Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2020 May 12;36(9):705–711. doi: 10.1002/kjm2.12225

Inhibition of proprotein convertase subtilisin/kexin type 9 attenuates 2,4,6‐trinitrobenzenesulfonic acid‐induced colitis via repressing toll‐like receptor 4/nuclear factor‐kappa B

Lei Lei 1, Xu Li 2, You‐Jun Yuan 3, Zhi‐Li Chen 3, Jian‐Hua He 1, Jian‐Hua Wu 3, Xiao‐Sheng Cai 3,✉
PMCID: PMC11896329  PMID: 32396274

Abstract

Inflammatory bowel disease (IBD) is characterized by recurring inflammatory disorders in digestive system, and devoid of effective treatment. Proprotein convertase subtilisin/kexin type 9 (PCSK9), stimulated via inflammation whose inhibition could decrease secretion of inflammatory factors. We then determined whether inhibition of PCSK9 could improve the inflammation. First, rats model of colitis was first established via administration of 2,4,6‐trinitrobenzenesulfonic acid (TNBS), and then verified via determination of body weight loss, myeloperoxidase (MPO) activity, and histopathological analysis of colonic damage. Results showed that treatment with TNBS induced a great body weight loss, MPO activity increase, and serious colonic damage, showing an obviously character of IBD. PCSK9 was elevated in TNBS‐induced rats, and PCSK9 inhibition delivered by adenovirus vector increased the body weight, decreased MPO activity, and ameliorated histological change of colon. Second, the protective effect of PCSK9 inhibition against TNBS‐induced colitis was accompanied by decrease of proinflammatory factors secretion, including tumor necrosis factor‐α, interleukin‐1β, interleukin‐6, intercellular adhesion molecule 1, and monocyte chemoattractant protein‐1. TNBS could activate toll‐like receptor 4 (TLR4)/nuclear factor‐kappa B (NF‐κB) signaling pathway, while PCSK9 inhibition suppressed activation of TLR4/NF‐κB in TNBS‐induced rats. In conclusion, PCSK9 inhibition attenuated TNBS‐induced rat colitis through anti‐inflammatory effect under inactivation of TLR4/NF‐κB, suggesting potential therapeutic strategy in IBD.

Keywords: colitis, inflammation, NF‐κB, PCSK9, TLR4

1. INTRODUCTION

Inflammatory bowel disease (IBD) is characterized by recurring inflammation in digestive system, and includes ulcerative colitis and Crohn's disease, 1 Genetic, infectious, and immune system disorders are found to be associated with pathogenesis of IBD. 2 It is beneficial to inhibit secretion of proinflammatory mediators during the prevention of chronic inflammation. 3 Therefore, efforts to mediate inflammatory pathways can inhibit IBD progression.

Proprotein convertase subtilisin/kexin type 9 (PCSK9), member of proprotein convertase family, contributes to cholesterol homeostasis via degradation of low‐density lipoprotein receptor and decrease cholesterol intake in liver. 4 PCSK9 has been regarded as target for interventions of atherosclerosis. 5 Inhibition of PCSK9 shows promising effect on tumor growth suppression. 6 Moreover, study has shown that inflammation can stimulate the expression of PCSK9. 7 PCSK9 plays an important role in inflammation. Differential expression of PCSK9 in sepsis mice regulates infection, inflammation, and coagulation. 8 PCSK9 was increased in patients with periodontitis and mice infected with porphyromonas gingivalis, and knockdown of PCSK9 could reduce inflammatory response via decrease of proinflammatory factors secretion. 9 However, whether PCSK9 plays a role in IBD needs to be further investigated.

Toll‐like receptors (TLRs), critical mediators in inflammatory response, participate in progression of atherosclerotic lesions. 10 TLRs could recruit and stimulate activation of nuclear factor‐κB (NF‐κB). 11 NF‐κB functions as transcriptional factor to regulate genes involved in immune responses and cytokines production. 12 Considering that PCSK9 could enhance secretion of proinflammatory cytokines and lead to atherosclerosis plaque inflammation, TLR4/NF‐κB is the main signaling pathway to mediate PCSK9‐induced inflammatory response. 13 Moreover, TLR4 is a key receptor for intestinal innate immune synesthesia recognition and found to be overexpressed in IBD. 14 Hyperactivation of TLR4/NF‐κB is associated with colitis, 15 and blocking TLR4/NF‐κB may eliminate intestinal inflammation of IBD. Therefore, this study was designed to evaluate effect and mechanism of PCSK9 on 2,4,6‐trinitrobenzenesulfonic acid (TNBS)‐induced rats colitis.

2. MATERIALS AND METHODS

2.1. Adenoviral vectors

shRNAs for knocking down of PCSK9 (1#: 5′‐ggaacctggagcgaattatcc‐3′ and 2#: 5′‐ggaggtgtatctcttagatac‐3′), as well as the negative control (shNC), were inserted to adenoviral vectors. The adenoviral vectors (Ad‐shPCSK9 1# and Ad‐shNC) were cotransfected into 293 T cells with pHelper 1.0 and pHelper 2.0 (Genechem, Shanghai, China). Viruses were harvested and purified by ultracentrifugation via cesium chloride gradients from the supernatants.

2.2. Animals

Twenty‐four male Wistar rats (8‐10 weeks old and weighing between 180 and 220 g) were obtained from Slac Laboratory Animal Corporation (Shanghai, China). Rats were housed with standard diet and water. The study was approved by the Ethics Committee of The Central Hospital of Enshi Autonomous Prefecture, and experimental procedures were performed in accordance with the guidelines of Guide for the Care and Use of Laboratory Animals of the National Institutes of Health. Rats were divided into four groups with six rats for each group: control, control with Ad‐shPCSK9 1#, TNBS, and TNBS with Ad‐shPCSK9 1#.

For the TNBS groups, rats were fasted for 24 hours before induction of colitis, and then anesthetized via intraperitoneal injection of 10% chloral hydrate solution (0.3 mL/100 g). Rats were intrarectal administrated with 100 mg/kg TNBS dissolved in 0.25 mL 50% ethanol solution via catheter. For control groups, rats were intrarectal administrated with 0.25 mL 50% ethanol solution in PBS. Ten days after induction, rats were intracolonic administrated with 0.25 mL 1 × 108 PFU Ad‐shPCSK9 1# or Ad‐shNC. Seven days later, rats were euthanized and the colons were dissected.

2.3. Measurement of myeloperoxidase activity

The colon tissues were homogenized in tissue lysis buffer, and the supernatant was harvested. Myeloperoxidase (MPO) activity was measured via MPO Kit (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).

2.4. Histological analysis

Fixed and paraffined colon tissues with 5 μm sections were stained with H&E (Sigma Aldrich, St. Louis, Missouri), and then examined under light microscopy (Olympus, Tokyo, Japan). The colon damage was scored as: Grade 0 (mucosa, submucosa, muscularis propria, and serous membrane were normal, without inflammatory cells); Grade 1 (inflammatory cells in the mucosa and submucosa); Grade 2 (acute inflammation through the wall); Grade 3 (small ulcer with acute inflammation of the wall); Grade 4 (multiple large ulcers with transmural inflammation); and Grade 5 (extensive ulceration, total or partial necrosis, interdural inflammation, irregular villous mucosal surface).

2.5. Detection of proinflammatory factors

Supernatant of colon tissues homogenate was obtained via centrifugation. The concentrations of tumor necrosis factor‐α (TNF‐α), interleukin‐1β (IL‐1β), interleukin‐6 (IL‐6), intercellular adhesion molecule 1 (ICAM‐1), and monocyte chemoattractant protein‐1 (MCP‐1) were measured via ELISA kit (R&D Systems, Minneapolis, Minnesota).

2.6. Western blot

Proteins extracted from colon tissues homogenate (30 μg/lane) were resolved in SDS‐PAGE, and transferred to polyvinylidine difluoride membranes. After blocking with 1% BSA, the membranes were incubated overnight with primary antibodies: anti‐PCSK9 (1:1500; Cell Signaling Technology, Boston, Massachusetts), anti‐TLR4, anti‐IκBα, and phospho‐IκBα (1:2000; Abcam, Cambridge, Massachusetts), anti‐p65 and phospho‐p65 (1:2000; Abcam), and β‐actin (1:3000; Cell Signaling Technology) at 4°C. Finally, the immunoreactivities were detected by enhanced chemiluminescence (KeyGen, Nanjing, China) after incubating with HRP labeled secondary antibody (1:5000; Cell Signaling Technology).

2.7. Statistical analysis

Results were expressed as mean ± SEM, and statistical analyses were determined via GraphPad Prism software and one‐way analysis of variance. P < .05 was considered as a mark of statistically significant.

3. RESULTS

3.1. PCSK9 was elevated in TNBS‐induced rat colitis

Rat model was established via TNBS treatment. A series of indices, including body weight, colorectal histology, were then measured. Result showed that rats treated with TNBS indicated significantly body weight loss compared with the control (Figure 1A). Moreover, MPO activity was greater in rats under TNBS treatment than in control (Figure 1B). Colons of control rats revealed intact morphology with complete colonic crypts and low histological damage score (Figure 1C), while TNBS treatment caused ulceration of the colon membrane and high histological damage score (Figure 1C), indicating successful colitis model. Expression of PCSK9 was elevated in rats under TNBS treatment (Figure 1D), suggesting a potential regulatory role in TNBS‐induced colitis.

FIGURE 1.

FIGURE 1

Open in a new tab

PCSK9 was elevated in TNBS‐induced rat colitis. A, Body weight change in rats from control or TNBS group. ** represents TNBS vs control, P < .01. B, MPO activity in rats from control or TNBS group. ** represents TNBS vs control, P < .01. C, Histological characteristics of the colons in rats from control or TNBS group. The histological score was determined. ** represents TNBS vs control, P < .01. D, Protein expression of PCSK9 in rats from control or TNBS group. MPO, myeloperoxidase; PCSK9, proprotein convertase subtilisin/kexin type 9; TNBS, 2,4,6‐trinitrobenzenesulfonic acid

3.2. Knockdown of PCSK9 improved symptoms in TNBS‐induced colitis

Exact regulatory role of PCSK9 on symptoms of IBD was then evaluated by loss‐of functional assays. Knockdown of PCSK9 via shRNAs was confirmed in Figure 2A. Meanwhile, shPCSK9 1# with the lower expression was chosen for the following experiments. PCSK9 inhibition delivered by adenovirus vector ameliorated the body weight loss induced by TNBS (Figure 2B), decreased the MPO activity (Figure 2C). Moreover, PCSK9 inhibition alleviated TNBS‐induced intestinal ulceration, and resulted in lower histological damage score than rats under TNBS treatment (Figure 2D). Therefore, knockdown of PCSK9 improved symptoms in TNBS‐induced colitis.

FIGURE 2.

FIGURE 2

Open in a new tab

Knockdown of PCSK9 improved symptoms in TNBS‐induced colitis. A, Transfection efficiency of shPCSK9 1# and 2# detected by western blot. *, **, *** represent control + Ad‐shPCSK9 1#, control + Ad‐shPCSK9 2#, or TNBS + Ad‐shNC vs control + Ad‐shNC, P < .05, P < .01, P < .001. ### represents TNBS + Ad‐shPCSK9 1# or TNBS + Ad‐shPCSK9 2# vs TNBS + Ad‐shNC, P < .001. B, The effect of PCSK9 inhibition on body weight of TNBS‐induced rats. ** represents TNBS + Ad‐shNC vs control + Ad‐shNC, P < .01. ## represents TNBS + Ad‐shPCSK9 1# vs TNBS + Ad‐shNC, P < .01. C, The effect of PCSK9 inhibition on MPO activity of TNBS‐induced rats. ** represents TNBS + Ad‐shNC vs control + Ad‐shNC, P < .01. ## represents TNBS + Ad‐shPCSK9 1# vs TNBS + Ad‐shNC, P < .01. D, The effect of PCSK9 inhibition on histological characteristics of the colons in TNBS‐induced rats. *** represents TNBS + Ad‐shNC vs control + Ad‐shNC, P < .001. ### represents TNBS + Ad‐shPCSK9 1# vs TNBS + Ad‐shNC, P < .001. MPO, myeloperoxidase; PCSK9, proprotein convertase subtilisin/kexin type 9; TNBS, 2,4,6‐trinitrobenzenesulfonic acid

3.3. Knockdown of PCSK9 suppressed inflammation in TNBS‐induced colitis

A significant decrease in MPO activity by PCSK9 inhibition represented an improved inflammatory reaction. Levels of proinflammatory factors were then detected. There was an obvious increase of TNF‐α (Figure 3A), IL‐1β (Figure 3B), IL‐6 (Figure 3C), ICAM‐1 (Figure 3D), and MCP‐1 (Figure 3E) in rats under TNBS treatment compared with control. However, PCSK9 inhibition delivered by adenovirus vector significantly inhibited TNBS‐induced TNF‐α (Figure 3A), IL‐1β (Figure 3B), IL‐6 (Figure 3C), ICAM‐1 (Figure 3D), and MCP‐1 (Figure 3E) in colon tissues, suggesting that knockdown of PCSK9 suppressed inflammation in TNBS‐induced rat colitis.

FIGURE 3.

FIGURE 3

Open in a new tab

Knockdown of PCSK9 suppressed inflammation in TNBS‐induced colitis. A, The effect of PCSK9 inhibition on TNF‐α secretion in colons of TNBS‐induced rats. ** represents TNBS + Ad‐shNC vs control + Ad‐shNC, P < .01. ## represents TNBS + Ad‐shPCSK9 1# vs TNBS + Ad‐shNC, P < .01. B, The effect of PCSK9 inhibition on IL‐1β secretion in colons of TNBS‐induced rats. ** represents TNBS + Ad‐shNC vs control + Ad‐shNC, P < .01. ## represents TNBS + Ad‐shPCSK9 1# vs TNBS + Ad‐shNC, P < .01. C, The effect of PCSK9 inhibition on IL‐6 secretion in colons of TNBS‐induced rats. ** represents TNBS + Ad‐shNC vs control + Ad‐shNC, P < .01. ## represents TNBS + Ad‐shPCSK9 1# vs TNBS + Ad‐shNC, P < .01. D, The effect of PCSK9 inhibition on ICAM‐1 secretion in colons of TNBS‐induced rats. ** represents TNBS + Ad‐shNC vs control + Ad‐shNC, P < .01. ## represents TNBS + Ad‐shPCSK9 1# vs TNBS + Ad‐shNC, P < .01. E, The effect of PCSK9 inhibition on MCP‐1 secretion in colons of TNBS‐induced rats. ** represents TNBS + Ad‐shNC vs control + Ad‐shNC, P < .01. ## represents TNBS + Ad‐shPCSK9 1# vs TNBS + Ad‐shNC, P < .01. IL‐1β, interleukin‐1β; IL‐6, interleukin‐6; PCSK9, proprotein convertase subtilisin/kexin type 9; TNBS, 2,4,6‐trinitrobenzenesulfonic acid; TNF‐α, tumor necrosis factor‐α

3.4. Knockdown of PCSK9 repressed TNBS‐induced TLR4/NF‐κB activation in colitis

To determine signaling pathway involved in protective effect of PCSK9 inhibition against TNBS‐induced colitis, TLR4/NF‐κB, important for regulation of inflammatory response, was then evaluated. First, TLR4 and p65 phosphorylation were increased in rats under TNBS treatment (Figure 4), while protein expression of p65 was not affected by TNBS (Figure 4). Moreover, IκBα, inhibitor of NF‐κB, was decreased, while IκBα phosphorylation was increased in TNBS‐induced rats compared to control (Figure 4), showing that TNBS induced TLR4/NF‐κB pathway activation in colitis. Nevertheless, PCSK9 inhibition decreased protein expression of TLR4, IκBα phosphorylation, and p65 phosphorylation, while increased IκBα (Figure 4), furtherly revealing that knockdown of PCSK9 repressed TNBS‐induced TLR4/NF‐κB pathway activation in colitis.

FIGURE 4.

FIGURE 4

Open in a new tab

Knockdown of PCSK9 repressed TNBS‐induced TLR4/NF‐κB pathway activation in colitis. The effect of PCSK9 inhibition on TLR4, IκBα, p‐IκBα, p65, and p‐p65 expression in colons of TNBS‐induced rats. *** represents TNBS + Ad‐shNC vs control + Ad‐shNC, P < .001. ### represents TNBS + Ad‐shPCSK9 1# vs TNBS + Ad‐shNC, P < .001. PCSK9, proprotein convertase subtilisin/kexin type 9; TLR4/NF‐κB, toll‐like receptor 4/nuclear factor‐kappa B; TNBS, 2,4,6‐trinitrobenzenesulfonic acid

4. DISCUSSION

Gut is the most important organs for absorption of nutrients in the whole body. 16 Notably, IBD seriously affect people's lives with increasing incidence and prevalence. 17 Recent therapies could ameliorate IBD, but direct therapeutic medicines do not yet exist. 18 The present study clarified a potential therapeutic target, PCSK9, in IBD.

Recently, overloading of inflammatory responses in the host intestinal mucosa is considered as pathogenesis of IBD development and occurrence. 19 TNBS, a nitroaryl oxidizing acid, with the ability to induce features resembling human Crohn's disease, including progressive weight loss and intense transmural inflammation, 20 has long been used as well‐established experimental model for IBD. 21 This study revealed that intrarectal administration of TNBS induced typical characteristics of IBD, including greater body weight loss, ulceration of the colon membrane with high histological damage score. Moreover, MPO, a neutrophil‐specific enzyme, is associated with leukocyte infiltration and cause tissue inflammation damage. 22 TNBS treatment increased MPO activity, thus revealing severity of colitis. Interestingly, PCSK9, a stimulator of inflammation, was elevated in rats after TNBS treatment, suggesting a potential regulatory role in IBD.

PCSK9 inhibition delivered by adenovirus vector into TNBS‐induced rats increased the body weight, decreased MPO activity, and alleviated intestinal ulceration with lower histological damage score, suggesting a protective role against IBD. However, as reported before, S1P functions as precursor convertases to produce active peptides via intracellular proteolysis of inactive precursors, and mediates activating transcription factor 6, thus participating in colitis. 23 PCSK9 can direct bind with low‐density lipoprotein receptor, 24 the binding target involved in PCSK9‐mediated colitis needs to be further investigated.

Previous study has shown that PCSK9 could stimulate secretion of inflammatory factors (TNF‐α, IL‐1β, and IL‐6) and chemokine (MCP‐1). 25 ICAM‐1, associated with cell‐to‐cell interaction, was reduced by PCSK9 inhibition to suppress vascular inflammation. 26 Moreover, extensive research has shown that increased proinflammatory cytokines and chemokines were associated with IBD. 27 Result of the present study showed that PCSK9 inhibition effectively decreased the secretion of TNF‐α, IL‐1β, IL‐6, MCP‐1, and ICAM‐1 in the colon of TNBS‐induced colitis rats, suggesting anti‐inflammation role against IBD.

Multiple signaling pathways, including peroxisome proliferator‐activated receptors, 28 Hedgehog pathway, 29 stimulator of interferon genes, 30 janus kinase/signal transducer and activator of transcription, 31 and Wnt, 32 are implicated in colitis. TLR4/NF‐κB, regulating inflammatory factors secretion, is closely associated with colitis initiation and development. 33 TLR4 was upregulated in patients with IBD 34 and colitis model. 35 NF‐κB was also upregulated in TNBS‐induced colitis. 2 In line with previous study, 36 the present study showed that TNBS stimulated TLR4/NF‐κB activation, thus leading to release of proinflammatory factors and promotion of inflammatory response. Antagonizing the TLR4 receptor 37 and inhibition of NF‐κB activation 38 could abrogate inflammatory response in IBD. Knockdown of PCSK9 could decrease protein expression of TLR4 and p65, thus inhibiting atherosclerotic inflammation. 13 Our result showed that PCSK9 inhibition decreased TLR4 and p65 phosphorylation, suggesting inhibition of TLR4/NF‐κB activation. Moreover, a significant increase of IκBα phosphorylation and decrease of intact IκBα were observed in colons of TNBS‐induced rats. IκBα functions as inhibitor of NF‐κB, and phosphorylation of IκBα could promote nuclear translocation of NF‐κB and promote secretion of inflammatory cytokines and other immune regulators. 39 However, PCSK9 inhibition decreased IκBα phosphorylation and increased IκBα to prevent degradation of IκBα, thus suppressing NF‐κB nuclear translocation to protect against TNBS‐induced colitis. Whether other signaling pathways are involved in PCSK9‐mediated IBD needs to be further investigated. In addition, the clinical significance of PCSK9 inhibition on IBD needs to be strengthened in the further study.

5. CONCLUSION

Knockdown of PCSK9 protected against TNBS‐induced colitis via inactivation of TLR4/NF‐κB, suggesting that juglone might serve as a potential candidate for IBD therapy.

CONFLICT OF INTEREST

The authors declare no conflicts of interest.

Lei L, Li X, Yuan Y‐J, et al. Inhibition of proprotein convertase subtilisin/kexin type 9 attenuates 2,4,6‐trinitrobenzenesulfonic acid‐induced colitis via repressing toll‐like receptor 4/nuclear factor‐kappa B. Kaohsiung J Med Sci. 2020;36:705–711. 10.1002/kjm2.12225

REFERENCES

  • 1. Chachu KA, Osterman MT. How to diagnose and treat IBD mimics in the refractory IBD patient who does not have IBD. Inflamm Bowel Dis. 2016;22(5):1262–1274. [DOI] [PubMed] [Google Scholar]
  • 2. Zeng Z, Zhan L, Liao H, Chen L, Lv X. Curcumin improves TNBS‐induced colitis in rats by inhibiting IL‐27 expression via the TLR4/NF‐kappa B signaling pathway. Planta Med. 2013;29(02):102–109. [DOI] [PubMed] [Google Scholar]
  • 3. Gutierrez‐Orozco F, Thomas‐Ahner JM, Berman‐Booty LD, Galley JD, Chitchumroonchokchai C, Mace T, et al. Dietary α‐mangostin, a xanthone from mangosteen fruit, exacerbates experimental colitis and promotes dysbiosis in mice. Mol Nutr Food Res. 2014;58(6):1226–1238. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Soutar A. Unexpected roles for PCSK9 in lipid metabolism. Curr Opin Lipidol. 2011;22:192–196. [DOI] [PubMed] [Google Scholar]
  • 5. Betteridge D. Cardiovascular endocrinology in 2012: PCSK9 – An exciting target for reducing LDL‐cholesterol levels. Nat Rev Endocrinol. 2013;9:76. [DOI] [PubMed] [Google Scholar]
  • 6. Momtazi‐Borojeni AA, Nik ME, Jaafari MR, Banach M, Sahebkar A. Effects of immunization against PCSK9 in an experimental model of breast cancer. Arch Med Sci. 2019;15(3):570–579. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Feingold KR, Moser AH, Shigenaga JK, Patzek SM, Grunfeld C. Inflammation stimulates the expression of PCSK9. Biochem Biophys Res Commun. 2008;374(2):341–344. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Dwivedi D, Grin P, Khan M, Prat A, Zhou J, Fox‐Robichaud A, et al. Differential expression of PCSK9 modulates infection, inflammation and coagulation in a murine model of sepsis. Shock. 2016;46:672–680. [DOI] [PubMed] [Google Scholar]
  • 9. Sun HL, Wu YR, Song FF, Gan J, Huang LY, Zhang L, et al. Role of PCSK9 in the development of mouse periodontitis before and after treatment: A double‐edged sword. J Infect Dis. 2017;217(4):667–680. [DOI] [PubMed] [Google Scholar]
  • 10. Tang YL, Jiang JH, Wang S, Liu Z, Tang XQ, Peng J, et al. TLR4/NF‐kappaB signaling contributes to chronic unpredictable mild stress‐induced atherosclerosis in ApoE−/− mice. PLoS One. 2015;10(4):e0123685. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. de Winther M, Kanters E, Kraal G, Hofker M. Nuclear factor kappaB signaling in atherogenesis. Arterioscler Thromb Vasc Biol. 2005;25:904–914. [DOI] [PubMed] [Google Scholar]
  • 12. Vriend J, Reiter RJ. Melatonin as a proteasome inhibitor. Is there any clinical evidence? Life Sci. 2014;115(1):8–14. [DOI] [PubMed] [Google Scholar]
  • 13. Tang ZH, Peng J, Ren Z, Yang J, Li TT, Li TH, et al. New role of PCSK9 in atherosclerotic inflammation promotion involving the TLR4/NF‐κB pathway. Atherosclerosis. 2017;262:113–122. [DOI] [PubMed] [Google Scholar]
  • 14. Cario E. Toll‐like receptors in inflammatory bowel diseases: A decade later. Inflamm Bowel Dis. 2010;16(9):1583–1597. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Pålsson‐McDermott EM, O'Neill LAJ. Signal transduction by the lipopolysaccharide receptor, Toll‐like receptor‐4. Immunology. 2004;113(2):153–162. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Jiang L, Lv J, Liu J, Hao X, Ren F, Guo H. Donkey milk lysozyme ameliorates dextran sulfate sodium‐induced colitis by improving intestinal barrier function and gut microbiota composition. J Funct Foods. 2018;48:144–152. [Google Scholar]
  • 17. Molodecky NA, Soon IS, Rabi DM, Ghali WA, Ferris M, Chernoff G, et al. Increasing incidence and prevalence of the inflammatory bowel diseases with time, based on systematic review. Gastroenterology. 2012;142(1):46–54.e42. [DOI] [PubMed] [Google Scholar]
  • 18. He W, Li Y, Liu M, Yu H, Chen Q, Chen Y, et al. Citrus aurantium L. and its flavonoids regulate TNBS‐induced inflammatory bowel disease through anti‐inflammation and suppressing isolated jejunum contraction. Int J Mol Sci. 2018;19:10–3057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Park JH, Peyrin‐Biroulet L, Eisenhut M, Shin JI. IBD immunopathogenesis: A comprehensive review of inflammatory molecules. Autoimmun Rev. 2017;16(4):416–426. [DOI] [PubMed] [Google Scholar]
  • 20. Dou W, Zhang J, Zhang E, Sun A, Ding L, Chou G, et al. Chrysin ameliorates chemically induced colitis in the mouse through modulation of a PXR/NF‐κB signaling pathway. J Pharmacol Exp Ther. 2013;345(3):473–482. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Zhang J, Ding L, Wang B, Ren G, Sun A, Deng C, et al. Notoginsenoside R1 attenuates experimental inflammatory bowel disease via pregnane X receptor activation. J Pharmacol Exp Ther. 2015;352(2):315–324. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22. Bian Z, Guo Y, Binh H, Zen K, Liu Y. Regulation of the inflammatory response: Enhancing neutrophil infiltration under chronic inflammatory conditions. J Immunol. 2011;188:844–853. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Brandl K, Rutschmann S, Li X, Du X, Xiao N, Schnabl B, et al. Enhanced sensitivity to DSS colitis caused by a hypomorphic Mbtps1 mutation disrupting the ATF6‐driven unfolded protein response. Proc Natl Acad Sci U S A. 2009;106(9):3300–3305. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Cunningham D, Danley DE, Geoghegan KF, Griffor MC, Hawkins JL, Subashi TA, et al. Structural and biophysical studies of PCSK9 and its mutants linked to familial hypercholesterolemia. Nat Struct Mol Biol. 2007;14(5):413–419. [DOI] [PubMed] [Google Scholar]
  • 25. Ricci C, Ruscica M, Camera M, Rossetti L, Macchi C, Colciago A, et al. PCSK9 induces a pro‐inflammatory response in macrophages. Sci Rep. 2018;8(1):2267. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Landlinger C, Pouwer MG, Juno C, van der Hoorn JWA, Pieterman EJ, Jukema JW, et al. The AT04A vaccine against proprotein convertase subtilisin/kexin type 9 reduces total cholesterol, vascular inflammation, and atherosclerosis in APOE*3Leiden.CETP mice. Eur Heart J. 2017;38(32):2499–2507. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 27. Ren G, Sun A, Deng C, Zhang J, Wu X, Wei X, et al. The anti‐inflammatory effect and potential mechanism of cardamonin in DSS‐induced colitis. Am J Physiol Gastrointest Liver Physiol. 2015;309(7):G517–G527. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Wang L, Xie H, Xu L, Liao Q, Wan S, Yu Z, et al. rSj16 protects against DSS‐induced colitis by inhibiting the PPAR‐alpha signaling pathway. Theranostics. 2017;7(14):3446–3460. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Lee JJ, Rothenberg ME, Seeley ES, Zimdahl B, Kawano S, Lu WJ, et al. Control of inflammation by stromal Hedgehog pathway activation restrains colitis. Proc Natl Acad Sci U S A. 2016;113(47):E7545–E7553. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Ahn J, Son S, Oliveira SC, Barber GN. STING‐dependent signaling underlies IL‐10 controlled inflammatory colitis. Cell Rep. 2017;21(13):3873–3884. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Zundler S, Neurath MF. Integrating immunologic signaling networks: The JAK/STAT pathway in colitis and colitis‐associated cancer. Vaccines. 2016;4(1):5. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Moparthi L, Koch S. Wnt signaling in intestinal inflammation. Differentiation. 2019;108:24–32. [DOI] [PubMed] [Google Scholar]
  • 33. Ke X, Zhou FAN, Gao Y, Xie B, Hu G, Fang W, et al. Qing Hua Chang Yin exerts therapeutic effects against ulcerative colitis through the inhibition of the TLR4/NF‐κB pathway. Int J Mol Med. 2013;32(4):926–930. [DOI] [PubMed] [Google Scholar]
  • 34. Szebeni B, Veres G, Dezsőfi A, Rusai K, Vannay A, Mraz M, et al. Increased expression of Toll‐like receptor (TLR) 2 and TLR4 in the colonic mucosa of children with inflammatory bowel disease. Clin Exp Immunol. 2008;151:34–41. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Ohkawara T, Takeda H, Miyashita K, Nishiwaki M, Nakayama T, Taniguchi M, et al. Regulation of Toll‐like receptor 4 expression in mouse colon by macrophage migration inhibitory factor. Histochem Cell Biol. 2006;125(5):575–582. [DOI] [PubMed] [Google Scholar]
  • 36. Rashidian A, Muhammadnejad A, Dehpour AR, Mehr SE, Akhavan MM, Shirkoohi R, et al. Atorvastatin attenuates TNBS‐induced rat colitis: The involvement of the TLR4/NF‐kB signaling pathway. Inflammopharmacology. 2016;24(2–3):109–118. [DOI] [PubMed] [Google Scholar]
  • 37. Ungaro R, Fukata M, Hsu D, Hernandez Y, Breglio K, Chen A, et al. A novel Toll‐like receptor 4 antagonist antibody ameliorates inflammation but impairs mucosal healing in murine colitis. Am J Physiol Gastrointest Liver Physiol. 2009;296(6):G1167–G1179. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Atreya I, Atreya R, Neurath MF. NF‐κB in inflammatory bowel disease. J Intern Med. 2008;263:591–596. [DOI] [PubMed] [Google Scholar]
  • 39. Chamanara M, Rashidian A, Mehr SE, Dehpour AR, Shirkohi R, Akbarian R, et al. Melatonin ameliorates TNBS‐induced colitis in rats through the melatonin receptors: Involvement of TLR4/MyD88/NF‐kappaB signalling pathway. Inflammopharmacology. 2019;27(2):361–371. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES