The role of calcium‐sensitive receptor in ovalbumin‐induced airway inflammation and hyperresponsiveness in juvenile mice with asthma

Abstract

The role of the calcium‐sensitive receptor (CaSR) was assessed in a juvenile mouse model of asthma induced by ovalbumin (OVA). The experiment was divided into normal control, OVA, and OVA +2.5/5 mg/kg NPS2143 (a CaSR antagonist) groups. OVA induction was performed in all groups except the normal control, followed by assessing airway hyperresponsiveness (AHR) and lung pathological changes. Serum OVA‐specific IgE and IgG1 were detected with an enzyme‐linked immunosorbent assay (ELISA), and inflammatory cells were counted in bronchoalveolar lavage fluid (BALF). Real‐time quantitative polymerase chain reaction, ELISA, and western blotting were performed to detect gene and protein expression. NPS2143 improved the OVA‐induced AHR in mice, and AHR was higher in the OVA +2.5 mg/kg NPS2143 group than in the OVA +5 mg/kg NPS2143 group. Furthermore, NPS2143 reduced the production of OVA‐specific IgE and IgG1 in serum and the number of eosinophils and lymphocytes in BALF in OVA mice with reduced CaSR expression in lung tissues. Besides, OVA‐induced mice exhibited peribronchial and perivascular inflammatory cell infiltration, which was accompanied by severe goblet cell hyperplasia/hyperplasia and airway mucus hypersecretion. Furthermore, these mice exhibited increased levels of Interleukin (IL)‐5, IL‐13, MCP‐1, and eotaxin, which were alleviated by NPS2143. The 5 mg/kg NPS2143 showed more effective than the 2.5 mg/kg treatment. CaSR expression was elevated in the lung tissues of OVA‐induced asthmatic juvenile mice, whereas the CaSR antagonist NPS2143 reduced AHR and attenuated the inflammatory response in OVA‐induced juvenile mice, possibly exerting therapeutic effects on childhood asthma.

1. INTRODUCTION

Bronchial asthma is the most common and frequent chronic respiratory disease, particularly during childhood, ¹ and is a chronic inflammatory disease of the airways involving various cells, including eosinophils, lymphocytes, neutrophils, mast cells, and structural cells, as well as cellular components. ² Asthma is characterized by variable airflow obstruction, airway hyperresponsiveness (AHR), and airway inflammation due to exposure to multiple airway irritants, ³ which can be controlled by medication but have not yet been completely cured. To date, the pathogenesis of asthma remains incompletely understood. ⁴ Therefore, investigating the pathogenesis and identifying new and effective therapeutic targets is of great clinical significance.

The calcium‐sensing receptor (CaSR), a G protein‐coupled receptor, ⁵ was first extracted from bovine parathyroid cells by Brown et al. ⁶ It was also obtained from human parathyroid glands by Garrett et al. ⁷ and plays important role in the homeostasis of extracellular Ca²⁺ concentrations. CaSR is widely distributed in the parathyroid glands, gastrointestinal tract, skin, brain, bone, heart, and immune cells. ⁸ At present, CaSR is known to be expressed in embryonic interstitial lungs ⁹ and thought to be involved in AHR in neonatal mice induced by noninvasive continuous positive airway pressure ventilation. ¹⁰ Moreover, CaSR promotes the proliferation of airway smooth muscle cells (ASMCs) to further trigger AHR, thus participating in the development of adult asthma. ¹¹ , ¹² However, the involvement of CaSR in childhood asthma is unknown, prompting us to perform this in vivo study. Experimental animals, especially mice or rats, have been extensively used to prepare bronchial asthmatic mice, and BALB/c mice are the most commonly used mice for this purpose. ¹³ To this end, 4‐week‐old BALB/c female mice were sensitized and challenged with ovalbumin (OVA) to construct the asthma model, as described previously. ¹⁴

NPS‐2143, also known as SB262470, has the chemical formula C₂₄H₂₅ClN₂O₂ and is accepted as a novel and potent selective calcium‐sensitive receptor antagonist. ¹⁵ It has been found to exert therapeutic effects in various animal models of disease; for example, NPS‐2143 was reported to significantly attenuate NH4CL‐induced hypercalciuria and hypomagnesuria in mice with chronic metabolic acidosis. ¹⁶ Additionally, NPS‐2143 was shown to improve neurological deterioration, cerebral edema, and neurodegeneration in mice with intravascular perforation, ¹⁷ which also attenuated hypoxic pulmonary vasoconstriction in an isolated perfused/ventilated mouse lung. ¹⁸ More importantly, Lee et al. ¹⁹ found that NPS2143 (2.5 mg/kg and 5 mg/kg) inhibited lipopolysaccharide‐induced pulmonary inflammation in mice by decreasing the levels of neutrophil elastase in the bronchoalveolar lavage fluid (BALF), reducing the production of proinflammatory cytokines in the BALF and serum, and suppressing the activation of nuclear factor‐kappa B (NF‐κB). Therefore, in this study, we orally administered 2.5 or 5 mg/kg NPS‐2143 to OVA‐induced juvenile mice to investigate the role of CaSR in OVA‐induced airway inflammation and AHR in asthmatic juvenile mice.

2. MATERIALS AND METHODS

2.1. Ethical statement

This study complied with the Guide for the Care and Use of Laboratory Animals, ²⁰ and all animal experimental operations were performed under the supervision of the Medical Laboratory Animal Ethics Committee of our hospital.

2.2. Experimental animals

A total of 80 female pathogen‐free (SPF) BALB/c juvenile mice (4 weeks old) were purchased from the Institute of Laboratory Animals Science. These mice were given access to tap water and standard laboratory chow ad libitum and exposed to a 12‐h light/dark cycle with a regulated room temperature of 20 ± 2°C and a relative humidity of 40%–60%.

2.3. Establishment of a juvenile mouse model of asthma

The mice were randomly divided into the normal control group, OVA group, OVA +2.5 mg/kg NPS2143 group, and OVA +5 mg/kg NPS2143 group, with 20 mice per group. OVA challenge was performed in all groups except the normal control group. Briefly, on the first day, mice under isoflurane (Sigma–Aldrich, St. Louis, Missouri) anesthesia were intraperitoneally injected with Hanks' Balanced Salt Solution (HBSS; Sigma–Aldrich, St. Louis, Missouri) containing 10 μg egg OVA (Sigma–Aldrich, St. Louis, Missouri) and 1 mg Al(OH)₃ (Sigma–Aldrich, St. Louis, Missouri). On the 14th day, mice were again injected intraperitoneally with 10 μg OVA, followed by intranasal dripping of HBSS (35 μl) containing 10 μg OVA on Days 21, 22, and 23. ¹⁴ Then, 2.5 or 5 mg/kg NPS‐2143 (a CaSR antagonist; purity: 99.47%; Selleck, China) was dissolved in phosphate‐buffered saline (PBS) with 0.5% dimethyl sulfoxide (Merck, China). ¹⁹ Juvenile mice in the treatment groups (OVA +2.5 mg/kg NPS2143 group and OVA +5 mg/kg NPS2143 group) were orally administered NPS‐2143 three times per week for 4 weeks (from Days 1 to 27). ²¹ On Day 28, half of the mice from each group (10 mice per group) were assessed for AHR based on enhanced pause (P _enh) values. The remaining juvenile mice were sacrificed, and BALF, blood samples, and lung tissue samples were collected for subsequent experiments. The experimental procedure is shown in Figure 1A.

FIGURE 1.

Comparison of airway responsiveness among groups of juvenile mice. (A) The experimental flow chart of this study. (B) The P _enh values assessed the airway hyperresponsiveness (AHR) of mice in each group. When compared with normal control group, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001; compared with ovalbumin (OVA) group, ^& p < 0.05, ^&& p < 0.01, ^&&& p < 0.005, ^&&&& p < 0.001; compared with OVA +2.5 mg/kg NPS2143 group, ^# p < 0.05, ^## p < 0.01, ^### p < 0.005, ^#### p < 0.001

2.4. AHR testing

Bronchoconstriction was stimulated by the gradient inhalation of acetylcholine (Methacholine, Mch, Merck, China), and a whole‐body plethysmography system (BUXCO, Winchester, UK) was used to detect and record changes in the airway resistance, P _enh, during excitation. After measuring the baseline P _enh, increasing concentrations of methacholine (Mch, 6, 12, 25, 50 mg/ml) were nebulized in the test chamber for 3 min through an inlet, and the P _enh values for each dose were then collected for 5 min.

2.5. Measurements of OVA‐specific IgE and OVA‐specific IgG1 in serum

An enzyme‐linked immunosorbent assay (ELISA) assay was performed to detect the serum production of OVA‐specific IgE and OVA‐specific IgG1. Briefly, 96‐well microtiter plates were coated with 100 μl of OVA (10 μg/ml for IgE Ab and 1 μg/ml for IgG1 Ab) dissolved in PBS‐Tween 20 (PBST). The samples were then incubated for 2 h after washing the plate, followed by the addition of horseradish peroxidase (HRP)‐conjugated goat antimouse IgE and IgG1 antibodies. O‐phenylenediamine dihydrochloride (200 μl, Sigma–Aldrich, St. Louis, Missouri) was added to each well for 10 min in the dark after the plates were washed four times with PBST. Finally, the absorbance of the plate was measured using a microplate ELISA reader (450 nm, Bio‐Rad Laboratories, California), and the concentrations of OVA‐specific IgE and OVA‐specific IgG1 were calculated from a standard curve using 250 ng/ml recombinant IgE and IgG1.

2.6. Cell counting in BALF

Ice‐cold PBS was infused into the lung and withdrawn via tracheal cannulation three times to obtain BALF, which was centrifuged (700 rpm, 10 min) onto slides using a Shandon Cytofunnels (Thermo Fisher Scientific, Rockford, Illinois) to determine differential cell counts (eosinophils, lymphocytes, and neutrophils). After the slides were dried, the cells were fixed and stained using Giemsa (Sigma–Aldrich, St. Louis, Missouri) followed by examination with microscopy (Keyence, China). The supernatant was collected and stored at −70°C prior to ELISA analysis.

2.7. Measurements of inflammatory factors and chemokines in lung tissue

Identical portions of the lung tissues were snap frozen in liquid nitrogen and stored at −80°C for ELISA analysis. After thawing, the tissues were homogenized, and supernatant fluids were harvested. ELISA was also used to detect the following expression levels in lung tissue and BALF, including IL‐5 (sensitivity: 3.3 pg/ml; range: 7.8–500 pg/ml, catalog no. BMS610), IL‐13 (sensitivity: <2 pg/ml; range: 3.9–250 pg/ml, catalog no. KMC2221), monocyte chemoattractant protein‐1 (MCP‐1) (sensitivity: 2.2 pg/ml; range: 15.6–1000 pg/ml, catalog no. BMS6005), and eotaxin (sensitivity: 3.6 pg/ml; range: 31.3–2000 pg/ml, catalog no. BMS6008). Reagent kits were purchased from Invitrogen (USA). The levels of inflammatory factors and chemokines in homogenized lung tissues were normalized by the tissue weight for each group of mice.

2.8. Lung histopathological staining

Lungs were immersed in neutral buffered formalin (10%), and 5‐μm thick sections were stained with hematoxylin and eosin (HE) or Periodic Acid Schiff (PAS). HE staining: the lung tissue was dewaxed in xylene, dehydrated in gradient alcohol, successively rinsed fully in tap water and ultrapure water for 2 min, placed in hematoxylin for staining for 8 min, removed, and then washed with water for 2 min. Alcohol with 1% hydrochloric acid was used to differentiate for 30 s, and the slides were then rinsed continuously with running water for 20 min after being stained with antiblue. The slides were soaked in ultrapure water for 5 min, soaked in 75% alcohol for 5 min, and then stained in 0.5% eosin solution for 5 min. The slides were then conventionally dehydrated with incremental concentrations of alcohol, soaked in xylene for 12 min for transparent treatment, and finally sealed with neutral gum. Mucus and mucus‐containing goblet cells in the bronchial epithelium were stained with PAS. The lung tissues were dewaxed in water, oxidized with 0.5% periodate for 10 min, washed with distilled water for 10 min, added to Schiff's reagent for 30 min, washed with tap water for 10 min, stained with hematoxylin for 5 min, fractionated with hydrochloric acid for 5 s, rinsed with running water, dehydrated with gradient alcohol, cleared with xylene, and sealed with neutral gum. Pathological changes in the airways of each group of young mice after HE and PAS staining were observed under a high‐magnification field with an optical microscope and scored (Table 1).

TABLE 1.

Histopathological staining scores of lungs in each group

Grade	Inflammatory infiltration (HE staining)	Goblet cells (PAS staining)
0	No inflammatory infiltration	<5%
1	One or two minimal foci of perivascular and peribronchial infiltration	5%–15%
2	Three to six foci of perivascular and peribronchial infiltration	15%–30%
3	Multiple foci of perivascular and peribronchial infiltration, many of which formed multilayered cuffs	30%–50%
4	Multiple multilayered dense inflammatory infiltrates, primarily affecting the central parts of the lungs	>50%
5	Same as Grade 4 but more extensive by affecting both central and peripheral parts of the lungs	—

Abbreviation: HE, hematoxylin and eosin; PAS, Periodic Acid Schiff.

2.9. Real‐time quantitative polymerase chain reaction

The lung tissue was placed in a homogenizer treated with high temperature and pressure and well‐milled in the homogenizer. TRIzol™ Reagent (Invitrogen, USA) was used to extract total RNA. A High‐capacity cDNA Reverse Transcription Kit (Applied Biosystems, USA) was used to reverse transcribe RNA into cDNA. Quantitative polymerase chain reaction (qPCR) was conducted with the PowerUp SYBR Green PCR Master Mix (Applied Biosystems, USA) in the StepOnePlus™ Real‐Time PCR System (Applied Biosystems, USA). The appropriate amount of cDNA was used as the template for PCR, and the Primer 5.0 software was used to design primers (Table 2). The expression level of each gene was calculated using the 2^−△△Ct formula using Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) as a reference gene.

TABLE 2.

Real‐time qPCR primers used in this study

Gene	GenBank accession	Primers (5′‐3′)
CaSR	NM_013803	Forward: AGCAGGTGACCTTCGATGAGT
		Reverse: ACTTCCTTGAACACAATGGAGC
IL‐5	NM_010558	Forward: CTCTGTTGACAAGCAATGAGACG
		Reverse: TCTTCAGTATGTCTAGCCCCTG
IL‐13	NM_008355	Forward: CCTGGCTCTTGCTTGCCTT
		Reverse: GGTCTTGTGTGATGTTGCTCA
MCP‐1	NM_011333	Forward: TTAAAAACCTGGATCGGAACCAA
		Reverse: GCATTAGCTTCAGATTTACGGGT
Eotaxin	NM_011330	Forward: GAATCACCAACAACAGATGCAC
		Reverse: ATCCTGGACCCACTTCTTCTT
GAPDH	NM_008084	Forward: AGGTCGGTGTGAACGGATTTG
		Reverse: TGTAGACCATGTAGTTGAGGTCA

Abbreviation: GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; MCP‐1, monocyte chemoattractant protein‐1; qPCR, quantitative polymerase chain reaction.

2.10. Western blotting

Juvenile mouse lung tissues were placed in 2 ml of prechilled PBS solution (pH 7.4). The cell suspensions were then lysed by ultrasound, and the total protein concentration of the supernatant was determined with the Bradford method. Subsequently, the total protein concentration was adjusted to be the same for each sample. The protein was separated with 7.5% sodium dodecyl sulfate–polyacrylamide gel electrophoresis (SDS–PAGE) and transferred to a polyvinylidene fluoride (PVDF) membrane. After being transferred, blocked with skimmed milk powder and washed with PBS with 0.5% Tween 20 (PBST) buffer at room temperature, the PVDF membranes were hybridized at room temperature for 1 h with rabbit antimouse monoclonal anti‐CaSR antibody (ab137408) at a 1/1000 dilution and anti‐β‐actin antibody (ab8227) at 1 μg/ml (both purchased from Abcam, UK) before being washed five times with PBST buffer for 3 min each. Then, goat antirabbit IgG H&L (HRP) at a 1/50,000 dilution was used. The β‐actin protein was used as the loading control. The ratio of target protein/β‐actin grayscale value was used as the relative content of the measured target protein.

2.11. Statistical method

SPSS 21.0 statistical software (SPSS, Inc., Chicago, Illinois) was used to analyze the data. The data are presented as the means ± SD. Differences among multiple groups were compared using two‐way or one‐way analysis of variance (ANOVA), and pairwise comparisons between groups were conducted with Tukey's honestly significant difference (HSD) test. The difference was considered significant when p < 0.05.

3. RESULTS

3.1. Comparison of airway responsiveness among groups

As shown in Figure 1B, the P _enh at 6 mg/ml Mch in the juvenile mice on Day 28 did not differ between the normal control and OVA +5 mg/kg NPS2143 groups, the OVA and OVA +2.5 mg/kg NPS2143 groups, or the OVA +2.5 mg/kg NPS2143 and OVA +5 mg/kg NPS2143 groups (all p > 0.05). After administration of 12, 20, and 50 mg/ml Mch, the juvenile mice in the OVA group showed a significant increase in P _enh compared with the normal control group (all p < 0.001); moreover, the P _enh in the OVA +2.5 mg/kg NPS2143 group was higher than that in the OVA +5 mg/kg NPS2143 group but lower than that in the OVA group (all p < 0.05).

3.2. Comparison of serum OVA‐specific IgE and IgG1 production among groups

According to the ELISA analysis (Figure 2), the serum OVA‐specific IgE and IgG1 production were significantly higher in the OVA group than in the normal control group (all p < 0.001), and these levels were significantly decreased in mice treated with either 2.5 or 5 mg/kg NPS‐2143 when compared with the OVA group; specifically, the effect of 5 mg/kg NPS‐2143 was more significant (all p < 0.001).

FIGURE 2.

Serum ovalbumin (OVA)‐specific IgE (A) and IgG1 (B) production in each group detected by enzyme‐linked immunosorbent assay. The data are presented as the mean ± SD (10 mice per group). Differences among multiple groups were compared with a one‐way ANOVA, and pairwise comparisons between groups were conducted with Tukey's HSD test. When compared with normal control group, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001; compared with OVA group, ^& p < 0.05, ^&& p < 0.01, ^&&& p < 0.005, ^&&&& p < 0.001; compared with OVA +2.5 mg/kg NPS2143 group, ^# p < 0.05, ^## p < 0.01, ^### p < 0.005, ^#### p < 0.001

3.3. Comparison of lymphocytes, eosinophils, and neutrophils in BALF among groups

The number of inflammatory cells, including lymphocytes, eosinophils, and neutrophils, in the BALF of each group was compared, and the results demonstrated (Figure 3) an increased number of lymphocytes, eosinophils, and neutrophils in the OVA group compared with the normal control group (all p < 0.001). However, the numbers of lymphocytes, eosinophils, and neutrophils were lower in the OVA +2.5 mg/kg NPS2143 group than in the OVA group and lower in the OVA +5 mg/kg NPS2143 group than in the OVA +2.5 mg/kg NPS2143 group (all p < 0.001).

FIGURE 3.

Comparison of lymphocytes (A), eosinophils (B), and neutrophils (C) in the bronchoalveolar lavage fluid (BALF) of mice in each group. The data are presented as the mean ± SD (10 mice per group). Differences among multiple groups were compared with a one‐way ANOVA, and pairwise comparisons between groups were conducted with Tukey's HSD test. When compared with normal control group, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001; compared with ovalbumin (OVA) group, ^& p < 0.05, ^&& p < 0.01, ^&&& p < 0.005, ^&&&& p < 0.001; compared with OVA +2.5 mg/kg NPS2143 group, ^# p < 0.05, ^## p < 0.01, ^### p < 0.005, ^#### p < 0.001

3.4. Comparison of CaSR expression in lung tissues among groups

As determined by qPCR and western blotting, CaSR gene and protein expression were significantly increased in the lung tissues of juvenile mice in the OVA group compared with the normal control group (all p < 0.001). However, NPS2143 significantly decreased the expression of the CaSR gene and protein in the OVA‐induced lung tissues of juvenile mice (all p < 0.001, Figure 4).

FIGURE 4.

Comparison of calcium‐sensitive receptor (CaSR) expression in the lung tissue of juvenile mice in each group. (A) CaSR gene expression in the lung tissues of juvenile mice measured by quantitative polymerase chain reaction. (B,C) CaSR protein expression in the lung tissues of juvenile mice measured by western blotting. The data are presented as the means ± SDs (10 mice per group). Differences among multiple groups were compared with a one‐way ANOVA, and pairwise comparisons between groups were conducted with Tukey's HSD test. Compared with normal control group, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001; compared with ovalbumin (OVA) group, ^& p < 0.05, ^&& p < 0.01, ^&&& p < 0.005, ^&&&& p < 0.001; compared with OVA +2.5 mg/kg NPS2143 group, ^# P < 0.05, ^## p < 0.01, ^### p < 0.005, ^#### p < 0.001

3.5. Pathological changes in lung tissues in juvenile mice

HE and PAS staining showed that OVA‐treated mice exhibited marked peribronchial and perivascular inflammatory cell infiltration, accompanied by severe goblet cell hyperplasia/hyperplasia and airway mucus hypersecretion (Figure 5A). NPS2143 treatment significantly improved these pathological conditions. The quantitative results showed (Figure 5B–D) that the peribronchial and perivascular inflammatory scores of lung tissues were significantly higher in the OVA group than in the normal control group, accompanied by a significant increase in PAS‐positive cells (all p < 0.001). The lung tissue inflammation scores and PAS‐positive cells were significantly reduced in both the OVA +2.5 mg/kg NPS2143 and OVA +5 mg/kg NPS2143 groups compared with the OVA group, and this reduction was more significant in the OVA +5 mg/kg NPS2143 group (all p < 0.05).

FIGURE 5.

The pathological changes in the lung tissues of juvenile mice in each group (×200). (A) Hematoxylin and eosin (HE) staining showed inflammatory cell infiltration (B, bronchioles; BV, blood vessels; arrows mark peribronchial and perivascular inflammatory cell infiltrations), and Periodic Acid Schiff (PAS) staining showed goblet cell proliferation (arrow marked PAS‐positive cells); (B,C) The perivascular and peribronchial inflammation score in the lung tissues of mice. (D) The comparison of PAS‐positive cells in the lung tissues of mice. The data are presented as the means ± SDs (10 mice per group). Differences among multiple groups were compared with a one‐way ANOVA, and pairwise comparisons between groups were conducted with Tukey's HSD test. Compared with normal control group, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001; compared with ovalbumin (OVA) group, ^& p < 0.05, ^&& p < 0.01, ^&&& p < 0.005, ^&&&& p < 0.001; compared with OVA +2.5 mg/kg NPS2143 group, ^# p < 0.05, ^## p < 0.01, ^### p < 0.005, ^#### p < 0.001

3.6. Comparison of inflammatory factors and chemokines among groups

The expression levels of IL‐5, IL‐13, MCP‐1, and eotaxin in lung tissues and BALF were detected with ELISA (Figure 6A,B). These factors were all significantly upregulated in the OVA‐induced lung tissues of juvenile mice compared with the normal control group (all p < 0.001), but NPS‐2143 treatment downregulated these levels to some extent (all p < 0.05). The degree of reduction was more pronounced in mice treated with 5 mg/kg NPS2143, and specifically, the levels of IL‐5, IL‐13, MCP‐1, and eotaxin in the lung tissues of juvenile mice were significantly lower in the OVA +5 mg/kg NPS2143 group than in the OVA +2.5 mg/kg NPS2143 group (all p < 0.05). The expression of the abovementioned genes in lung tissues, as determined by qPCR, was found to be consistent with the trends in protein expression (Figure 6C).

FIGURE 6.

Comparison of inflammatory factors and chemokines in the lung tissues and bronchoalveolar lavage fluid (BALF) of juvenile mice in each group The protein and gene expression levels of IL‐5, IL‐13, MCP‐1, and eotaxin in the lung tissues (A,C) and BALF (B) of juvenile mice were measured by enzyme‐linked immunosorbent assay and quantitative polymerase chain reaction. The data are presented as the means ± SDs (10 mice per group). Differences among multiple groups were compared with a one‐way ANOVA, and pairwise comparisons between groups were conducted with Tukey's HSD test. Compared with the normal control group, *p < 0.05, **p < 0.01, ***p < 0.005, ****p < 0.001; compared with the OVA group, ^& p < 0.05, ^&& p < 0.01, ^&&& p < 0.005, ^&&&& p < 0.001; compared with the OVA +2.5 mg/kg NPS2143 group, ^# p < 0.05, ^## p < 0.01, ^### p < 0.005, ^#### p < 0.001

4. DISCUSSION

In this study, OVA was used to sensitize juvenile mice, and the nebulized inhalation of OVA was used to induce an asthma attack. This model mimics the characteristics of acute asthma, including eosinophil infiltration, mucus hypersecretion, airway remodeling, and AHR, ¹³ and the above phenomena were indeed found in OVA juvenile mice, indicating the successful establishment of the mouse model.

As reported in numerous studies, CaSR is important in bone and mineral metabolism and can regulate parathyroid hormone secretion, urinary Ca²⁺ excretion, bone development, and lactation. However, it is also expressed in organs not involved in Ca²⁺ homeostasis, such as the lung. ²² Considerable evidence has shown that CaSR is aberrantly expressed in various lung‐related diseases; for instance, CaSR expression is significantly higher in lung cancer tissues than in paracancerous and normal lung tissues, and it is more significantly elevated in patients with bone metastases. ²³ Additionally, the CaSR mRNA and protein expression levels were observed to be significantly elevated in the lung tissues of mice with pulmonary hypertension, ²⁴ whereas the overall knockdown or lung‐specific knockdown of CaSR significantly attenuated phenylalanine‐induced pulmonary hypertension. ¹² By regulating airflow by constricting or relaxing airways, ASMCs were demonstrated to be involved in overproliferation in response to various factors, such as growth factors, cytokine inflammatory mediators, and enzymes, and to participate in airway remodeling, thereby exacerbating asthma. ²⁵ Previous studies have found that increased airway CaSR expression in neonatal mice after CPAP was associated with a long‐term increase in airway responsiveness. ¹⁰ In addition, Yarova et al. ¹¹ found that CaSR was elevated in human (ages ranged from 40 to 80 years) and mouse (6‐week to 8‐week‐old C57/Bl6 mice) asthmatic ASMC, which may be caused by inflammatory cationic proteins correlated with asthma severity. Indeed, we showed that the CaSR gene and protein expression levels were significantly elevated in the lung tissues of OVA‐treated pups (4 weeks old). Together, these results strongly suggest that CaSR may be a therapeutic target in airway inflammation‐related diseases in infants, children, and adults.

AHR is a characteristic feature of asthma that correlates with the severity of the condition. ²⁶ A study found that inhaled CaSR negative allosteric modulators are likely safe and effective topical therapy for human asthma that works by abolishing AHR. ²⁷ Moreover, the intranasal administration of an antagonist to CaSR in mice reversed the effects of Br₂ on AHR. ²⁸ Consistent with these findings, we showed that NPS2143 also significantly reduced the P _enh values in OVA‐induced juvenile mice, showing a correlation with airway resistance measured using standard evaluation methods in BALB/c mice. ²⁹ Notably, NPS2143 was found to significantly inhibit MUC5AC expression in cigarette smoke extract (CSE)‐stimulated human airway epithelial NCI‐H292 cells. ³⁰ Moreover, the mucus hypersecretion state was associated with MUC5AC expression levels during AHR, and its abnormally high expression was associated with the progression of asthma in young mice. ³¹ As analyzed by our PAS staining, we also found that the lung tissues of OVA‐induced juvenile mice showed reduced mRNA and protein expression levels of CaSR, severe goblet cell hyperplasia/hyperplasia, and airway mucus hypersecretion, but this phenomenon was ameliorated by 2.5/5 mg/kg NPS2143, which was reported to act on CaSR in a stereoselective manner. ³² Consistently, Yasukawa et al. ³³ found that the mineral trioxide aggregate‐induced gene and protein levels of CaSR in murine MC3T3‐E1 cells decreased to control levels in response to NPS2143. Furthermore, a previous study reported by Schepelmann et al. ³⁴ also revealed that NPS2143 affected the expression of CaSR at both the RNA and protein levels in a highly enantiospecific manner, indicating that CaSR gene expression was directly induced by CaSR itself. The above findings indicated that the CaSR antagonist NPS2143 can significantly control AHR in OVA‐induced juvenile mice to play a therapeutic role in childhood asthma.

Airway inflammation is one of the most important mechanisms leading to AHR. ³⁵ A large number of studies have focused on the inflammatory process of asthma progression, and some targets, including IgE, IgG1, IL‐5, and IL‐13, are credited as key factors that drive or promote airway inflammation. ³⁶ Growing evidence has shown that CaSR is closely associated with inflammation‐related diseases, ³⁷ which may initiate the onset and development of airway inflammation. In our study, NPS‐2143 treatment also improved peribronchial and perivascular inflammation in the lung tissue of OVA juvenile mice and reduced serum OVA‐specific IgE and IgG1 production and the number of eosinophils and lymphocytes in BALF. In addition, Lee et al. ¹⁹ found that NPS‐2143 pretreatment significantly inhibited the LPS‐induced influx of inflammatory cells and MCP‐1 expression in the lung tissues of acute lung injury mice, which also reduced CSE‐stimulated proinflammatory cytokine release from NCI‐H292 cells. ³⁰ Studies have reported that Th2 cytokines and chemokines play a key role in the development of allergic airway inflammation. ³⁸ The BALF eosinophil pattern was followed by Th2 cytokines (IL‐5 and IL‐13), regulating eosinophil inflammation and AHR. ¹⁴ In our study, the levels of OVA‐induced IL‐5 and IL‐13 and chemokines (MCP‐1 and eotaxin) ³⁹ were significantly upregulated in the lung tissue and BALF of juvenile mice, but NPS‐2143 treatment downregulated, these levels to some extent. This effect was more significant in mice treated with 5 mg/kg NPS2143, indicating that NPS2143 improved OVA‐induced inflammation in juvenile mice. However, this study was also subject to limitations. First, because CaSR is widely expressed in various organs and controls the homeostasis of extracellular Ca²⁺ concentration, ⁴⁰ the Ca²⁺ levels would need to be determined in NPS‐2143‐treated mice. Second, the physiological parameters in NPS2143‐treated mice should be measured before sacrifice to reflect the health status. Last, further clinical studies are required to clarify the role and efficacy of NPS2143 in childhood asthma.

In summary, CaSR was increased in the OVA‐induced lung tissue of juvenile mice, whereas its antagonist NPS2143 improved AHR and reduced the inflammatory response in these mice. Thus, this compound may have potential therapeutic applications in childhood asthma.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Xiang Z‐Y, Tao D‐D. The role of calcium‐sensitive receptor in ovalbumin‐induced airway inflammation and hyperresponsiveness in juvenile mice with asthma. Kaohsiung J Med Sci. 2022;38(12):1203–1212. 10.1002/kjm2.12601