miR‐671‐5p repressed progression of papillary thyroid carcinoma via TRIM14

Wan‐Ju Wang; Yuan Yuan; Dong Zhang; Piao Liu; Fang Liu

doi:10.1002/kjm2.12424

. 2021 Jul 22;37(11):983–990. doi: 10.1002/kjm2.12424

miR‐671‐5p repressed progression of papillary thyroid carcinoma via TRIM14

Wan‐Ju Wang ¹, Yuan Yuan ², Dong Zhang ^1,^✉, Piao Liu ¹, Fang Liu ¹

PMCID: PMC11896367 PMID: 34292652

Abstract

The pivotal role of dysregulated miRNAs in development of papillary thyroid carcinoma has been emphasized in recent research. miR‐671‐5p was previously documented to function as a tumor suppressor. However, the role and mechanism of miR‐671‐5p in progression of papillary thyroid carcinoma remain to be further studied. Data from functional assays indicated that forced expression of miR‐671‐5p decreased cell viability, repressed cell proliferation, migration, and invasion in papillary thyroid carcinoma cells. In vivo study showed that miR‐671‐5p overexpression inhibited tumor growth, downregulated Ki67, and decreased tumor volume and weight. Tripartite motif containing 14 (TRIM14) was verified as downstream target of miR‐671‐5p. The expression of TRIM14 was suppressed by miR‐671‐5p in papillary thyroid carcinoma. Overexpression of TRIM14 increased cell viability, and promoted the proliferation, migration, and invasion of papillary thyroid carcinoma. Moreover, TRIM14 counteracted the suppressive effect of miR‐671‐5p overexpression on papillary thyroid carcinoma cell growth. In conclusion, miR‐671‐5p repressed progression of papillary thyroid carcinoma through downregulation of TRIM14, providing a promising target for therapy of papillary thyroid carcinoma.

Keywords: miR‐671‐5p, papillary thyroid carcinoma, TRIM14, tumor suppressor

1. INTRODUCTION

Thyroid cancer, including papillary thyroid carcinoma, is the most common endocrine system cancer, which can be divided into four types. ¹ Papillary thyroid carcinoma has the highest incidence among thyroid cancers, up to 70%–80%. ² The incidence of papillary thyroid carcinoma is still increasing with the improvement of diagnostic methods. ³ Papillary thyroid carcinoma is difficult to diagnose at the early stage due to devoid of obvious clinical symptoms. ³ Moreover, although the 5‐year and 10‐year survival rates of patients with papillary thyroid carcinoma are about 90%, elderly patients demonstrate tumor invasion and lymph node metastasis, leading to poor prognosis and higher risk of locoregional recurrence. ⁴ Therefore, finding effective therapeutic targets and diagnostic biomarkers for papillary thyroid carcinoma are key issues that need to be urgently solved in the current research.

MicroRNAs (miRNAs) could negatively regulate gene expression through cleavage or translational repression. ⁵ Therefore, miRNAs were reported to participate in various cellular processes, including cell differentiation, proliferation, apoptosis, migration, and invasion. ⁶ Oncogenic or anti‐oncogenic miRNAs have demonstrated to be used as diagnostic markers in the thyroid cancer. ⁷ , ⁸ Dysregulated miRNAs are involved in pathogenesis of papillary thyroid carcinoma. ⁹ For example, miR‐199a‐5p repressed progression of papillary thyroid carcinoma, ¹⁰ while miR‐3619‐3p promoted the progression. ¹¹ MiR‐671‐5p was reported to suppress epithelial‐to‐mesenchymal transition in breast cancer, ¹² repress esophageal squamous cell proliferation, ¹³ block osteosarcoma cell cycle,¹⁴ and promote cell apoptosis of gastric cancer. ¹⁵ However, whether miR‐671‐5p showed tumor suppressive effect on papillary thyroid carcinoma has not been reported yet.

Proteins in tripartite motif (TRIM) family function as E3 ubiquitin ligase to be involved in cellular processes, including carcinogenesis. ¹⁶ TRIM14, which is enhanced in osteosarcoma specimens and cells, promoted the cell proliferation. ¹⁷ High expression level of TRIM14 predicted poor prognosis in hepatocellular carcinoma ¹⁸ and induced cell migration and invasion of colorectal cancer. ¹⁹ TRIM14 was reported to play oncogenic role in papillary thyroid carcinoma through activation of signal transducer and activator of transcription 3 (STAT3). ²⁰ Analysis from TargetScan revealed that miR‐671‐5p targeted TRIM14. In this study, we investigated the role of miR‐671‐5p/TRIM14 axis in development of papillary thyroid carcinoma.

The effects of miR‐671‐5p on progression of papillary thyroid carcinoma were firstly investigated in this study, and then the downstream target was validated. The tumor suppressive role of miR‐671‐5p in papillary thyroid carcinoma growth in vivo provided a promising insight for therapy of papillary thyroid carcinoma.

2. MATERIALS AND METHODS

2.1. Cell culture and transfection

Human papillary thyroid carcinoma cell lines (IHH‐4 and TPC‐1) were acquired from European Collection of Cell Cultures (Sigma‐Aldrich, St. Louis, MO), and were incubated with DMEM (Invitrogen, Carlsbad, CA) containing 10% fetal bovine serum (Sigma‐Aldrich) in 37°C incubator. pcDNA‐TRIM14, miR‐671‐5p mimic, or inhibitor were purchased from RiboBio (Guangzhou, China). IHH‐4 or TPC‐1 cells were transfected with the abovementioned molecules via Lipofectamine 2000 (Invitrogen).

2.2. Cell viability and proliferation assays

IHH‐4 or TPC‐1 cells with indicated transfection were seeded and cultured for 24, 48, or 72 h. MTT solution (20 μl, 5 mg/ml; Sigma‐Aldrich) was added to each well for 4 h. Followed by removal of supernatant and incubation with DMSO, optical density at 490 nm was evaluated by microplate spectrophotometer (ELx800, Bio‐TEK, Winooski, VT). For cell proliferation assay, IHH‐4 or TPC‐1 cells with indicated transfection were cultured for 2 weeks at a density of 200 cells per well. Followed by fixation with methanol/acetic acid and stain with crystal violet, the colonies were counted under microscope (Olympus, Tokyo, Japan).

2.3. Cell migration and invasion assays

To evaluate cell motility, IHH‐4 or TPC‐1 cells with indicated transfection were seeded and conducted with scratch wound by a micropipette tip. Twenty‐four hours later, the wound was observed under microscope (Olympus) followed by removal of cellular debris. To evaluate cell invasion, IHH‐4 or TPC‐1 cells with indicated transfection were seeded on the upper chamber of Matrigel‐coated Boyden chamber (Corning Costar, Pittsburgh, PA) under serum‐free DMEM medium. DMEM medium containing 15% serum was added into lower chamber. Twenty‐four hours later, cells invaded to lower chamber were observed under microscope (Olympus) followed by staining with crystal violet.

2.4. Tumor Xenografts and immunohistochemistry

Studies involved animals, which were approved by the Ethics Committee of Wuhan No. 1 Hospital accordance with the National Institutes of Health Laboratory Animal Care and Use Guidelines. In order to stabilize overexpression of miR‐671‐5p, the precursor sequence of miR‐671‐5p or negative control of miRNA mimic was inserted into pMIRNA lentiviral vector (System Biosciences, Mountain View, CA). TPC‐1 cells were seeded and transfected with pMIRNA‐miR‐671‐5p or pMIRNA‐NC mimic. Stable cells were selected with 1 μg/ml of puromycin. Twelve male BALB/c nude mice (body weight 18–20 g and 4–5 weeks old) were divided into two groups, miR‐671‐5p and vector group. Mice were subcutaneously injected with TPC‐1 cells stably transfected with pMIRNA‐miR‐671‐5p or pMIRNA‐NC mimic. Tumor volume was measured every 10 days, and the tumor weight was assessed 30 days after implantation. For evaluation of Ki67 expression, formalin‐fixed and paraffin embedded slides of tumors in each group were stained with primary antibody against Ki67 (1:500; Abcam, Cambridge, MA). Slides were counterstained with hematoxylin followed by incubation with HRP IgG secondary antibody (Abcam) and observed under microscope (Olympus).

2.5. Luciferase reporter assay

The sequence of 3' UTR TRIM14 was cloned into psiCHECK2 vector (Promega, Madison, WI) to generate TRIM14‐WT. Mutant sequence of 3' UTR TRIM14 was cloned into psiCHECK2 vector (Promega, Madison, WI) to generate TRIM14‐MUT. TPC‐1 cells were cotransfected with miR‐617‐5p mimic or NC mimic with the luciferase reporter vectors via Lipofectamine 2000. Two days post‐transfection, the luciferase activities were evaluated by Dual‐Luciferase Reporter Detection System (Promega).

2.6. Quantitative reverse transcription PCR

Isolated RNAs from cultured cells via TRIzol (Invitrogen) were synthesized into cDNAs according to MLV reverse transcriptase (Invitrogen). SYBR® Premix Ex Taq™ II (TaKaRa, Dalian, China) or TaqMan miRNA assay kit (Applied Biosystems, Foster City, CA) was used for qRT‐PCR analysis of TRIM14 or miR‐617‐5p, respectively, with condition (95°C for 10 min, 40 cycles of 95°C for 15 s and 60°C for 1 min). GAPDH or U6 was used as internal control for TRIM14 or miR‐617‐5p, respectively. The primers are listed below in the primer table:

Primer table:

ID	Sequences (5′‐ 3′)
GAPDH F	GCACCGTCAAGGCTGAGAAC
GAPDH R	TGGTGAAGACGCCAGTGGA
U6 F	GCTTCGGCAGCACATATACT
U6 R	GGTGCAGGGTCCGAGGTAT
miR‐617‐5p F	ACACTCCAGCTGGGAGGAAGCCCTGG
miR‐617‐5p R	CTCAACTGGTGTCGTGGAGTCGGCAAT
TRIM 14 F	GGATTTGTGTCTCCGTTCTG
TRIM 14 R	TCTGTCTGCCTGGTATTCTG

Open in a new tab

2.7. Western blot

ProteoPrep Total Extraction Sample Kit (Sigma‐Aldrich) was used for the extraction of proteins from cultured cells and tumor species. BCA Protein Assay Kit (Invitrogen) was used to determine the concentration. Proteins were separated by SDS‐PAGE and then transferred onto PVDF membrane (Bio‐Rad, Hercules, CA). PVDF membrane was blocked and incubated with primary antibodies against TRIM14 (1:2500; Abcam) and GAPDH (1:3000; Abcam). Followed by incubation with HRP IgG secondary antibody (Abcam) and BeyoECL Plus Kit (Beyotime, Shanghai, China), the signals of each band were analyzed by Gel Pro Analyzer Software 4.0 (Media Cybernetics, Rockville, MD).

2.8. Statistics

GraphPad Prism was used for the statistical analysis with data displayed as mean ± standard deviation for at least three repetitions. Student t test and Tukey’s post‐hoc test were used to analyze statistical difference between different groups. p < 0.05 was considered statistically significant.

3. RESULTS

3.1. Forced miR‐671‐5p repressed progression of papillary thyroid carcinoma

To evaluate the effect of miR‐671‐5p on progression of papillary thyroid carcinoma, IHH‐4 and TPC‐1 cells were transfected with mimic of miR‐671‐5p. qRT‐PCR analysis results showed higher expression of miR‐671‐5p by transfection with the mimic than with mock or NC mimic (Figure 1(A)). Overexpression of miR‐671‐5p decreased cell viability of IHH‐4 and TPC‐1 (Figure 1(B)), suppressed the cell colony formation capacity (Figure 1(C)), demonstrating that miR‐671‐5p might contribute to repress papillary thyroid carcinoma cell growth. In addition to the antiproliferative role, miR‐671‐5p also suppressed the cell migration (Figure 2(A)) and invasion (Figure 2(B)) of IHH‐4 and TPC‐1 cells, demonstrating the anti‐invasive role of miR‐671‐5p in papillary thyroid carcinoma. Moreover, inhibition of miR‐671‐5p suppressed papillary thyroid carcinoma proliferation, migration, and invasion (Figure S1).

Forced miR‐671‐5p repressed proliferation of papillary thyroid carcinoma. (A) Transfection with miR‐671‐5p mimic in IHH‐4 and TPC‐1 increased miR‐671‐5p expression compared with that of NC mimic. (B) Transfection with miR‐671‐5p mimic in IHH‐4 and TPC‐1 decreased cell viability compared with that of NC mimic. (C) Transfection with miR‐671‐5p mimic in IHH‐4 and TPC‐1 decreased cell proliferation compared with that of NC mimic. * p < 0.05, ** p < 0.01

Forced miR‐671‐5p repressed progression of papillary thyroid carcinoma. (A) Transfection with miR‐671‐5p mimic in IHH‐4 and TPC‐1 decreased cell migration compared with that of NC mimic. (B) Transfection with miR‐671‐5p mimic in IHH‐4 and TPC‐1 decreased cell invasion compared with that of NC mimic. ** p < 0.01

3.2. Forced miR‐671‐5p repressed papillary thyroid carcinoma tumor growth

To evaluate the role of miR‐671‐5p on in vivo tumor growth of papillary thyroid carcinoma, mice were subcutaneously injected with TPC‐1 cells transfected with pMIRNA‐miR‐671‐5p or pMIRNA‐NC mimic. Injection with TPC‐1 cells overexpressed miR‐671‐5p repressed tumor growth with reduced tumor volume and weight (Figure 3(A)). Ki67 was downregulated in tumor tissues isolated from mice injected with TPC‐1 cells transfected with pMIRNA‐miR‐671‐5p compared with pMIRNA‐NC mimic (Figure 3(B)), demonstrating that forced miR‐671‐5p repressed papillary thyroid carcinoma tumor growth.

Forced miR‐671‐5p repressed papillary thyroid carcinoma tumor growth. (A) Injection with TPC‐1 cells stably transfected with pMIRNA‐miR‐671‐5p repressed tumor growth with reduced tumor volume and weight compared with that of pMIRNA‐NC mimic. (B) Injection with TPC‐1 cells stably transfected with pMIRNA‐miR‐671‐5p repressed Ki67 expression compared with that of pMIRNA‐NC mimic. ** p < 0.01

3.3. MiR‐671‐5p mediated TRIM14 in papillary thyroid carcinoma

To investigate the mechanism of miR‐671‐5p on the progression of papillary thyroid carcinoma, downstream target gene of miR‐671‐5p was predicted as TRIM14 by TargetScan (http://www.targetscan.org/vert_72/) (Figure 4(A)). Luciferase activity assay revealed that transfection with miR‐671‐5p mimic decreased luciferase activity of TRIM14‐WT (Figure 4(B)). However, luciferase activity of TRIM14‐MUT was not affected by miR‐671‐5p mimic (Figure 4(B)), suggesting that miR‐671‐5p binds to 3'UTR of TRIM14. mRNA (Figure 4(C)) and protein (Figure 4(D)) expression of TRIM14 were reduced in IHH‐4 and TPC‐1 cells transfected with miR‐671‐5p mimic, while enhanced by transfection with the miR‐671‐5p inhibitor. TRIM14 was downregulated in tumor tissues isolated from mice injected with TPC‐1 cells transfected with pMIRNA‐miR‐671‐5p compared with pMIRNA‐NC mimic (Figure 4(E)), indicating that forced miR‐671‐5p suppressed TRIM14 expression in papillary thyroid carcinoma.

MiR‐671‐5p mediated TRIM14 in papillary thyroid carcinoma. (A) Potential binding site between miR‐671‐5p and TRIM14. (B) Transfection with miR‐671‐5p mimic decreased the activity of TRIM14‐WT, while transfection with miR‐671‐5p inhibitor increased the activity of TRIM14‐WT. Luciferase activity of TRIM14‐MUT was not affected by miR‐671‐5p mimic or inhibitor. (C) Transfection with miR‐671‐5p mimic decreased mRNA expression of TRIM14, while transfection with miR‐671‐5p inhibitor increased the expression.(D) Transfection with miR‐671‐5p mimic decreased the protein expression of TRIM14, while transfection with miR‐671‐5p inhibitor increased the expression.(E) Injection with TPC‐1 cells stably transfected with pMIRNA‐miR‐671‐5p repressed TRIM14 expression compared with that of pMIRNA‐NC mimic. **, ## p < 0.01

3.4. Forced TRIM14 attenuated suppressive effect of miR‐671‐5p on progression of papillary thyroid carcinoma

To evaluate the effect of miR‐671‐5p/TRIM14 axis on progression of papillary thyroid carcinoma, TPC‐1 cells were transfected with pcDNA‐TRIM14 or cotransfected with miR‐671‐5p mimic and pcDNA‐TRIM14. Forced TRIM14 attenuated miR‐671‐5p‐induced decrease in TRIM14 (Figure 5(A)). Overexpression of TRIM14 contributed to progression of papillary thyroid carcinoma by increasing cell viability (Figure 5(B)), proliferation (Figure 5(C)), migration (Figure 5(D)), and invasion (Figure 5(E)). However, cotransfection with mimic of miR‐671‐5p and pcDNA‐TRIM14 counteracted the suppressive effects of miR‐671‐5p on the progression (Figure 5(B),(C),(D),(E)) of papillary thyroid carcinoma, suggesting that miR‐671‐5p repressed progression of papillary thyroid carcinoma through downregulation of TRIM14.

Forced TRIM14 attenuated suppressive effect of miR‐671‐5p on progression of papillary thyroid carcinoma. (A) Cotransfection with mimic of miR‐671‐5p and pcDNA‐TRIM14 attenuated miR‐671‐5p‐induced decrease of TRIM14.(B) Overexpression of TRIM14 increased cell viability of TPC‐1, while cotransfection with mimic of miR‐671‐5p and pcDNA‐TRIM14 attenuated miR‐671‐5p‐induced decrease of cell viability.(C) Overexpression of TRIM14 increased cell proliferation of TPC‐1, while cotransfection with mimic of miR‐671‐5p and pcDNA‐TRIM14 attenuated miR‐671‐5p‐induced decrease of cell proliferation.(D) Overexpression of TRIM14 increased cell migration of TPC‐1, while cotransfection with mimic of miR‐671‐5p and pcDNA‐TRIM14 attenuated miR‐671‐5p‐induced migration of cell viability.(E) Overexpression of TRIM14 increased cell invasion of TPC‐1, while cotransfection with mimic of miR‐671‐5p and pcDNA‐TRIM14 attenuated miR‐671‐5p‐induced invasion of cell viability. **, ## p < 0.01

4. DISCUSSION

Differently expressed miRNAs were reported to predict the progression‐free interval in papillary thyroid carcinoma, suggesting its prognostic role in papillary thyroid carcinoma. ²¹ Moreover, differently expressed miRNAs were related to different risks of recurrence and histological types in papillary thyroid carcinoma, suggesting that miRNAs might be potential therapeutic targets for treatment of papillary thyroid carcinoma. ²² Studies have shown the tumor suppressive role of miR‐671‐5p in various tumors. Therefore, the potential mechanism of miR‐671‐5p was evaluated in papillary thyroid carcinoma in this study.

Since no reliable diagnostic biomarkers for papillary thyroid carcinoma have been identified, ²³ the correlation between miRNAs and clinical stage of papillary thyroid carcinoma demonstrated that miRNAs might be promising diagnosis biomarkers for papillary thyroid carcinoma. ²⁴ MiR‐671‐5p was shown to be involved in oncogenic transformation of breast cancer, suggesting potential diagnostic role in breast cancer. ²⁵ To unravel the potential prognostic and diagnostic roles of miR‐671‐5p in papillary thyroid carcinoma, the relationship between miR‐671‐5p level and clinical stage of papillary thyroid carcinoma should be analyzed.

Functional assays indicated that forced miR‐671‐5p repressed in vitro cell viability, proliferation, migration, and invasion, suggesting the common tumor suppressive role of miR‐671‐5p in papillary thyroid carcinoma. Moreover, the in vivo tumor growth of papillary thyroid carcinoma was also suppressed by miR‐671‐5p overexpression. Previous study has shown that miR‐671‐5p promoted growth of colon cancer cells through targeting TRIM67. ²⁶ Leucine rich repeat neuronal 1, kinesin family member 1B, and TRIM25 were predicted as binding targets of miR‐671‐5p in Kawasaki disease. ²⁷ The downstream target gene of miR‐671‐5p involved in papillary thyroid carcinoma was validated in this study.

The results obtained in this study showed that miR‐671‐5p binds to 3' UTR of TRIM14 and reduced its expression both in vitro and in vivo. TRIM14, which was enhanced in papillary thyroid carcinoma tissues, promoted cell proliferation of papillary thyroid carcinoma and repressed the cell apoptosis. ²⁰ Functional assays in this study also confirmed the oncogenic role of TRIM14 in papillary thyroid carcinoma. Furthermore, forced expression of TRIM14 attenuated the suppressive effect of miR‐671‐5p on progression of papillary thyroid carcinoma, suggesting that miR‐671‐5p repressed progression of papillary thyroid carcinoma through downregulation of TRIM14. TRIM14 promoted the activation of STAT3 through interaction with negative regulator of STAT3, suppressor of cytokine‐signaling‐1, thereby promoting the progression of papillary thyroid carcinoma. ²⁰ TRIM14 also upregulated sphingosine kinase 1 for constitutive activation of STAT3 during colorectal cancer progression. ¹⁹ AKT pathway was promoted during TRIM14‐mediated osteosarcoma progression. ¹⁷ However, TRIM14 suppressed non‐small cell lung cancer progression through STAT1 signaling. ²⁸ Therefore, the downstream pathways involved in miR‐671‐5p/TRIM14‐mediated papillary thyroid carcinoma progression will be investigated in further study.

5. CONCLUSION

Our results demonstrated that miR‐671‐5p repressed the development of papillary thyroid carcinoma. Mechanistically, miR‐671‐5p modulated papillary thyroid carcinoma cell behavior through negative regulation of TRIM14. The meaningful results provided a novel promising therapeutic target for the treatment of papillary thyroid carcinoma.

CONFLICT OF INTEREST

The authors declare no potential conflict of interest.

Supporting information

Figure S1 Inhibition of miR‐671‐5p suppressed papillary thyroid carcinoma proliferation, migration and invasion. * p < 0.05, ** p < 0.01.

KJM2-37-983-s001.jpg^{(1.8MB, jpg)}

Wang W‐J, Yuan Y, Zhang D, Liu P, Liu F. miR‐671‐5p repressed progression of papillary thyroid carcinoma via TRIM14 . Kaohsiung J Med Sci. 2021;37:983–990. 10.1002/kjm2.12424

Wan‐Ju Wang and Yuan Yuan contributed equally to the work.

REFERENCES

1. Schweppe RE, Pozdeyev N, Pike LA, Korch C, Zhou Q, Sams SB, et al. Establishment and characterization of four novel thyroid cancer cell lines and PDX models expressing the RET/PTC1 rearrangement, BRAFV600E, or RASQ61R as drivers. Mol Cancer Res. 2019;17(5):1036–48. [DOI] [PMC free article] [PubMed] [Google Scholar]
2. Pitoia F, Bueno F, Urciuoli C, Abelleira E, Cross G, Tuttle RM. Outcomes of patients with differentiated thyroid cancer risk‐stratified according to the American Thyroid Association and Latin American thyroid society risk of recurrence classification systems. Thyroid. 2013;23(11):1401–7. [DOI] [PubMed] [Google Scholar]
3. Yildiz SY, Berkem H, Yuksel BC, Ozel H, Kendirci M, Hengirmen S. The rising trend of papillary carcinoma in thyroidectomies: 14‐years of experience in a referral center of Turkey. World J Surg Oncol. 2014;12:34. [DOI] [PMC free article] [PubMed] [Google Scholar]
4. Bhargav PRK, Mishra A, Agarwal G, Agarwal A, Pradhan PK, Gambhir S, et al. Long‐term outcome of differentiated thyroid carcinoma: Experience in a developing country. World J Surg. 2010;34(1):40–7. [DOI] [PubMed] [Google Scholar]
5. Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–97. [DOI] [PubMed] [Google Scholar]
6. Lee YS, Dutta A. MicroRNAs in cancer. Annu Rev Pathol. 2009;4:199–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
7. Boufraqech M, Klubo‐Gwiezdzinska J, Kebebew E. MicroRNAs in the thyroid. Best Pract Res Clin Endocrinol Metab. 2016;30(5):603–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
8. Dai Z, Yan H, Wang K, Zhong S, Zhou M, Zheng D, et al. MicroRNA‐22 regulates thyroid cell growth and lipid accumulation via IL6R. Front Biosci. 2019;24:1350–62. [DOI] [PubMed] [Google Scholar]
9. He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S, et al. The role of microRNA genes in papillary thyroid carcinoma. Proc Natl Acad Sci U S A. 2005;102(52):19075–80. [DOI] [PMC free article] [PubMed] [Google Scholar]
10. Ma S, Jia W, Ni S. miR‐199a‐5p inhibits the progression of papillary thyroid carcinoma by targeting SNAI1. Biochem Biophys Res Commun. 2018;497(1):181–6. [DOI] [PubMed] [Google Scholar]
11. Yu S, Cao S, Hong S, Lin X, Guan H, Chen S, et al. miR‐3619‐3p promotes papillary thyroid carcinoma progression via Wnt/β‐catenin pathway. Ann Transl Med. 2019;7(22):643. [DOI] [PMC free article] [PubMed] [Google Scholar]
12. Tan X, Fu Y, Chen L, Lee W, Lai Y, Rezaei K, et al. miR‐671‐5p inhibits epithelial‐to‐mesenchymal transition by downregulating FOXM1 expression in breast cancer. Oncotarget. 2016;7(1):293–307. [DOI] [PMC free article] [PubMed] [Google Scholar]
13. Sajdak S, Markowska A, Krygowska‐Zielińska J, Szarszewska M, Witek A, Olejek A, et al. Effect of metformin on clinical‐pathological variables in women with endometrial cancer. A multicenter study. Eur J Gynaecol Oncol. 2019;40(5):775–80. [Google Scholar]
14. Xin C, Lu S, Li Y, Zhang Y, Tian J, Zhang S, et al. miR‐671‐5p inhibits tumor proliferation by blocking cell cycle in osteosarcoma. DNA Cell Biol. 2019;38(9):996–1004. [DOI] [PubMed] [Google Scholar]
15. Qiu T, Wang K, Li X, Jin J. miR‐671‐5p inhibits gastric cancer cell proliferation and promotes cell apoptosis by targeting URGCP. Exp Ther Med. 2018;16(6):4753–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
16. Hatakeyama S. TRIM family proteins: roles in autophagy, immunity, and carcinogenesis. Trends Biochem Sci. 2017;42(4):297–311. [DOI] [PubMed] [Google Scholar]
17. Xu G, Guo Y, Xu D, Wang Y, Shen Y, Wang F, et al. TRIM14 regulates cell proliferation and invasion in osteosarcoma via promotion of the AKT signaling pathway. Sci Rep. 2017;7:42411. [DOI] [PMC free article] [PubMed] [Google Scholar]
18. Dong B, Zhang W. High levels of TRIM14 are associated with poor prognosis in hepatocellular carcinoma. Oncol Res Treat. 2018;41(3):129–34. [DOI] [PubMed] [Google Scholar]
19. Jin Z, Li H, Hong X, Ying G, Lu X, Zhuang L, et al. TRIM14 promotes colorectal cancer cell migration and invasion through the SPHK1/STAT3 pathway. Cancer Cell Int. 2018;18:202. [DOI] [PMC free article] [PubMed] [Google Scholar]
20. Sun W, Wang Y, Li D, Wu Y, Ji Q, Sun T. Tripartite motif containing 14: An oncogene in papillary thyroid carcinoma. Biochem Biophys Res Commun. 2020;521(2):360–7. [DOI] [PubMed] [Google Scholar]
21. Wang K, Xu J, Zhao L, Liu S, Liu C, Zhang L. Prognostic lncRNA, miRNA, and mRNA signatures in papillary thyroid carcinoma. Front Genet. 2020;11:805. [DOI] [PMC free article] [PubMed] [Google Scholar]
22. Rosignolo F, Memeo L, Monzani F, Colarossi C, Pecce V, Verrienti A, et al. MicroRNA‐based molecular classification of papillary thyroid carcinoma. Int J Oncol. 2017;50(5):1767–77. [DOI] [PubMed] [Google Scholar]
23. Liang H, Zhong Y, Luo Z, Huang Y, Lin H, Luo M, et al. Assessment of biomarkers for clinical diagnosis of papillary thyroid carcinoma with distant metastasis. Int J Biol Markers. 2010;25(1):38–45. [DOI] [PubMed] [Google Scholar]
24. Zhao Y, Liu X, Zhong L, He M, Chen S, Wang T, et al. The combined use of miRNAs and mRNAs as biomarkers for the diagnosis of papillary thyroid carcinoma. Int J Mol Med. 2015;36(4):1097–103. [DOI] [PubMed] [Google Scholar]
25. Tan X, Li Z, Ren S, Rezaei K, Pan Q, Goldstein AT, et al. Dynamically decreased miR‐671‐5p expression is associated with oncogenic transformation and radiochemoresistance in breast cancer. Breast Cancer Res. 2019;21(1):89. [DOI] [PMC free article] [PubMed] [Google Scholar]
26. Jin W, Shi J, Liu M. Overexpression of miR‐671‐5p indicates a poor prognosis in colon cancer and accelerates proliferation, migration, and invasion of colon cancer cells. Onco Targets Ther. 2019;12:6865–73. [DOI] [PMC free article] [PubMed] [Google Scholar]
27. Zhang X, Xin G, Sun D. Serum exosomal miR‐328, miR‐575, miR‐134 and miR‐671‐5p as potential biomarkers for the diagnosis of Kawasaki disease and the prediction of therapeutic outcomes of intravenous immunoglobulin therapy. Exp Ther Med. 2018;16(3):2420–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
28. Hai J, Zhu CQ, Wang T, Organ SL, Shepherd FA, Tsao MS. TRIM14 is a putative tumor suppressor and regulator of innate immune response in non‐small cell lung cancer. Sci Rep. 2017;7:39692. [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Figure S1 Inhibition of miR‐671‐5p suppressed papillary thyroid carcinoma proliferation, migration and invasion. * p < 0.05, ** p < 0.01.

KJM2-37-983-s001.jpg^{(1.8MB, jpg)}

[kjm212424-bib-0001] 1. Schweppe RE, Pozdeyev N, Pike LA, Korch C, Zhou Q, Sams SB, et al. Establishment and characterization of four novel thyroid cancer cell lines and PDX models expressing the RET/PTC1 rearrangement, BRAFV600E, or RASQ61R as drivers. Mol Cancer Res. 2019;17(5):1036–48. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0002] 2. Pitoia F, Bueno F, Urciuoli C, Abelleira E, Cross G, Tuttle RM. Outcomes of patients with differentiated thyroid cancer risk‐stratified according to the American Thyroid Association and Latin American thyroid society risk of recurrence classification systems. Thyroid. 2013;23(11):1401–7. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0003] 3. Yildiz SY, Berkem H, Yuksel BC, Ozel H, Kendirci M, Hengirmen S. The rising trend of papillary carcinoma in thyroidectomies: 14‐years of experience in a referral center of Turkey. World J Surg Oncol. 2014;12:34. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0004] 4. Bhargav PRK, Mishra A, Agarwal G, Agarwal A, Pradhan PK, Gambhir S, et al. Long‐term outcome of differentiated thyroid carcinoma: Experience in a developing country. World J Surg. 2010;34(1):40–7. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0005] 5. Bartel DP. MicroRNAs: Genomics, biogenesis, mechanism, and function. Cell. 2004;116(2):281–97. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0006] 6. Lee YS, Dutta A. MicroRNAs in cancer. Annu Rev Pathol. 2009;4:199–227. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0007] 7. Boufraqech M, Klubo‐Gwiezdzinska J, Kebebew E. MicroRNAs in the thyroid. Best Pract Res Clin Endocrinol Metab. 2016;30(5):603–19. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0008] 8. Dai Z, Yan H, Wang K, Zhong S, Zhou M, Zheng D, et al. MicroRNA‐22 regulates thyroid cell growth and lipid accumulation via IL6R. Front Biosci. 2019;24:1350–62. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0009] 9. He H, Jazdzewski K, Li W, Liyanarachchi S, Nagy R, Volinia S, et al. The role of microRNA genes in papillary thyroid carcinoma. Proc Natl Acad Sci U S A. 2005;102(52):19075–80. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0010] 10. Ma S, Jia W, Ni S. miR‐199a‐5p inhibits the progression of papillary thyroid carcinoma by targeting SNAI1. Biochem Biophys Res Commun. 2018;497(1):181–6. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0011] 11. Yu S, Cao S, Hong S, Lin X, Guan H, Chen S, et al. miR‐3619‐3p promotes papillary thyroid carcinoma progression via Wnt/β‐catenin pathway. Ann Transl Med. 2019;7(22):643. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0012] 12. Tan X, Fu Y, Chen L, Lee W, Lai Y, Rezaei K, et al. miR‐671‐5p inhibits epithelial‐to‐mesenchymal transition by downregulating FOXM1 expression in breast cancer. Oncotarget. 2016;7(1):293–307. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0013] 13. Sajdak S, Markowska A, Krygowska‐Zielińska J, Szarszewska M, Witek A, Olejek A, et al. Effect of metformin on clinical‐pathological variables in women with endometrial cancer. A multicenter study. Eur J Gynaecol Oncol. 2019;40(5):775–80. [Google Scholar]

[kjm212424-bib-0014] 14. Xin C, Lu S, Li Y, Zhang Y, Tian J, Zhang S, et al. miR‐671‐5p inhibits tumor proliferation by blocking cell cycle in osteosarcoma. DNA Cell Biol. 2019;38(9):996–1004. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0015] 15. Qiu T, Wang K, Li X, Jin J. miR‐671‐5p inhibits gastric cancer cell proliferation and promotes cell apoptosis by targeting URGCP. Exp Ther Med. 2018;16(6):4753–8. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0016] 16. Hatakeyama S. TRIM family proteins: roles in autophagy, immunity, and carcinogenesis. Trends Biochem Sci. 2017;42(4):297–311. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0017] 17. Xu G, Guo Y, Xu D, Wang Y, Shen Y, Wang F, et al. TRIM14 regulates cell proliferation and invasion in osteosarcoma via promotion of the AKT signaling pathway. Sci Rep. 2017;7:42411. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0018] 18. Dong B, Zhang W. High levels of TRIM14 are associated with poor prognosis in hepatocellular carcinoma. Oncol Res Treat. 2018;41(3):129–34. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0019] 19. Jin Z, Li H, Hong X, Ying G, Lu X, Zhuang L, et al. TRIM14 promotes colorectal cancer cell migration and invasion through the SPHK1/STAT3 pathway. Cancer Cell Int. 2018;18:202. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0020] 20. Sun W, Wang Y, Li D, Wu Y, Ji Q, Sun T. Tripartite motif containing 14: An oncogene in papillary thyroid carcinoma. Biochem Biophys Res Commun. 2020;521(2):360–7. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0021] 21. Wang K, Xu J, Zhao L, Liu S, Liu C, Zhang L. Prognostic lncRNA, miRNA, and mRNA signatures in papillary thyroid carcinoma. Front Genet. 2020;11:805. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0022] 22. Rosignolo F, Memeo L, Monzani F, Colarossi C, Pecce V, Verrienti A, et al. MicroRNA‐based molecular classification of papillary thyroid carcinoma. Int J Oncol. 2017;50(5):1767–77. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0023] 23. Liang H, Zhong Y, Luo Z, Huang Y, Lin H, Luo M, et al. Assessment of biomarkers for clinical diagnosis of papillary thyroid carcinoma with distant metastasis. Int J Biol Markers. 2010;25(1):38–45. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0024] 24. Zhao Y, Liu X, Zhong L, He M, Chen S, Wang T, et al. The combined use of miRNAs and mRNAs as biomarkers for the diagnosis of papillary thyroid carcinoma. Int J Mol Med. 2015;36(4):1097–103. [DOI] [PubMed] [Google Scholar]

[kjm212424-bib-0025] 25. Tan X, Li Z, Ren S, Rezaei K, Pan Q, Goldstein AT, et al. Dynamically decreased miR‐671‐5p expression is associated with oncogenic transformation and radiochemoresistance in breast cancer. Breast Cancer Res. 2019;21(1):89. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0026] 26. Jin W, Shi J, Liu M. Overexpression of miR‐671‐5p indicates a poor prognosis in colon cancer and accelerates proliferation, migration, and invasion of colon cancer cells. Onco Targets Ther. 2019;12:6865–73. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0027] 27. Zhang X, Xin G, Sun D. Serum exosomal miR‐328, miR‐575, miR‐134 and miR‐671‐5p as potential biomarkers for the diagnosis of Kawasaki disease and the prediction of therapeutic outcomes of intravenous immunoglobulin therapy. Exp Ther Med. 2018;16(3):2420–32. [DOI] [PMC free article] [PubMed] [Google Scholar]

[kjm212424-bib-0028] 28. Hai J, Zhu CQ, Wang T, Organ SL, Shepherd FA, Tsao MS. TRIM14 is a putative tumor suppressor and regulator of innate immune response in non‐small cell lung cancer. Sci Rep. 2017;7:39692. [DOI] [PMC free article] [PubMed] [Google Scholar]

PERMALINK

miR‐671‐5p repressed progression of papillary thyroid carcinoma via TRIM14

Wan‐Ju Wang

Yuan Yuan

Dong Zhang

Piao Liu

Fang Liu

Abstract

1. INTRODUCTION