours, and then cells were stained with Annexin V and propidium iodide for 15 minutes, followed by flow cytometry (Thermo, MA, USA).

2.7. Luciferase assay

To verify the target gene of miR‐217, Dual‐Luciferase Reporter Assay System was used according to the manufacturer's instructions (Promega, WI, USA). The ccRCC cells were cotransfected with PGL3‐CUL4B mutant or WT reporter plasmids along with mimic‐NC or miR‐217 mimics by using Lipofectamine2000 (Thermo, MA, USA). Renilla was used as an internal control. Seventy‐two hours later, cells were lysed for luciferase assay.

2.8. Statistical analysis

To compare the differences between two groups, student's t test was used. Moreover, P value less than .05 was considered statistically significant. CUL4B expression was analyzed by Oncomine datasets based on Beroukhim Renal Statistics (www.oncomine.org). TargetScanHuman tool (http://www.targetscan.org) was used to predict the binding sites of miR‐217 in CUL4B 3'UTR.

3. RESULTS

3.1. CUL4B is elevated in ccRCC tumor tissues and cell lines

To investigate CUL4B expression, the public cancer database Oncomine was used. As shown in Figure 1A, CUL4B was markedly upregulated in ccRCC tumor tissues compared with renal cortex and renal tissue. To further confirm it, several ccRCC tumor specimens were collected for RT‐qPCR analysis. As shown in Figure 1B, it showed the mRNA levels of CUL4B were higher in ccRCC tumor tissues than in corresponding normal tissues. Moreover, CUL4B expression was also evaluated in cell lines. As shown in Figure 1C,D, both of the Western blot and RT‐qPCR showed that CUL4B was elevated in ccRCC cell lines compared with the human normal kidney cell line HK‐2. These results proved CUL4B was elevated in ccRCC.

FIGURE 1.

CUL4B is upregulated in ccRCC tumor tissues and cell lines. A, CUL4B expression was analyzed by Oncomine datasets based on Beroukhim Renal Statistics. B, RT‐qPCR analysis of CUL4B mRNA expression in ccRCC tumor tissues and corresponding normal tissues. C and D, Western blot, C, and RT‐qPCR, D, were performed to analyze the protein and mRNA expression of CUL4B in human normal kidney cell line HK‐2 and ccRCC cell lines. CUL4B, Cullin 4B; ccRCC, clear cell renal cell carcinoma; ^* P < .05; ^** P < .01

3.2. Knockdown of CUL4B inhibits cell growth and promotes cell apoptosis in ccRCC cells

To evaluate the function of CUL4B in ccRCC, CUL4B was knocked down by siRNAs in ccRCC cell lines (Figure 2A). The CCK‐8 assay showed knockdown of CUL4B significantly inhibited ccRCC cell growth in both of 786‐O and Caki‐2 cells (Figure 2B,C). Subsequently, we also analyzed the status of cell apoptosis when cells were treated with siRNAs. As shown in Figure 2D, the flow cytometry showed knockdown of CUL4B by siRNAs significantly induced cell apoptosis in both of 786‐O and Caki‐2 cells. In mechanism, CUL4B knockdown markedly inhibited anti‐apoptotic proteins' expression in ccRCC cells, including Mcl‐1 and Bcl‐2, and silenced CUL4B also induced the cleavages of PARP (Figure 2E). These results indicated CUL4B was functional in ccRCC and it regulated cell growth and apoptosis in ccRCC cells.

FIGURE 2.

Knockdown of CUL4B inhibits cell growth and induces cell apoptosis in ccRCC cells. A, Western blot was used to detect the interference efficiency of siRNAs in 786‐O and Caki‐2 cells. B and C, 786‐O, B, and Caki‐2 cells, C, transfected with siRNAs were prepared for CCK‐8 assay at indicated times. D and E. 786‐O and Caki‐2 cells were transfected with siNC or siCUL4B‐1 for 72 hours, and then cells were stained with Annexin V and propidium iodide, followed by flow cytometry, D, and cells were also lysed for Western blot analysis, E. CUL4B, Cullin 4B; ^** P < .01

3.3. MiR‐217 targets CUL4B and inhibits its expression in ccRCC cells

We also confirmed miR‐217 was down‐regulated in ccRCC tumor tissues (Figure 3A). And the correlation analysis based on Figure 3A and Figure 1B data showed CUL4B expression was negatively correlated with miR‐217 expression (Figure 3B). Moreover, overexpression of miR‐217 by mimics significantly down‐regulated both of the mRNA and protein levels of CUL4B in 786‐O and Caki‐2 cells (Figure 3C,D).

FIGURE 3.

CUL4B is negatively regulated by miR‐217 in ccRCC cells. A, The expression of miR‐217 in ccRCC tumor tissues and corresponding normal tissues. B, Correlation analysis between CUL4B and miR‐217 expression. C and D, 786‐O and Caki‐2 cells were transfected with mimic‐NC or miR‐217 mimic for 72 hours, followed by RT‐qPCR, C, and western blot, D. CUL4B, Cullin 4B; ^** P < 0.01

To further confirm whether miR‐217 targeted CUL4B, informative analysis was conducted. As shown in Figure 4A, TargetScanHuman tool was used, and it predicted miR‐217 could bind to the indicated 3'UTR region of CUL4B. Then, to verify the target gene of miR‐217, Dual‐Luciferase Reporter Assay System was used. As shown in Figure 4B,C, the luciferase assay showed miR‐217 mimics significantly inhibited the luciferase activity of the wild‐type (WT) construct in both of 786‐O and Caki‐2 cells, but not the mutant in which the binding sits in CUL4B 3'UTR was mutated. Collectively, these results suggested miR‐217 targeted CUL4B and inhibited its expresssion in ccRCC cells.

FIGURE 4.

CUL4B is a target of miR‐217 in ccRCC cells. A, TargetScanHuman tool was used to predict the binding sites between CUL4B 3'UTR and miR‐217 (http://www.targetscan.org). B and C, 786‐O, B, and Caki‐2, C, cells were cotransfected with PGL3‐CUL4B Mutant or WT reporter plasmids along with mimic‐NC or miR‐217 mimic for 72 hours, followed by luciferase activity. CUL4B, Cullin 4B; ^** P < .01

3.4. Enforced CUL4B abolishes miR‐217‐induced cell survival inhibition in ccRCC cells

Subsequently, miR‐217 was overexpressed by mimics in ccRCC cells (Figure 5A), and we confirmed overexpression of miR‐217 significantly suppressed ccRCC cell growth in both of 786‐O and Caki‐2 cells (Figure 5B,C). However, when ccRCC cells were reintroduced of CUL4B into miR‐217‐transfected ccRCC cells (Figure 5D), the reintroduced CUL4B significantly reversed the effects of miR‐217 on ccRCC cell survival (Figure 5E,F). These results further indicated CUL4B was one target of miR‐217.

FIGURE 5.

Overexpression of miR‐217 inhibits ccRCC cell growth and abolished by enforced CUL4B. A, Detection of transfection efficiency of miR‐217 mimic by RT‐qPCR at day 2. B and C, 786‐O, B, and Caki‐2, C, cells were transfected with mimic‐NC or miR‐217 mimic for indicated times, followed by CCK‐8 assay. D, Detection of transfection efficiency of pcDNA3.1‐CUL4B by Western blot at day 2. E and F. 786‐O, E and Caki‐2, F, cells were transfected with miR‐217 mimic or pcDNA3.1‐CUL4B plasmids for 48 hours, followed by CCK‐8 assay. CUL4B, Cullin 4B; ^** P < .01

4. DISCUSSION

Our present study found that CUL4B expression in ccRCC tumor specimens was more than double than that in adjacent tissues. CUL4B was also found significantly upregulated in ccRCC cell lines compared with the human normal kidney cell line. Among those, the expression levels of CUL4B in 786‐O/Caki‐2 were higher than that in ACHN/UM‐RC‐2, but we did not investigate the difference between 786‐O/Caki‐2 and ACHN/UM‐RC‐2 cell lines with their tumor behavior, which will be studied in our future work. CUL4B has been also reported to be elevated in several other solid cancers. ⁵ In colorectal cancer, CUL4B was found elevated, and its knockdown led to the suppression of colorectal cancer cell proliferation, metastasis and sphere formation. ¹⁰ In gastric cancer, CUL4B was also found overexpressed, and CUL4B overexpression was positively correlated with poor prognosis of gastric cancer patients. ¹¹ Moreover, CUL4B overexpression promoted the epithelial‐mesenchymal transition and invasion of gastric cancer cells by upregulating HER2. ¹¹ In short, similar expression and effects of CUL4B also exist in other solid tumors, such as prostate cancer, ⁹ lung cancer, ¹² pancreatic cancer, ¹³ and so on.

As shown above, the elevated expression of CUL4B has been proved in a majority of cancers, including ccRCC. And it has been also shown that inhibiting CUL4B has been a potential strategy for the treatment of several solid cancers. ¹⁴ , ¹⁵ In osteosarcoma, the naturally‐sourced small molecule TSC01682 was identified as an active compound which could markedly inhibit cell growth by suppressing CUL4B‐DDB1 interaction. ¹⁴ Several microRNAs were also reported to repress CUL4B expression in different tumors, and they displayed antitumor activities by inhibiting CUL4B expression. For example, in non‐small cell lung cancer (NSCLC), the microRNA miR‐101‐3p was found to target CUL4B and inhibit its expression, but in contrast, circular RNA ZFR (circZFR) acted as a sponge of miR‐101‐3p, which thus promoted NSCLC progression by enhancing CUL4B expression. ¹⁶ And in gastric cancer, the microRNAs miR‐381 and miR‐489 could directly target CUL4B and inhibit its expression, and thus they displayed antitumor activities. ¹⁷ In this study, we found that the miR‐217 could also target CUL4B and inhibit its expression in ccRCC cells. Thus, using the microRNAs or small molecules to inhibit the expression or function of CUL4B has potential significance for the treatment of ccRCC in clinic.

5. CONCLUSION

Our present study indicates miR‐217 functions to suppress CUL4B expression in ccRCC, and miR‐217/CUL4B axis could be a potential therapeutical target in ccRCC.

CONFLICT OF INTEREST

All authors declare no potential conflicts of interest.

Yang H‐F, Wang Z‐L, Mao T‐T, Liu J‐C. Cullin 4B regulates cell survival and apoptosis in clear cell renal cell carcinoma as a target of microRNA‐217. Kaohsiung J Med Sci. 2021;37:121–127. 10.1002/kjm2.12307