Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2020 Jan 13;36(5):354–362. doi: 10.1002/kjm2.12183

The protection of NF‐κB inhibition on kidney injury of systemic lupus erythematosus mice may be correlated with lncRNA TUG1

Hai‐Yu Cao 1, Dong Li 2, Yun‐Peng Wang 3, Hui‐Xiu Lu 1, Jing Sun 1, Hai‐Bin Li 3,✉
PMCID: PMC11896366  PMID: 31930775

Abstract

We aimed to know the effect of nuclear factor‐kappa B (NF‐κB) inhibition on the kidney injury of systemic lupus erythematosus (SLE) mice. Pristane‐induced SLE mice were treated with pyrrolidine dithiocarbamate (PDTC, 50 or 100 mg/kg), a NF‐κB inhibitor. Histopathological changes were observed by hematoxylin & eosin, Masson and periodic schiff‐methenamine stainings. Long noncoding RNA Taurine upregulated gene 1 (LncRNA TUG1) was measured by real‐time reverse transcription PCR, NF‐κB p65 expression by western blotting, levels of inflammatory cytokines, antinuclear antibodies (ANA), and antidouble stranded DNA (anti‐dsDNA) by enzyme‐linked immunosorbent assay, and the deposition of IgG and C3 by immunofluorescence. The kidney of SLE mice exhibited interstitial inflammatory cell infiltration, interstitial fibrous proliferation, glomerular mesangial proliferation, and crescent formation, which was mitigated after PDTC administration. The levels of BUN, Cr, ANA, and anti‐dsDNA and the pro‐inflammatory factors in SLE mice were increased with obvious deposition of IgG and C3, but they were also reversed by PDTC. Furthermore, the NF‐κB p65 expression in the nucleus in the SLE mice was decreased with the up‐regulation of TUG1 expression and NF‐κB p65 expression in the cytoplasm after PDTC treatment. Correlation analysis revealed the negative correlation between the TUG1 expression and NF‐κB p65 in the nucleus in the kidney tissues. NF‐κB inhibition with PDTC protected against the kidney injury of pristine‐induced SLE mice possibly via up‐regulating lncRNA TUG1, and further clinical studies are needed to clarify whether NF‐κB inhibition may be a therapeutic modality for the kidney injury of SLE.

Keywords: lncRNA TUG1, NF‐κB pathway, PDTC, SLE

1. INTRODUCTION

Systemic lupus erythematosus (SLE), as a kind of autoimmune inflammatory disease, is clinically characterized by various manifestations, such as butterfly erythema, fever, arthritis, headache, epilepsy, leukopenia, anemia, or proteinuria, and so on.1 In China, SLE has been ranked as one of the most common chronic conditions with a prevalence of 0.03%.2 SLE usually involves multiple organs damage, including kidney, vessels, skin, joints, and brain, among which kidney was the most susceptible.3 Currently, medication for SLE patients, including the corticosteroids and immunosuppressors, failed to control the clinical symptoms or to prevent the recurrence, which plused the injury posed by the toxicity of these drugs, consequently affecting the efficacy of SLE.4 Therefore, developing novel therapeutics to treat SLE‐induced inflammation is of great significance.

Nuclear transcription factor‐kappa B (NF‐κB) is a group of key nucleus transcription factors consisting of the complicated polypeptide subunits, which widely distributes in the eukaryotes.5 The members of NF‐κB usually exist in the form of homodimer or heterodimer to form the complex by binding to IκBs, its suppressing protein, in the cytoplasm without activity, and is only activated by various factors.6 Massive evidences had shown the correlations between the anomaly in NF‐κB signaling pathway and the abnormal inflammation or immune responses, whereas the abnormal activation of NF‐κB was also closely associated with the development of chronic inflammation and SLE.7, 8 Notably, the key role of NF‐κB signaling pathway in the development of renal injury has gained wide attention. Ahmed and Mohamed found that candesartan and epigallocatechin‐3‐gallate could improve gentamicin‐induced renal injury in rats through mediating the NF‐κB signaling pathway9; and Liu et al reported that low‐molecular‐weight polyphenol protected the mice from renal injury by inhibiting the NF‐κB signaling pathway in the diabetes mellitus models.10 Nevertheless, whether inhibition of NF‐κB signaling pathway can potentially benefit SLE‐induced renal injury remains unknown. Based upon past experiments, the animal models of SLE could precisely simulate the development and progression of human SLE, which may have great valuables for developing the effective drugs and elucidating the pathogenesis of SLE.11, 12, 13 In this study, the SLE models, as the ideal disease models, were prepared by the injection of pristine in mice, with the advantages of short term, low cost, early onset, and high similarity to the human autoimmune disease.14, 15 Following the model construction, Pyrrolidine dithiocarbamate, a potent inhibitor of nuclear factor κB (NF‐κB) activation, was intravenous (iv) injected in SLE mice to further investigate the effect of NF‐κB inhibition on the renal injury of SLE mice.

2. MATERIALS AND METHODS

2.1. Ethical statement

The protocol of study was stipulated under the Guide for the Care and Use of Laboratory Animals issued by the National Institute of Health.16 All animal‐related experiments were conducted under the supervision of the Ethical Committee of the Medical Experimental Animals of xxx University.

2.2. Construction of SLE mice models

A total of 24 SPF BALB/c female mice (8‐week old) were purchased from the Experiment Animal Center of the Chinese Academy of Medical Sciences (Beijing, China). SLE models were established by the intraperitoneally (ip) injection with pristane, and 8 weeks later, PDTC, at a dose of 0, 50, or 100 mg/kg, respectively,17, 18, 19, 20 was injected (iv) three times a week for consecutive 12 weeks, with six mice at each dose. The remaining normal mice (n = 6) received the normal saline in same volume were taken into the control group.

2.3. Sample collection

At the end of experiment, mice were anesthetized to collect the blood samples. Simultaneously, the thoracic cavity was rapidly opened to expose, and the kidney on one side was collected in the 10% formaldehyde for fixation, and following by the washes with phosphate buffered saline (PBS) and dehydration with gradient ethanol. After clearing in the xylene, waxing, and embedding, tissues were sliced into sections for pathological examinations. Kidney on the other side was removed and kept at −80°C for molecular experiments. Serum levels of creatinine (Cr) and blood urinary nitrogen (BUN) were detected in the 7170 automatic biochemical analyzer (Hitachi, Japan).

2.4. Enzyme‐linked immunosorbent assay assay

The levels of the pro‐inflammatory factors (TNF‐α, IL‐6, MCP‐1, IL‐17A, IL‐1β, and IFN‐γ, Dakewei, Beijing, China) in kidney, and the plasma levels of antinuclear antibody (ANA, ng/mL, BD, Franklin Lakes, New Jersey) and the antidouble stranded DNA antibody (anti‐dsDNA, IU/m, BD, Franklin Lakes, New Jersey) were measured by the ELISA kits according to the manufacturer's instructions. Finally, the color was developed through tetramethylbenzidine (Sigma) followed by the measurement by ELISA plate reader (450/620 nm, BioRad, Richmond, California).

2.5. Hematoxylin & eosin staining

The kidney tissues were heated at 60°C, cleared in xylene, and sequentially immersed into the gradient ethanol followed by the twice washes with running water (1 minute/time). Next, these sections were stained in the Harris hematoxylin for 10 minutes, followed by rinsing under the running water for 1 minute and differentiating in 1% HCl‐ethanol for 30 seconds. Under the running water, sections were blued for 15 minutes, and then stained in 1% eosin for 3 minutes. Again, in 90% ethanol, sections were differentiated for 30 seconds, and washed in 95% ethanol for 1 minute, in carbo‐xylol three times and xylene three times (2 minutes/time). At last, the sections were mounted in the neutral balsam for microscopic observation. Staining reagents above were provided by the Jrdun Biotechnology Co, Ltd (Shanghai, China).

2.6. Masson staining

Sections were dewaxed and hydrated as described above, and then stained in weigert hematoxylin for nucleus staining (5‐10 minutes). After rinsing in water, sections were stained in the Masson ponceau acidic solution for 5 to 10 minutes, rinsed in 2% glacial acetic acid solution, subjected to the differentiation in 1% phosphomolybdic acid solution for 3 to 5 minutes, and stained in the aniline blue for 5 minutes. Finally, after short rinsing in 0.2% glacial acetic acid solution, sections were dehydrated, cleared, and mounted.

2.7. Periodic schiff‐methenamine staining

Similar to the procedures for dewaxing and hydration for the paraffin sections, they were stained in the 1% periodic acid solution for 10 minutes, which was terminated in the running water and distilled water. Then, sections were placed in the 5% CrO3 for 40 minutes, and after removal from the CrO3, the residual CrO3 was removed by 1% sodium sulfite, followed by several washes in running water and distilled water. Prior to the microscopic observation, sections were stained in the silver hexosamine solution for 40 minutes at 55°C to 60°C. Staining results were evaluated by the black staining of the basal membrane of capillary in glomeruli, and those failing to meet the criteria should be further heated in the oven until the staining results were satisfactory. Following three washes in the distilled water three times, they were snap‐treated by the sodium thiosulfate and then rinsed in the distilled water once. Sections were finally stained by hematoxylin & eosin (HE), followed by dehydration, transparent, and mounting.

2.8. Real‐time reverse transcription PCR

Total RNA was extracted by using the TRIzol reagent (Life Technologies, Grand Island, New York), followed by the measurements of concentration and purity. Primer sequences: lncRNA TUG1, forward, 5′‐TAGCAGTTCCCCAATCCTTG3‐3′; reverse, 5′‐CACAAATTCCCATCATTCCC‐3′; GAPDH, forward, 5′‐CGGAGTCAACGGATTTGGTCGTAT‐3′; reverse, 5′‐AGCCTTCTCCATGGTGGTGAAGAC‐3′. Amplification was performed on the Applied Biosystems 7900HT (Applied Biosystems, Foster City, California) with cycling conditions consisting of the initial denaturation at 95°C for 10 minutes, followed by 40 cycles of two‐step PCR (95°C for 15 seconds, 60°C for 1 minute). Results were normalized to the GAPDH.

2.9. Western blotting

Proteins were extracted with the nuclear/cytoplasm extraction kit (Active Motif, Europe, Rixensarf, Belgium), which were subjected to the measurement of concentration by using the bicinchoninic acid protein assay reagent kit (Pierce, Rockford, Illinois). Thereafter, protein samples were loaded for the sodium dodecyl sulfate‐polyacrylamide gel electrophoresis (SDS‐PAGE), and the proteins in gel were transferred onto the polyvinylidene fluoride (PVDF) membrane by using the semi‐dry method. After being blocked at room temperature in the non‐fat milk and washes in PBS, proteins on the membrane were incubated with the primary antibodies for 1 hour, including anti‐NF‐κB p65 antibody at 1/1000 dilution (ab32536, Abcam), anti‐Lamin B1 antibody—nuclear loading control at 1/5000 dilution (ab194109, Abcam), and anti‐β‐actin antibody—cytoplasm loading control at 1/1000 dilution (ab8226, Abcam). Following washes in PBST, immunoblots on the membrane were probed by incubating with the secondary antibody for 1 hour at room temperature. Again, the membranes were washed in PBST for five times (3 minutes/time). The bands of target proteins were developed by the HRP substrate (Bio‐Rad), and the relative content of target protein was calculated by the ratio of the gray value of target protein to that of loading control.

2.10. Immunofluorescence

After being frozen rapidly in the liquid nitrogen, kidney samples preserved at −80°C were slice for preparation of the frozen section in thickness of 4 μm. Following the fixation in acetone, sections were incubated with the corresponding fluorescein isothiocyanate‐labeled antibodies of C3 and IgG with PBS containing 2% BSA in a humid incubator for 1 hour, and then washed five times in PBS three times. The fluorescent intensity was detected and quantified by Image J.

2.11. Statistical methods

All data were processed statistically by using the SPSS 21.0 software (SPSS, Inc, Chicago, Illinois). Measurement data were presented by means ± SD, and comparison among groups with the randomized analysis of variance, while comparisons within groups with the Tukey HSD test.

3. RESULTS

3.1. Histopathological examination of the kidney tissues in mice

The HE, Masson and periodic schiff‐methenamine stainings of the kidney tissues in mice were shown in Figure 1. The kidney in the control group was in normal structure with no evident pathological changes; while SLE mice exhibited the obvious interstitial inflammatory cell infiltration, interstitial fibrous proliferation, glomerular mesangial proliferation, and crescent formation in the kidney tissues. As for those SLE mice treated with PDTC, the above manifestations had great improvements, and with the increase of PDTC dosage, the improvement effect was more remarkable.

Figure 1.

Figure 1

Open in a new tab

The histopathological examination of kidney tissues in mice (×400)

3.2. Effect of PDTC on biochemical and immunological indicators of kidney functions in SLE mice

As indicated by Figure 2, mice in the SLE groups had significant elevations in serum levels of BUN and Cr, and the increased plasma levels of ANA and anti‐dsDNA when compared to the control group (all P < .05). However, the above indexes were reduced by the treatment of PDTC in SLE mice, and the effect of PDTC at 100 mg/kg was more superior to that at 50 mg/kg (all P < .05).

Figure 2.

Figure 2

Open in a new tab

Effect of NF‐κB inhibitor PDTC on biochemical and immunological indicators of kidney functions in SLE mice. Notes: A and B, Serum levels of blood urinary nitrogen (BUN, A) and creatinine (Cr, B) were detected in an automatic biochemical analyzer; C and D, Plasma levels of antinuclear antibody (ANA, ng/mL, C) and the anti‐double stranded DNA antibody (anti‐dsDNA, IU/mL, D) were measured by enzyme‐linked immunosorbent assay (ELISA). *, P < .05 compared with Control group; #P < .05 compared with SLE group; % P < .05 compared with SLE + 50 mg/kg PDTC group. NF‐κB, nuclear factor‐kappa B; PDTC, pyrrolidine dithiocarbamate; SLE, systemic lupus erythematosus

3.3. Effect of PDTC on pro‐inflammatory factors in the kidney tissues of SLE mice

ELISA was adopted to determine the expressions of pro‐inflammatory factors (TNF‐α, IL‐6, MCP‐1, IL‐17A, IL‐1β, and IFN‐γ) in the kidney tissues of mice (Figure 3). As a result, mice in the SLE group had significant increases in the levels of these factors as compared with the control group (all P < .05). In comparison with the SLE group, the expressions of pro‐inflammatory factors were decreased in the SLE + 50 mg/kg PDTC group and SLE + 100 mg/kg PDTC group (all P < .05), and the decreases at dose of 100 mg/kg were more evident than those at 50 mg/kg (all P < .05).

Figure 3.

Figure 3

Open in a new tab

Effect of PDTC on the expressions of pro‐inflammatory factors (TNF‐α, IL‐6, MCP‐1, IL‐17A, IL‐1β, and IFN‐γ) detected by enzyme‐linked immunosorbent assay (ELISA) in the kidney tissues of SLE mice. Notes: #P < .05 compared with SLE group; % P < .05 compared with SLE + 50 mg/kg PDTC group. PDTC, pyrrolidine dithiocarbamate; SLE, systemic lupus erythematosus

3.4. Effect of PDTC on immune complex deposits in the kidney of SLE mice

Through the immunofluorescent staining of the IgG and C3 in the glomeruli, we found the obvious depositions of IgG and C3 in the glomeruli of SLE mice, while the administration of PDTC weakened the fluorescent signals in the SLE mice (Figure 4). Similar results were shown in the quantification of the fluorescence (Figure 4). The significant decreases were identified in the fluorescent signals of mice from the SLE + 50 mg/kg PDTC group and the SLE + 100 mg/kg PDTC group as compared with those from the SLE group (all P < .05), and the reduction in the deposition of IgG and C3 at dose of 100 mg/kg were more prominent than those at dose of 50 mg/kg (both P < .05).

Figure 4.

Figure 4

Open in a new tab

Effect of PDTC on the deposition of IgG and C3 measured by immunofluorescence in the kidney tissues of SLE mice. Notes: A and B, Observation of the effect on the IgG deposition in the kidney of mice (IgG with the red fluorescence and nucleus with the blue fluorescence after DAPI staining); A and C, Observation of the effect on the complement C3 deposition in the kidney of mice (C3 with the green fluorescence and nucleus with the blue fluorescence after DAPI staining). #P < .05 compared with SLE group; % P < .05 compared with SLE + 50 mg/kg PDTC group. PDTC, pyrrolidine dithiocarbamate; SLE, systemic lupus erythematosus

3.5. Comparison of the expressions of NF‐κB p65 and TUG1 in mice

We detected the expression of TUG1 and NF‐κB p65 in the nucleus and cytoplasm in the kidney tissues of mice (Figure 5A–C), and we found that mice in the SLE group had the highest p65 expression in the nucleus and lowest expressions of TUG1 and p65 in the cytoplasm among all groups (all P < .05). PDTC deceased p65 protein level in the nucleus in the kidney tissues from SLE mice accompanying with the increased TUG1 expression (all P < .05). Additionally, mice in the SLE + 100 mg/kg PDTC group had decreased p65 expression in the nucleus and increased expressions of TUG1 and p65 in the cytoplasm, as compared with the SLE + 50 mg/kg PDTC group (all P < .05). In addition, the correlation analysis was adopted to show a negative correlation between p65 expression in the nucleus and TUG1 in the kidney tissues (all P < .05).

Figure 5.

Figure 5

Open in a new tab

Comparison of the expressions of NF‐κB p65 and lncRNA TUG1 in the kidney tissues in mice among groups. Notes: A and B, Expression of NF‐κB p65 in the nucleus and cytoplasm in the kidney tissues of mice detected by western blotting, 1, control group, 2, SLE group, 3, SLE + 50 mg/kg PDTC group, and 4, SLE + 100 mg/kg PDTC group; C, TUG1 expression in mice by qRT‐PCR; D, The correlation analysis between the TUG1 expression and NF‐κB p65 in the nucleus in the kidney tissues of mice. #P < .05 compared with SLE group; % P < .05 compared with SLE + 50 mg/kg PDTC group. NF‐κB, nuclear factor‐kappa B; PDTC, pyrrolidine dithiocarbamate; qRT‐PCR, real‐time reverse transcription PCR; SLE, systemic lupus erythematosus

4. DISCUSSION

SLE is a kind of systemic autoimmune disease originated from the multifactor‐caused immune disorder, and its development and progression may be correlated closely with the abnormal immune signal transduction.21 Among various immune‐related signaling pathways, evidence has shown the association between the anomaly in NF‐κB signaling pathway and the development of SLE.22 In this study, we did found the significantly increased p65 expression in the nucleus and decreased expressions of p65 in the cytoplasm in kidney tissues of SLE mice, which was consistent with many previous studies,7, 23 suggesting that inhibition of NF‐κB signaling might be a potential target in SLE treatment.

PDTC, a stable carbamatecompound, is an efficient inhibitor of NF‐κB by suppressing the phosphorylation of IκB to block the nuclear translocation of NF‐κB.24 Currently, enormous studies have uncovered the potential therapeutic effects in multiple diseases. For example, Miao et al have reported that PDTC could relieve cancer cachexiais through influencing the muscle atrophy and fat lipolysis.25 Also, PDTC could prevent gastric ischemia‐reperfusion injury via facilitating the cell survival.26 Previous literatures have shown that in serum, the levels of ANA and anti‐dsDNA were increased in SLE patients, which served as a diagnostic criterion to be correlated closely with the development and prognosis of SLE.27, 28 In this study, we injected PDTC (50 or 100 mg/kg) in pristane‐induced SLE mice for 12 weeks, and we discovered the decreased levels of ANA and anti‐dsDNA in plasma of mice, suggesting that PDTC may mitigate the progression of SLE to some extent.

As documented, SLE is mainly characterized by the excessive activation of lymphocytes, numerous autoanti‐bodies, and the deposition of immune complex in the glomeruli or other major peripheral organs, giving rise to the general multisystemic lesions in kidney.3 Similar to the results of the model constructions mentioned in previous literatures,29, 30 we also found the evident interstitial infiltration of inflammatory factors, interstitial fibrous proliferation, and glomerular mesangial proliferation, indicating the kidney damage was indeed caused. However, after PDTC treatment, the kidney injury was improved with varying degrees depending on the PDTC dosage. Thus, inhibition of NF‐κB could partially mitigate the kidney injury. In order to further validate the hypothesis, we detected the levels of BUN and Cr, the primary end products of nitrogen, and protein metabolism respectively, which are normally filtrated through the glomeruli, but were massively retained to be increased in any decline in the filtrating function of glomeruli; thus, BUN and Cr are the major diagnostic indexes for evaluating the filtrating function of glomeruli.31, 32 Consequently, we found that PDTC did reduce the serum levels of BUN and Cr of SLE mice. Meanwhile, NF‐κB inhibition also alleviated the kidney injury according to the previous evidence. In presence of PDTC, the decreased levels of BUN and Cr in remission of TCE‐induced renal injury.33 And, PDTC‐induced chronic inhibition of NF‐κB signaling pathway restored the renal injury by decreasing the levels of CTGF and TGF‐β.34 Besides, one of the prominent features in the progressive kidney injury of SLE is the interstitial inflammatory cell infiltration.35 Activation of NF‐κB is necessary for the initiation of natural or acquired immune, laying the basis for the development of persistent inflammatory responses.36 As such, we determined the release of inflammatory factors in kidney, and found that PDTC treatment could decrease the levels of pro‐inflammatory factors in SLE mice, including TNF‐α, IL‐6, MCP‐1, IL‐17A, IL‐1β, and IFN‐γ, with the reduction in the deposition of IgG and C3. Overall, PDTC‐induced inhibition of NF‐κB signaling pathway significantly alleviated the kidney inflammation, reduced the deposition of IgG and C3 in the kidney, as well as downregulated the plasma levels of ANA and anti‐dsDNA, providing great valuables to the treatment of SLE.

On the other hand, TUG1 has been demonstrated to act as an oncogenic lncRNA involve in various cancers, such as hepatocellular carcinoma, osteosarcoma, glioma, and bladder cancer.37 Not surprisingly, this lncRNA was detected to be decreased in SLE mice. Previous evidence pointed out that lncRNA TUG1 could inhibit the apoptosis and the release of inflammatory factors, thereby protecting the HK‐2 cell from LPS‐induced inflammatory injury, showing the protective role of TUG1 in disease.38 Moreover, the existing evidence also implied the close relation between NF‐κB and TUG1.38, 39 In our experiment, PDTC treatment resulted in the up‐regulation of TUG1 in SLE mice, and there was a negative correlation between p65 expression in the nucleus and TUG1 in the kidney tissues. Thus, we inferred that NF‐κB signaling pathway might alter the expression of TUG1. However, the lack of time and expenditure lags the efforts to elucidate the specific mechanism of regulation, which is expected to accomplished in the future studies.

Therefore, the inhibition of NF‐κB could be beneficial for SLE treatment via mitigating the inflammation in kidney, reducing the deposition of immune complex, and decreasing the levels of BUN, Cr, ANA, and anti‐dsDNA in serum, which might be correlated with the increased levels of lncRNA TUG1.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

ACKNOWLEDGMENTS

The authors would like to give our sincere appreciation to the reviewers for their helpful comments on this article.

Cao H‐Y, Li D, Wang Y‐P, Lu H‐X, Sun J, Li H‐B. The protection of NF‐κB inhibition on kidney injury of systemic lupus erythematosus mice may be correlated with lncRNA TUG1. Kaohsiung J Med Sci. 2020;36:354–362. 10.1002/kjm2.12183

Hai‐Yu Cao and Dong Li have equal contributions as the co‐first authors.

REFERENCES

  • 1. Reategui‐Sokolova C, Ugarte‐Gil MF, Gamboa‐Cardenas RV, Zevallos F, Cucho‐Venegas JM, Alfaro‐Lozano JL, et al. Serum uric acid levels contribute to new renal damage in systemic lupus erythematosus patients. Clin Rheumatol. 2017;36(4):845–852. [DOI] [PubMed] [Google Scholar]
  • 2. Zhang J, Zhan W, Yang B, Tian A, Chen L, Liao Y, et al. Genetic polymorphisms of rs3077 and rs9277535 in HLA‐DP associated with systemic lupus erythematosus in a Chinese population. Sci Rep. 2017;7:39757. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Pacheco‐Lugo L, Saenz‐Garcia J, Navarro Quiroz E, Gonzalez Torres H, Fang L, Diaz‐Olmos Y, et al. Plasma cytokines as potential biomarkers of kidney damage in patients with systemic lupus erythematosus. Lupus. 2019;28(1):34–43. [DOI] [PubMed] [Google Scholar]
  • 4. Aparicio‐Soto M, Sanchez‐Hidalgo M, Cardeno A, Rosillo MA, Sanchez‐Fidalgo S, Utrilla J, et al. Dietary extra virgin olive oil attenuates kidney injury in pristane‐induced SLE model via activation of HO‐1/Nrf‐2 antioxidant pathway and suppression of JAK/STAT, NF‐kappaB and MAPK activation. J Nutr Biochem. 2016;27:278–288. [DOI] [PubMed] [Google Scholar]
  • 5. Soubannier V, Stifani S. NF‐kappaB Signalling in Glioblastoma. Biomedicines. 2017;5(2):1–15. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Potoyan DA, Bueno C, Zheng W, Komives EA, Wolynes PG. Resolving the NFkappaB heterodimer binding paradox: Strain and frustration guide the binding of Dimeric transcription factors. J Am Chem Soc. 2017;139(51):18558–18566. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Kong X, Zhang Z, Fu T, Ji J, Yang J, Gu Z. TNF‐alpha regulates microglial activation via the NF‐kappaB signaling pathway in systemic lupus erythematosus with depression. Int J Biol Macromol. 2019;125:892–900. [DOI] [PubMed] [Google Scholar]
  • 8. Liu J, Huang X, Hao S, Wang Y, Liu M, Xu J, et al. Peli1 negatively regulates noncanonical NF‐kappaB signaling to restrain systemic lupus erythematosus. Nat Commun. 2018;9(1):1136. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Ahmed HI, Mohamed EA. Candesartan and epigallocatechin‐3‐gallate ameliorate gentamicin‐induced renal damage in rats through p38‐MAPK and NF‐kappaB pathways. J Biochem Mol Toxicol. 2019;33(3):e22254. [DOI] [PubMed] [Google Scholar]
  • 10. Liu HW, Wei CC, Chang SJ. Low‐molecular‐weight polyphenols protect kidney damage through suppressing NF‐kappaB and modulating mitochondrial biogenesis in diabetic db/db mice. Food Funct. 2016;7(4):1941–1949. [DOI] [PubMed] [Google Scholar]
  • 11. Zhang Y, Chen X, Deng Y. miR‐125a‐3p decreases levels of interlukin‐17 and suppresses renal fibrosis via down‐regulating TGF‐beta1 in systemic lupus erythematosus mediated lupus nephritic mice. Am J Transl Res. 2019;11(3):1843–1853. [PMC free article] [PubMed] [Google Scholar]
  • 12. Lee SY, Lee SH, Seo HB, Ryu JG, Jung K, Choi JW, et al. Inhibition of IL‐17 ameliorates systemic lupus erythematosus in Roquin(san/san) mice through regulating the balance of TFH cells, GC B cells, Treg and Breg. Sci Rep. 2019;9(1):5227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Flores R, Zhang P, Wu W, Wang X, Ye P, Zheng P, et al. Siglec genes confer resistance to systemic lupus erythematosus in humans and mice. Cell Mol Immunol. 2019;16(2):154–164. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14. Mardani F, Mahmoudi M, Esmaeili SA, Khorasani S, Tabasi N, Rastin M. In vivo study: Th1‐Th17 reduction in pristane‐induced systemic lupus erythematosus mice after treatment with tolerogenic Lactobacillus probiotics. J Cell Physiol. 2018;234(1):642–649. [DOI] [PubMed] [Google Scholar]
  • 15. Lin Y, Yan Y, Zhang H, Chen Y, He Y, Wang S, et al. Salvianolic acid a alleviates renal injury in systemic lupus erythematosus induced by pristane in BALB/c mice. Acta Pharm Sin B. 2017;7(2):159–166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. National Research Council, Guide for the care and use of laboratory animals. Wahington, DC: National Academic Press, 2011. [Google Scholar]
  • 17. Cheng T, Zhang GY, Guo CJ, Zhang X. Effects of NF‐kappaB inhibitor on titanium particulate‐induced inflammation in a murine model. J Surg Res. 2010;162(2):225–230. [DOI] [PubMed] [Google Scholar]
  • 18. Wang W, Zheng M. Nuclear factor kappa B pathway down‐regulates aquaporin 5 in the nasal mucosa of rats with allergic rhinitis. European archives of Oto‐rhino‐laryngology: Official journal of the European Federation of Oto‐Rhino‐Laryngological. Societies. 2011;268(1):73–81. [DOI] [PubMed] [Google Scholar]
  • 19. Nai YJ, Jiang ZW, Wang ZM, Li N, Li JS. Prevention of cancer cachexia by pyrrolidine dithiocarbamate (PDTC) in colon 26 tumor‐bearing mice. JPEN J Parenter Enteral Nutr. 2007;31(1):18–25. [DOI] [PubMed] [Google Scholar]
  • 20. Hirata I, Yasumoto S, Toshina K, Inoue T, Nishikawa T, Murano N, et al. Evaluation of the effect of pyrrolidine dithiocarbamate in suppressing inflammation in mice with dextran sodium sulfate‐induced colitis. World J Gastroenterol. 2007;13(11):1666–1671. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Li S, Li C, Zhang J, Tan X, Deng J, Jiang R, et al. Expression profile of long noncoding RNAs in children with systemic lupus erythematosus: A microarray analysis. Clin Exp Rheumatol. 2019;37(1):156–163. [PubMed] [Google Scholar]
  • 22. Cen H, Zhou M, Leng RX, Wang W, Feng CC, Li BZ, et al. Genetic interaction between genes involved in NF‐kappaB signaling pathway in systemic lupus erythematosus. Mol Immunol. 2013;56(4):643–648. [DOI] [PubMed] [Google Scholar]
  • 23. Wang Y, Lu Y, Chai J, Sun M, Hu X, He W, et al. Y‐27632, a rho‐associated protein kinase inhibitor, inhibits systemic lupus erythematosus. Biomed Pharmacother. 2017;88:359–366. [DOI] [PubMed] [Google Scholar]
  • 24. Lee EH, Kim SS, Seo SR. Pyrrolidine dithiocarbamate (PDTC) inhibits inflammatory signaling via expression of regulator of calcineurin activity 1 (RCAN1): Anti‐inflammatory mechanism of PDTC through RCAN1 induction. Biochem Pharmacol. 2017;143:107–117. [DOI] [PubMed] [Google Scholar]
  • 25. Miao C, Lv Y, Zhang W, Chai X, Feng L, Fang Y, et al. Pyrrolidine Dithiocarbamate (PDTC) attenuates cancer cachexia by affecting muscle atrophy and fat lipolysis. Front Pharmacol. 2017;8:915. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. El Eter E, Hagar HH, Al‐Tuwaijiri A, Arafa M. Nuclear factor‐kappaB inhibition by pyrrolidinedithiocarbamate attenuates gastric ischemia‐reperfusion injury in rats. Can J Physiol Pharmacol. 2005;83(6):483–492. [DOI] [PubMed] [Google Scholar]
  • 27. Sinico RA, Radice A. The clinical immunology laboratory in diagnosis and monitoring of systemic lupus erythematosus and connective tissue diseases. G Ital Nefrol. 2005;22(suppl 33):S21–S26. [PubMed] [Google Scholar]
  • 28. Chadha T, Hernandez JE. Infliximab‐related lupus and associated valvulitis: A case report and review of the literature. Arthritis Rheum. 2006;55(1):163–166. [DOI] [PubMed] [Google Scholar]
  • 29. Dos Santos M, Favero G, Bonomini F, Stacchiotti A, Rodella LF, Veronese FV, et al. Oral supplementation of melatonin protects against lupus nephritis renal injury in a pristane‐induced lupus mouse model. Life Sci. 2018;193:242–251. [DOI] [PubMed] [Google Scholar]
  • 30. Kadiombo AT, Maeshima A, Kayakabe K, Ikeuchi H, Sakairi T, Kaneko Y, et al. Involvement of infiltrating macrophage‐derived activin a in the progression of renal damage in MRL‐lpr mice. Am J Physiol Renal Physiol. 2017;312(2):F297–F304. [DOI] [PubMed] [Google Scholar]
  • 31. Finco DR, Duncan JR. Evaluation of blood urea nitrogen and serum creatinine concentrations as indicators of renal dysfunction: A study of 111 cases and a review of related literature. J Am Vet Med Assoc. 1976;168(7):593–601. [PubMed] [Google Scholar]
  • 32. Rouhani MH, Najafabadi MM, Esmaillzadeh A, Feizi A, Azadbakht L. Dietary energy density, renal function, and progression of chronic kidney disease. Adv Med. 2016;2016:2675345. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Liu M, Wang H, Zhang J, Yang X, Li B, Wu C, et al. NF‐kappaB signaling pathway‐enhanced complement activation mediates renal injury in trichloroethylene‐sensitized mice. J Immunotoxicol. 2018;15(1):63–72. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 34. Ding W, Yang L, Zhang M, Gu Y. Chronic inhibition of nuclear factor kappa B attenuates aldosterone/salt‐induced renal injury. Life Sci. 2012;90(15–16):600–606. [DOI] [PubMed] [Google Scholar]
  • 35. Ando S, Amano H, Amano E, Minowa K, Watanabe T, Nakano S, et al. FTY720 exerts a survival advantage through the prevention of end‐stage glomerular inflammation in lupus‐prone BXSB mice. Biochem Biophys Res Commun. 2010;394(3):804–810. [DOI] [PubMed] [Google Scholar]
  • 36. Guo W, Guan X, Pan X, Sun X, Wang F, Ji Y, et al. Post‐Natal inhibition of NF‐kappaB activation prevents renal damage caused by prenatal LPS exposure. PLoS One. 2016;11(4):e0153434. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Li Z, Shen J, Chan MT, Wu WK. TUG1: A pivotal oncogenic long non‐coding RNA of human cancers. Cell Prolif. 2016;49(4):471–475. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 38. Xu Y, Deng W, Zhang W. Long non‐coding RNA TUG1 protects renal tubular epithelial cells against injury induced by lipopolysaccharide via regulating microRNA‐223. Biomed Pharmacother. 2018;104:509–519. [DOI] [PubMed] [Google Scholar]
  • 39. Zhang H, Li H, Ge A, Guo E, Liu S, Zhang L. Long non‐coding RNA TUG1 inhibits apoptosis and inflammatory response in LPS‐treated H9c2 cells by down‐regulation of miR‐29b. Biomed Pharmacother. 2018;101:663–669. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES