Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2019 Nov 20;36(3):196–205. doi: 10.1002/kjm2.12156

Increased expression of hematological and neurological expressed 1 (HN1) is associated with a poor prognosis of hepatocellular carcinoma and its knockdown inhibits cell growth and migration partly by down‐regulation of c‐Met

Jia‐Jie Chen 1, Xu Sun 1, Qi‐Qi Mao 1, Xiao‐Yun Jiang 1, Xian‐Guang Zhao 1, Wei‐Jia Xu 1, Liang Zhong 1,✉
PMCID: PMC11896369  PMID: 31749294

Abstract

Hematologic and neurological expression 1 (HN1) has been reported to involved in certain cancers, but its role in hepatocellular carcinoma (HCC) is largely unknown. The contribution of HN1 to HCC progression was investigated in the present study. We found that HN1 was significantly up‐regulated in HCC tissues, compared with normal tissues, by analyzing the Oncomine and Human Protein Atlas database; and found that high expression of HN1 was markedly associated with worse overall survival, relapse‐free survival, progression‐ free survival and disease‐specific survival in HCC patients via exploring the Kaplan‐Meier plotter database. Functional assays revealed that HN1 knockdown by siRNA induced G1 cell cycle arrest, and inhibited the growth and migration of HCC cells; accordingly, HN1 over‐expression promoted HCC cells proliferation and migration. Further studies indicated that HN1 knockdown reduced the expression of cyclin D1 and CDK4, while upregulated the cell cycle inhibitor p21WAF1/Cip1. Moreover, HN1 knockdown decreased c‐Met (receptor tyrosine kinase of hepatocyte growth factor) expression, and suppressed ERK activation, which is a common downstream signaling pathway triggered by c‐Met; consistently, HN1 over‐expression reversed these effects. Meanwhile, down‐regulation of c‐Met partly eliminated the effect of HN1 over‐expression in HCC cells. Thus, the present findings suggested that HN1 promotes the progression of HCC to some extent by up‐regulating the expression of c‐Met, and may act as a potential biomarker and therapeutic target for the treatment of HCC.

Keywords: Hepatocellular, carcinoma, HN1, c‐Met, prognosis

1. INTRODUCTION

Hepatocellular carcinoma (HCC) is one of the most common malignant tumors in the world, and its incidence has been increasing in recent years.1 Although great progress has been made in the diagnosis and treatment of HCC, the 5‐year overall survival rate for HCC patients is still very low.2 Understanding the various factors that regulate HCC progression is a useful goal in developing novel therapies against HCC. However, the molecular mechanisms involved in the progression of HCC remain largely uncertain. Therefore, there is an urgent need to explore effective diagnostic biomarkers and therapeutic targets in order to improve the prognosis of patients with HCC.

Hematological and neurological expressed 1 (HN1) gene, also called Jupiter microtubule associated homolog 1 (JPT1), encodes a small 16.5 kDa protein.3 Some evidences have demonstrated that HN1 is up‐regulated in certain cancers and control their progression, such as breast cancer,3 gliomas,4 melanoma,5 ovarian cancer,6 and prostate cancer.7 In terms of mechanism, it is reported that HN1 promotes the progression of breast cancer by up‐regulating MYC expression.3 miR‐132 was reported to inhibit cell proliferation, invasion, migration and metastasis of breast cancer by targeting HN1.8 In prostate cancer, HN1 interacts with GSK3β/β‐catenin destruction complex to promote β‐catenin degradation and negatively influences the β‐catenin/E‐cadherin interaction, contributes to cell growth and migration.9 Moreover, HN1 depletion in melanoma cells resulted in cell cycle arrest. Recently, Nault and colleagues reported a 5‐gene score, based on combined expression level of HN1, RAN, RAMP3, KRT19, and TAF9, was associated with disease‐specific survival of HCC patients, and up‐regulation of these proteins was found in poor prognosis HCC.10 However, the role of HN1 in HCC and the molecular mechanisms involved are still unclear.

In this study, the function and mechanism of HN1 were investigated in HCC. Firstly, we explored the expression and prognostic value of HN1 in HCC patients by using the Oncomine, Human Protein Atlas and Kaplan‐Meier plotter databases. The effects of HN1 in HCC progression were then detected. Furthermore, the molecular mechanisms of HN1 in HCC cells were investigated. We found that HN1 was up‐regulated in HCC tissues, and patients with high level of HN1 had poor prognosis. Knockdown of HN1 inhibited the growth and migration of HCC cells partly by down‐regulating of c‐Met. The present results demonstrated that HN1 may be a therapeutic target for HCC.

2. MATERIALS AND METHODS

2.1. Antibodies and reagents

Primary antibodies for detecting HN1 (14914‐1‐AP), c‐Met (25869‐1‐AP), CDK4 (11026‐1‐AP), Cyclin D1 (60186‐1‐Ig), p21waf/cip1 (10355‐1‐AP), and β‐ACTIN (60008‐1‐Ig) were purchased from Proteintech (WUHAN SANYING, China). Antibodies for detection of phospho‐Akt (4060), Akt (4691), phospho‐p44/42 MAPK (Erk1/2) (4370), and p44/42 MAPK (Erk1/2) (4695), and horseradish peroxidase (HRP)‐linked secondary antibodies (anti‐rabbit IgG (7074P2) and anti‐mouse IgG (7076P2)) were obtained from Cell Signaling Technology (Danvers, Massachusetts). RIPA lysis buffer I (C500005) and phenylmethanesulfonyl fluoride (PMSF) (A610425) were purchased from Sangon Biotech (Shanghai, China).

2.2. Oncomine analysis

The Oncomine gene expression array database (www.oncomine.org) was used to assess the HN1 mRNA expression levels in HCC datasets. In this study, the differential mRNA expression of HN1 between HCC and normal liver tissues was compared using a Student's t‐test.11

2.3. Human protein atlas

HN1 protein expression levels in HCC and normal liver tissues were reviewed in the Human Tissue Atlas (http://www.proteinatlas.org/).12

2.4. Kaplan‐Meier plotter

Kaplan‐Meier Plotter (www.kmplot.com) is an online database including gene expression data and clinical data. In the present study, Kaplan‐Meier Plotter was used to evaluate the overall survival (OS), relapse‐free survival (RFS), progression‐free survival (PFS), and disease‐specific survival (DSS) of HCC patients. Individuals were separated into two groups based on median gene expression; high (≥median expression) and low expression (<median expression).11, 12

2.5. Cell culture

HCC cell lines HepG2, Hep3B, Huh7, and MHCC‐97H (a highly metastatic cell line) were obtained from the Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). All cells were maintained at 37°C under 5% CO2 in high glucose Dulbecco's modified Eagle's medium (Sangon Biotech) supplemented with 10% fetal bovine serum (Sangon Biotech).

2.6. Gene knockdown by small interference RNA (siRNA)

HN1‐specific siRNA (HN1‐siRNA) or negative control siRNA (NC‐siRNA) were purchased from Biotend Company (Shanghai, China). HN1‐siRNA is a mixture of two specific siRNA. The following siRNA sequences were used: HN1‐siRNA1, 5′‐GAGACUUCUUAGAUCUGAA dTdT‐3′; HN1‐siRNA2, 5′‐GUACAUCUCUUGGA‐ UUUGU dTdT‐3′; NC‐siRNA, 5′‐CUUACGCUG‐ GUACUUCGA dTdT‐3′. The siRNA oligonucleotides for c‐MET (s8701) were purchased from Thermo fisher Scientific‐CN (Shanghai, China).

RNA interference was according to the previous procedure with modifications.13 After seeded into 96 or six‐well plates for overnight, cells were transfected with HN1‐siRNA, c‐Met‐siRNA, or NC‐siRNA (final concentration 50 nM) using lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instructions. Then, cells were cultured for indicated time and subjected to gene silencing detection or functional assays.

2.7. RNA isolation and polymerase chain reaction (PCR)

Total RNA of different cells lines were extracted using RNAiso Plus reagent and reverse transcribed with PrimeScript RT Master Mix (TaKaRa Biotechnology Dalian Co. Ltd., Dalian, China) according to the manufacturer's instructions. The cDNA of matched cancer and paracancerous HCC tissues were ordered from Shanghai Outdo Biotech Co., Ltd. Primers for each gene were designed using NCBI Primer‐BLAST and synthesized by Sangon Biotech. The primers were as follows: HN1, 5′‐CCAACAGCAGGAATAGCTC CC‐3′ (forward) and 5′‐CAGGTGTCCCAAAGATAT‐ TAGAGGC‐3′ (reverse); β‐ACTIN, 5′‐GGACTTCGAGCAAGAGATGG‐3′ (forward) and 5′‐AGCACTGTGTTGGCGTACA G‐3′ (reverse). Real‐time PCR was performed using ABI 7500 systems (ABI, California) with SYBR Premix Ex Taq (TaKaRa). β‐actin was used as an internal control to normalize gene expression, the relative quantification was determined by 2ΔCt method.

2.8. Western blot analysis

Western blot was performed as previously described with modifications.14 Briefly, cells were lysed in RIPA lysis buffer, and the equal amounts of proteins were resolved with loading buffer. After thermal denaturation for 5 minutes at 95°C, samples were electrophoresed on 10% or 12% SDS‐PAGE mini gels, and then transferred to PVDF membranes. The membranes were blocked in TBST containing 5% skimmed milk for 1 hour at room temperature, and subsequently probed with targeted primary antibodies (diluted in blocking buffer according to the manufacturer's instructions) for overnight at 4°C, and blotted with the corresponding secondary antibodies. Western Blotting Luminol Reagent (Santa Cruz Biotechnology, California) was used to detect the signals. Membranes were imaged using the BioRad ChemiDoc XRS+ System. Densitometry was performed using Image Lab software (Bio‐Rad, Hercules, California). β‐ACTIN was used as an internal control.

2.9. HN1 over‐expression vector generation

The coding sequence of HN1 was obtained by direct PCR of MHCC‐97H cDNA and cloned into the CMV6 vector. Empty vector served as negative control. The CMV6‐HN1 plasmid or empty vector was transfected into Huh7 cells using liopofectamine 2000.

2.10. Cell proliferation assay

To determine the effect of HN1 knockdown on HCC cell growth in vitro, MHCC‐97H cells (3000) were seeded into each well of 96‐well plates and incubated overnight, and then transfected with 50 nM of NC‐siRNA or HN1‐siRNA, six parallel wells for each siRNA. Cell Counting Kit‐8 (CK04, Dojindo Laboratories, Japan) was used to test cell viability daily for 4 days post‐transfection. 10 μL of CCK‐8 was added to each well, and incubated for 4 hours at 37°C. The absorbance of each well was read in a microplate reader (BioTek ELX800, BioTek Instrument Inc., Winooski, VT, USA) at 450 nm. Similarly, to measure the effect of HN1 over‐expression on HCC cell growth, Huh7 cells were plated into 96‐well plates, and transfected with the CMV6‐HN1 plasmid or empty vector. The cell viability was tested daily for 4 days. Experiments were performed three times.

2.11. Cell cycle analysis

MHCC‐97H cells (3.5 × 105) were seeded into each well of six‐well plates. After transfection with siRNA, cells were subsequently cultured for 72 hours, collected, and fixed with 70% ethanol overnight at −20°C. The fixed cells were washed with cold PBS, and suspended in 500 μL phosphate‐buffered saline (PBS) containing ribonuclease A and stained with propidium iodide for 30 minutes in dark at room temperature. Then, the cell suspension was subjected to a FACSCalibur flow cytometer (BD Co., San Jose, CA, USA) to analyze the percentages of cells in G1, S and G2/M phases of the cell cycle. Experiments were performed in triplicate.

2.12. Migration assay

Cell migration assay were performed by using the migration chambers with 8 μm porosity (Merck Life Science [Shanghai] Co., Ltd. Shanghai, China) according to the manufacturer's instructions. Tumor cells (8 × 104 for HN1 knockdown MHCC‐97H cells, 4 × 104 for HN1 over‐expression Huh7 cells) in 1% FBS‐DMEM were seeded onto the filters in the upper chambers. DMEM containing 15% FBS was added to the lower chambers. After 24 to 48 hours of incubation, cells on the upper surface of the filters were removed with a cotton swab, and the filters were fixed with 4% paraformaldehyde and stained with crystal violet. After observed under microscope, the stained cells were dissolved in 33% v/v acetic acid (100 μL for each chamber) and the absorbance of the staining was measured at 570 nm in a microplate reader.15 Experiments were performed in triplicate.

2.13. Mouse xenograft models

Nude mice (male BALB/c nu/nu, 4‐week‐old) were obtained from the Shanghai SLAC Laboratory Animal Co. Ltd., Chinese Academy of Sciences, and fed with standard laboratory mice diet and water ad libitium. Mice were maintained in accordance with the institutional guidelines for the care and use of laboratory animals.

To investigate the effect of HN1 on HCC growth in vivo, we generated xenograft subcutaneous tumors in nude mice according to the previous description with modifications.16 5 × 106 MHCC‐97H cells transfected with NC‐siRNA or HN1‐siRNA in 200 μL PBS were subcutaneously injected into the right flank of mice, five mice in each group. Ten days after cells implantation, 5 nmol cholesterol‐conjugated NC‐siRNA or HN1‐siRNA in 25 to 100 μL PBS was intratumorally injected once every 3 days for seven times. Tumor volume was monitored by measuring the length (L) and width (W) with calipers once every 5 days and calculated with the following formula: (L × W 2) × 0.5. The experiments ended 35 days after tumor cell inoculation. Tumor weights were determined at the 35th day, and the tumor growth curve was drawn. HN1 expression level in subcutaneous tumor was detected by western blotting.

2.14. Statistical analysis

Data are expressed as mean ± SD. Student's t test was used to assess between‐group differences. Values of P < .05 were considered statistically significant (*P < .05, **P < .01, ***P < .001).

3. RESULTS

3.1. The expression of HN1 is up‐regulated in HCC tissues, and high level of HN1 is associated with poor outcome for HCC patients

To investigate the role of HN1 in HCC progression, we first examined HN1 expression in 20 types of cancer by using the Oncomine database. The results demonstrated that HN1 mRNA expression was notably increased in HCC samples compared with normal liver tissues (Figure 1A,B). To validate the above results from the Oncomine database, we examined the expression of HN1 in the matched cancer and paracancerous HCC tissues by real time PCR. Compared with the matched adjacent tissues, HN1 in 50% of the cancer tissues (7 out of 14) showed higher level, that in 35.7% of the cancer tissues (5 out of 14) were closer to its adjacent tissues, and that in 20% of the cancer tissues (2 out of 14) were lower than its adjacent tissues (Figure 1C). Moreover, the Human Protein Atlas database demonstrated that HN1 protein expression was decreased in normal liver samples (not detected in all three samples by immunohistochemistry staining) and increased in HCC tissues (medium staining in 5 out 11 samples, low staining in 2 samples, and not detected in 4 samples; Figure 1D). The Kaplan‐Meier Plotter survival curves illustrated that high level of HN1 mRNA expression was correlated with a poor OS, RFS, PFS, and DSS in HCC patients (Figure 2). HCC patients with high level of HN1 had significantly shorter survival than those with low HN1 expression.

Figure 1.

Figure 1

Open in a new tab

Expression of HN1 is up‐regulated in hepatocellular carcinoma (HCC) tumors. A, HN1 mRNA expressed in different types of cancers, and was up‐regulated in HCC tissues compared with normal controls in three datasets from the Oncomine database. B, The fold change of HN1 mRNA in Roessler liver 2 dataset (a) and Chen liver dataset (b). C, Real time PCR analysis of HN1 expression in 14 matched cancer (C) and paracancerous (P) HCC tissues. D, immunohistochemistry staining for HN1 in three cases of normal liver tissues (a‐c) and in three cases of HCC samples (d‐f) from the human protein atlas database

Figure 2.

Figure 2

Open in a new tab

Kaplan–Meier plotter reveals a poor prognosis of hepatocellular carcinoma (HCC) patients with HN1 over‐expression. High HN1 expression was associated with poor OS (A), poor RFS (B), poor PFS (C), and poor DSS (D) in HCC patients. DSS, disease‐specific survival; OS, overall survival; PFS, progression‐free survival; RFS, recurrence‐free survival

3.2. HN1 promotes HCC cell progression

To examine the effects of HN1 on HCC progression, HN1 expression was first detected in four HCC cell lines. MHCC‐97H expressed high level of HN1 than HepG2, Hep3B, and Huh7, both in mRNA and protein level (Figure 3A, B). So, MHCC‐97H was selected for HN1 knockdown, and Huh7 for HN1 over‐expression assay. The CCK‐8 measurement revealed that HN1 knockdown significantly decreased MHCC‐97H cell proliferation (Figure 3C). Western blot results indicated that HN1 knockdown reduced the expression of cyclin D1 and cyclin‐dependent kinase 4 (CDK4), them usually form a G1 phase cyclin‐CDK complex required for S phase entry; while up‐regulated the cell cycle inhibitor p21WAF1/Cip1 (Figure 3D). Moreover, the phosphorylation level of ERK (p‐ERK) was down‐regulated by HN1 knockdown; while which of p‐AKT did not occurred obviously change (Figure 3D). The cell cycle analysis showed that HN1 knockdown induced G1 cell cycle arrest (Figure 3E). This result was consistent with the expression change of cell cycle regulators measured above. The transwell assay demonstrated that the migration capability of HCC cells transfected with HN1‐siRNA was significantly decreased (Figure 3F). Furthermore, HN1 knockdown inhibited tumor growth in vivo (Figure 4).

Figure 3.

Figure 3

Open in a new tab

Knockdown of HN1 inhibited hepatocellular carcinoma (HCC) cell growth and migration. A, HN1 and β‐ACTIN (internal control) mRNA expression in HepG2, Hep3B, Huh7, and MHCC‐97H HCC cell lines was detected using PCR. B, HN1 protein expression in the four HCC cell lines was analyzed by western blotting. C, Effect of HN1 knockdown on MHCC‐97H cell proliferation. D, MHCC‐97H cells were transfected with siRNAs for 72 hours, the expression of HN1, CDK4, Cyclin D1, p21, c‐Met, ERK, and AKT were detected by western blotting. E, Effect of HN1 knockdown on cell cycle of MHCC‐97H cells. F, Migration ability of cells with HN1 knockdown was tested by using transwell chambers and crystal violet staining. Up panel: representative images; lower panel: dissolving the stained cells in 33% v/v acetic acid and measuring the absorbance at 570 nm. Data were averaged from three parallel experiments, and given as mean ± SD. *P < .05, **P < .01, ***P < .001 vs NC‐siRNA

Figure 4.

Figure 4

Open in a new tab

Knockdown of HN1 inhibited tumor growth in vivo. A, Representative images of tumors formed in nude mice (n = 5 per group). B, Western blotting analysis of the expression of HN1 and β‐ACTIN (internal control) in tumors from mice. C, Tumor growth curves. D, Tumor weights. *P < .05 vs NC‐siRNA

The above studies proved that knockdown HN1 in MHCC‐97H, which highly expressed HN1, inhibited cell growth and migration. Thus, CMV6‐HN1 plasmid was conducted into Huh7 cell, which lowly expressed HN1, to test whether over‐expression of HN1 may promote HCC progression. We found that HN1 over‐expression in Huh7 cells up‐regulated the expression of cyclin D1 and CDK4, and the activation of p‐ERK; while down‐regulated p21 (Figure 5A). Further analysis demonstrated that HN1 over‐expression promoted cell growth and migration of Huh7 cell (Figure 5B, C). These results indicated that high level of HN1 may promote HCC cell progression.

Figure 5.

Figure 5

Open in a new tab

Over‐expression of HN1 promoted hepatocellular carcinoma (HCC) cell growth and migration. A, CMV‐HN1 plasmids was transfected into Huh7 cells. Western blotting was performed to test the expression of HN1, CDK4, Cyclin D1, p21, c‐Met, ERK, and AKT. B, The growth of HN1 over‐expressing cells was analyzed with CCK‐8 reagent for 4 days continuously. C, Migration ability of indicated cells was measured by transwell analysis and crystal violet staining. Up panel: Representative images; lower panel: Dissolving the stained cells in 33% v/v acetic acid and measuring the absorbance at 570 nm. Each bar represents mean ± SD of three independent experiments. *P < .05, **P < .01 vs vector

3.3. HN1 activates c‐met pathway

c‐Met, a famous oncogene, has been demonstrated to promote the HCC progression, and been developed as a therapeutic target in HCC.17, 18 We found that HN1 expression was positively correlated with c‐Met expression in these four HCC cell line. MHCC‐97H highly expressed both HN1 and c‐Met, while the other three HCC cell lines HepG2, Hep3B and Huh7 lowly expressed these two proteins (Figures 3B and 6A). Moreover, western blot assay suggested knockdown of HN1 inhibited c‐Met expression and the level of p‐ERK (Figure 3D), the latter is a common downstream signaling pathway triggered by c‐Met19; and over‐expression of HN1 promoted c‐Met expression and the activation of p‐ERK (Figure 5A). These findings suggested HN1 might be a regulator of c‐Met, and could activate c‐Met pathway. We further demonstrated whether HN1 can regulate the proliferation and migration of HCC cell by regulating c‐Met expression. We used c‐Met siRNA to inhibit c‐Met expression in Huh7 cell over‐expressed HN1. Knockdown of c‐Met suppressed the activation ERK and AKT (Figure 6A). The functional assays showed that the pro‐growth and pro‐migration effects of HN1 were significantly reduced in Huh7 cell that over‐expressed HN1 and knockdown of c‐Met (Figure 6B,C). Therefore, our studies indicated that high level of HN1 may promote HCC cell progression partly by regulating the c‐Met pathway.

Figure 6.

Figure 6

Open in a new tab

Down‐regulation of c‐Met partly suppresses the phenotypes caused by HN1 over‐expression in hepatocellular carcinoma (HCC) cells. A, Western blotting analysis of the expression of c‐Met and β‐ACTIN (internal control) in the four HCC cell lines (up panel). Huh7 cells over‐expressing HN1 exposed to c‐Met‐siRNA, and western blotting was performed to test the expression of c‐Met, ERK, and AKT (lower panel). B, The cell‐growth was analyzed with CCK‐8 reagent for 4 days continuously. C, Migration ability of indicated cells was measured by transwell analysis and crystal violet staining. Up panel: Representative images; lower panel: dissolving the stained cells in 33% v/v acetic acid and measuring the absorbance at 570 nm. Each bar represents mean ± SD of three independent experiments. **P < .01 vs NC‐siRNA

4. DISCUSSION

HN1 is reported to express in models of development, regeneration and cancer, which suggests a putative role in cellular development and growth.5 However, the cellular functions of HN1 are not fully understood yet. HN1 has been demonstrated to promote the progression of some types of cancer through different mechanisms,3, 5, 9 but its role in HCC is still unknown.

In this study, we revealed that the expression of HN1 was increased in HCC tissues and high HN1 was markedly associated with poor outcome in HCC patients by mining the data in the Oncomine, Human Protein Atlas and Kaplan‐Meier plotter database (Figures 1 and 2). Further, we performed functional analysis via HN1 knockdown or over‐expression, which demonstrated that HN1 promoted the growth and migration of HCC cells partly by regulating c‐Met pathway (Figures 3, 4, 5, 6).

HN1 knockdown inhibited the growth of MHCC‐97H cells, which in some extent due to cell cycle G1 phase arrest (Figure 3E). The role of cell cycle regulation of HN1 was also observed in some other cancer cells. Varisli et al. reported that knockdown of HN1 resulted in prolongation of G1 phase in PC‐3 prostate cancer cell; consistently, over‐expression of HN1 resulted in accumulation of cells in G2/M phase.7 Laughlin et al. found that HN1 depletion in B16.F10 melanoma cells promoted differentiation due to G1/S cell cycle arrest.5 Accordingly, our western blot results showed that HN1 knockdown reduced the expression of cyclin D1 and CDK4, them usually form a G1 phase cyclin‐CDK complex required for S phase entry20, 21; while up‐regulated the cell cycle inhibitor p21WAF1/Cip1.22 In breast cancer cells MCF‐7 and T47D, HN1 executed the same regulatory function on the expression of CDK4, cyclin D1, and p213; however, there is a contrary observation in PC‐3 prostate cancer cell that knockdown of HN1 resulted in nuclear accumulation of cyclin D1.7

Furthermore, in the present study, HN1 knockdown decreased c‐Met expression, and suppressed ERK activation (Figure 3D); consistently, HN1 over‐expression increased c‐Met expression, and activated ERK (Figure 5A). Meanwhile, down‐regulation of c‐Met partly eliminated the effect of HN1 over‐expression in HCC cells (Figure 6). Previously, decreased expression of c‐Met was also detected in the HN1‐depleted melanoma cells.5 c‐Met, the receptor tyrosine kinase (RTK) of HGF, has been demonstrated to promote the HCC progression.18 The expression of c‐Met was closely associated with early recurrence.23 Down‐regulation of c‐Met expression inhibits human HCC cells growth and invasion.24 HGF induces c‐Met dimerization and activation, subsequently stimulates multiple downstream signaling pathways, including MAPK, PI3K, STAT, and NF‐kB. These pathways execute the cellular functions of c‐Met, such as proliferation, mobilization, and invasiveness.25, 26

ERK is a common downstream signaling pathway triggered by c‐Met.19, 27, 28 HGF may recruit Golgi‐localized, gamma ear‐containing, Arf‐binding proteins 3 (GGA3) to promote c‐Met recycling, and sustain ERK activation.29, 30 In the absence of HGF, heparin can also lead to c‐Met receptor dimerization and activates c‐Met signaling to promote motility and invasion in HCC cells through ERK1/2‐EGR1‐MMP axis.31 c‐Met is a direct target of miR‐449a, which may inhibit HCC growth by suppressing c‐Met/Ras/Raf/ERK signaling pathway.32 Thus, our findings suggested that HN1 promotes the progression of HCC to some extent by up‐regulating c‐Met pathway.

In summary, HN1 was significantly up‐regulated in HCC tissues, and HCC patients with high levels of HN1 expression had significantly shorter survival than those with low HN1 expression. Knockdown of HN1 arrested cell cycle, and inhibited cell growth and migration of HCC cells. The further functional assessment revealed that HN1 promoted the progression of HCC cells partly by up‐regulating the c‐Met pathway. Therefore, HN1 may act as a potential biomarker and therapeutic target for the treatment of HCC.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Chen J‐J, Sun X, Mao Q‐Q, et al. Increased expression of hematological and neurological expressed 1 (HN1) is associated with a poor prognosis of hepatocellular carcinoma and its knockdown inhibits cell growth and migration partly by down‐regulation of c‐Met. Kaohsiung J Med Sci. 2020;36:196–205. 10.1002/kjm2.12156

REFERENCES

  • 1. Liu YY, Liu LJ, Zhou Y, Zhou P, Yan QJ, Chen XB, et al. CKLF1 enhances inflammation‐mediated carcinogenesis and prevents doxorubicin‐induced apoptosis via IL‐6/STAT3 Signaling in HCC. Clin Cancer Res. 2019;25(13):4141–4154. 10.1158/10780432.CCR-18-3510. [DOI] [PubMed] [Google Scholar]
  • 2. Eggert T, Greten TF. Current standard and future perspectives in non‐surgical therapy for hepatocellular carcinoma. Digestion. 2017;96:1–4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Zhang C, Xu BF, Lu S, Zhao Y, Liu P. HN1 contributes to migration, invasion, and tumorigenesis of breast cancer by enhancing MYC activity. Mol Cancer. 2017;16:90. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4. Laughlin KM, Luo D, Liu C, Shaw G, Warrington KH Jr, Qiu J, et al. Hematopoietic‐ and neurologic‐expressed sequence 1 expression in the murine GL261 and high‐grade human gliomas. Pathol Oncol Res. 2009;15:437–444. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Laughlin KM, Luo D, Liu C, Shaw G, Warrington KH Jr, Law BK, et al. Hematopoietic‐ and neurologic‐expressed sequence 1 (Hn1) depletion in B16.F10 melanoma cells promotes a differentiated phenotype that includes increased melanogenesis and cell cycle arrest. Differentiation. 2009;78:35–44. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Lu KH, Patterson AP, Wang L, Marquez RT, Atkinson EN, Baggerly KA, et al. Selection of potential markers for epithelial ovarian cancer with gene expression arrays and recursive descent partition analysis. Clin Cancer Res. 2004;10:3291–3300. [DOI] [PubMed] [Google Scholar]
  • 7. Varisli L, Gonen‐Korkmaz C, Debelec‐Butuner B, Erbaykent‐Tepedelen B, Muhammed HS, Bogurcu N, et al. Ubiquitously expressed hematological and neurological expressed 1 downregulates Akt‐mediated GSK3β signaling, and its knockdown results in deregulated G2/M transition in prostate cells. DNA Cell Biol. 2011;30:419–429. [DOI] [PubMed] [Google Scholar]
  • 8. Zhang ZG, Chen WX, Wu YH, Liang HF, Zhang BX. MiR‐132 prohibits proliferation, invasion, migration, and metastasis in breast cancer by targeting HN1. Biochem Biophys Res Commun. 2014;454:109–114. [DOI] [PubMed] [Google Scholar]
  • 9. Varisli L, Ozturk BE, Akyuz GK, Korkmaz KS. HN1 negatively influences the β‐catenin/E‐cadherin interaction, and contributes to migration in prostate cells. J Cell Biochem. 2015;116:170–178. [DOI] [PubMed] [Google Scholar]
  • 10. Nault JC, De Reyniès A, Villanueva A, Calderaro J, Rebouissou S, Couchy G, et al. A hepatocellular carcinoma 5‐gene score associated with survival of patients after liver resection. Gastroenterology. 2013;145:176–187. [DOI] [PubMed] [Google Scholar]
  • 11. Hou GX, Liu PP, Yang J, Wen SJ. Mining expression and prognosis of topoisomerase isoforms in non‐small‐cell lung cancer by using Oncomine and Kaplan‐Meier plotter. PLoS One. 2017;12:e0174515. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Huang NQ, Wu ZL, Hong H, Wang XM, Yang FQ, Li HG. Overexpression of CKS2 is associated with a poor prognosis and promotes cell proliferation and invasion in breast cancer. Mol Med Rep. 2019;19:4761–4769. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Wang F, Hu YL, Feng Y, Guo YB, Liu YF, Mao QS, et al. High‐level expression of PRSS3 correlates with metastasis and poor prognosis in patients with gastric cancer. J Surg Oncol. 2019;119:1108–1121. [DOI] [PubMed] [Google Scholar]
  • 14. Bouraoui Y, Achour M, Royuela M, Oueslati R. Immune profiling of human prostate epithelial cells determined by expression of p38/TRAF‐6/ERK MAP kinases pathways. Kaohsiung J Med Sci. 2018;34(3):125–133. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Voigt S, Philipp S, Davarnia P, Winoto‐Morbach S, Röder C, Arenz C, et al. TRAIL‐induced programmed necrosis as a novel approach to eliminate tumor cells. BMC Cancer. 2014;14:74. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Wang YL, Liu JY, Yang JE, Yu XM, Chen ZL, Chen YJ, et al. Lnc‐UCID promotes G1/S transition and hepatoma growth by preventing DHX9‐mediated CDK6 Down‐regulation. Hepatology. 2019;70(1):259–275. 10.1002/hep.30613. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Goyal L, Muzumdar MD, Zhu AX. Targeting the HGF/c‐MET pathway in hepatocellular carcinoma. Clin Cancer Res. 2013;19:2310–2318. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Bouattour M, Raymond E, Qin S, Cheng AL, Stammberger U, Locatelli G, et al. Recent developments of c‐met as a therapeutic target in hepatocellular carcinoma. Hepatology. 2018;67:1132–1149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Hu CT, Wu JR, Cheng CC, Wu WS. The therapeutic targeting of HGF/c‐met Signaling in hepatocellular carcinoma: Alternative approaches. Cancers (Basel). 2017;9:58. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Connell‐Crowley L, Elledge SJ, Harper JW. G1 cyclin‐dependent kinases are sufficient to initiate DNA synthesis in quiescent human fibroblasts. Curr Biol. 1998;8:65–68. [DOI] [PubMed] [Google Scholar]
  • 21. Elledge SJ, Winston J, Harper JW. A question of balance: The role of cyclin‐kinase inhibitors in development and tumorigenesis. Trends Cell Biol. 1996;6:388–392. [DOI] [PubMed] [Google Scholar]
  • 22. Harper JW, Elledge SJ. Cdk inhibitors in development and cancer. Curr Opin Genet Dev. 1996;6:56–64. [DOI] [PubMed] [Google Scholar]
  • 23. Ogunwobi OO, Wang T, Zhang L, Liu C. Cyclooxygenase‐2 and akt mediate multiple growth‐factor‐induced epithelial‐mesenchymal transition in human hepatocellular carcinoma. J Gastroenterol Hepatol. 2008;27:566–578. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Xie B, Xing RX, Chen P, Gou YB, Li S, Xiao J, et al. Down‐regulation of c‐met expression inhibits human HCC cells growth and invasion by RNA interference. J Surg Res. 2010;162:231–238. [DOI] [PubMed] [Google Scholar]
  • 25. Garajova I, Giovannetti E, Biasco G, Peters GJ. C‐met as a target for personalized therapy. Transl Oncogenomics. 2015;7(Suppl. 1):13–31. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 26. Eder JP, Vande Woude GF, Boerner SA, LoRusso PM. Novel therapeutic inhibitors of the c‐met signaling pathway in cancer. Clin Cancer Res. 2009;15:2207–2214. [DOI] [PubMed] [Google Scholar]
  • 27. Zeng Q, Chen S, You Z, Yang F, Carey TE, Saims D, et al. Hepatocyte growth factor inhibits anoikis in head and neck squamous cell carcinoma cells by activation of ERK and Akt signaling independent of NFkappa B. J Biol Chem. 2002;277:25203–25208. [DOI] [PubMed] [Google Scholar]
  • 28. Lee KH, Hyun MS, Kim JR. Growth factor‐dependent activation of the MAPK pathway in human pancreatic cancer: MEK/ERK and p38 MAP kinase interaction in uPA synthesis. Clin Exp Metastasis. 2003;20:499–505. [DOI] [PubMed] [Google Scholar]
  • 29. İşcan E, Güneş A, Korhan P, Yılmaz Y, Erdal E, Atabey N. The regulatory role of heparin on c‐met signaling in hepatocellular carcinoma cells. J Cell Commun Signal. 2017;11:155–166. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 30. Cheng J, Wu LM, Deng XS, Wu J, Lv Z, Zhao HF, et al. MicroRNA‐449a suppresses hepatocellular carcinoma cell growth via G1 phase arrest and the HGF/MET c‐met pathway. Hepatobiliary Pancreat Dis Int. 2018;17:336–344. [DOI] [PubMed] [Google Scholar]
  • 31. Parachoniak CA, Luo Y, Abella JV, Keen JH, Park M. GGA3 functions as a switch to promote met receptor recycling, essential for sustained ERK and cell migration. Dev Cell. 2011;20:751–763. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32. Clague MJ. Met receptor: A moving target. Sci Signal. 2011;4:pe40. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES