High‐concentration atropine induces corneal epithelial cell apoptosis via miR‐30c‐1/SOCS3

Abstract

Atropine is an anticholinergic drug widely used in the field of ophthalmology, but its abuse can cause cytotoxicity to the cornea, resulting in blurred vision. This study used cultured human corneal epithelial cells (HCECs) to investigate the mechanism of high‐concentration atropine‐induced cytotoxicity. HCECs were treated with different concentrations of atropine. The expression levels of microRNA (miR)‐30c‐1 and suppressor of cytokine signaling 3 (SOCS3) were manipulated in HCECs treated with 0.1% atropine. Cell counting kit‐8 assay and flow cytometry were used to assess the viability and apoptosis of HCECs. The relationship between miR‐30c‐1 and SOCS3 was obtained from an online database and validated using a dual‐luciferase reporter assay and RNA immunoprecipitation method. The effect of atropine on the Janus kinase 2 (JAK2)/signal transducer and activator of transcription 3 (STAT3) signaling pathway was also investigated. High‐concentration atropine inhibited the viability of HCECs and promoted their apoptosis. Moreover, atropine reduced miR‐30c‐1 expression and increased SOCS3 expression in a dose‐dependent manner. It was found that miR‐30c‐1 targeted SOCS3. Overexpression of miR‐30c‐1‐reduced atropine‐induced HCEC cytotoxicity, whereas upregulation of SOCS3 reversed the effects of miR‐30c‐1 overexpression. High‐concentration atropine inhibited activation of the JAK2/STAT3 signaling pathway via miR‐30c‐1/SOCS3. High‐concentration atropine induces HCEC apoptosis by regulating the miR‐30c‐1/SOCS3 axis and JAK2/STAT3 signaling pathway.

1. INTRODUCTION

Atropine, an alkaloid derived from Atropa belladonna, is a nonselective and competitive muscarinic acetylcholine receptor antagonist that has been intensively studied in well‐conducted clinical trials for controlling myopia progression in myopic children. ¹ Low concentrations of atropine (0.05%, 0.025%, and 0.01%) can effectively reduce spherical equivalent changes and axial length elongation in myopic children in a concentration‐dependent manner. ² , ³ , ⁴ A high concentration of atropine such as 1% has been reported to reduce myopic anisometropia by ~74%, with a success rate of 76.9%. ⁵ Despite the favorable outcomes of atropine treatment, it is associated with dose‐dependent adverse events such as photophobia, poor near visual acuity, and allergy. ⁶ Therefore, understanding the mechanism of atropine‐induced ocular damage is essential for optimizing atropine therapy. A wide spectrum of medications induces ocular side effects by triggering corneal epithelial changes. ⁷ A previous study has shown that atropine over 0.3125 g/L (0.03%) poses dose‐dependent and time‐dependent toxicities to human corneal epithelial cells (HCECs) by inhibiting cell proliferation and inducing apoptosis ⁸ ; however, the mechanism for atropine‐induced cytotoxicity is currently poorly understood.

MicroRNAs (miRNAs) are small endogenous RNAs that can silence gene expression involved in functional pathways by targeting mRNAs. ⁹ Many miRNAs are implicated in the cellular activities of HCECs. For example, miR‐205‐3p reduces ultraviolet radiation‐induced apoptosis and autophagy of HCECs by regulating the expression of toll‐like receptor 4 ¹⁰ ; miR‐494 suppresses nerve growth factor‐dependent proliferation in HCECs by inducing G1 arrest ¹¹ ; miR‐155‐5p accelerates wound healing of the corneal epithelium by increasing the expression of tight junction proteins and reducing corneal permeability. ¹² In a recent study, miR‐30c‐1 was found to suppress transforming growth factor‐β1‐induced senescence of human corneal endothelial cells, ¹³ but its expression in HCECs was not studied.

Suppressors of cytokine signaling (SOCS) are a group of eight proteins that control cytokine signaling via the Janus kinase (JAK)/signal transducer and activator of transcription (STAT) pathway, of which SOCS3 is implicated in immune homeostasis and energy metabolism. ¹⁴ Ross et al. ¹⁵ showed that SOCS3 expression was promoted by interleukin (IL)‐24 in response to Pseudomonas aeruginosa infection in mouse corneal epithelial cells. Interestingly, miR‐30c targeted the three prime untranslated region (3'UTR) of SOCS3 to inhibit apoptosis of breast cancer cells. ¹⁶ Based on the above, we carried out a study to investigate whether there is an interaction between miR‐30c‐1 and SOCS3 in HCECs and whether they are involved in a molecular mechanism of high‐concentration atropine‐induced cytotoxicity.

2. MATERIALS AND METHODS

2.1. Cell culture

HCECs (American Type Culture Collection, Manassas, Virginia) were cultured in high‐glucose Dulbecco's modified Eagle's medium (DMEM; Gibco, New York, New York) containing 10% fetal bovine serum (FBS), 100 U/ml penicillin, 100 μg/ml streptomycin, and 2 mmol/L L‐glutamine at a constant temperature (37°C) in an incubator (Thermo Scientific, Waltham, Massachusetts) with 5% CO₂ and 95% humidity. Cells at the logarithmic growth phase were harvested for subsequent experiments.

2.2. Cell transfection

pcDNA3.1‐SOCS3, empty pcDNA3.1, miR‐30c‐1 mimic, miR‐30c‐1 inhibitor, and negative controls (NC) were purchased from GenePharma (Shanghai, China) and delivered into HCECs using Lipofectamine 2000 reagent (Invitrogen, Carlsbad, California). Nontransfected cells were designated in the control group and transfected cells were divided into the following groups according to their transfection: miR‐30c‐1 mimic group, mimic NC group, miR‐30c‐1 inhibitor group, inhibitor NC group, pcDNA3.1‐SOCS3 group, pcDNA3.1 group, and miR‐30c‐1 mimic + pcDNA3.1‐SOCS3 group. The cells were harvested 48 h after transfection.

2.3. Drug treatment

Atropine powder (200 mg, 99% purity; Sigma‐Aldrich, St. Louis, Missouri) was dissolved in serum‐free DMEM (Gibco, New York, New York) to prepare a stock solution of atropine (20 g/L). The atropine solution was diluted with 20% FBS‐DMEM to a concentration of 0.01% (0.119 g/L), 0.03% (0.357 g/L), 0.05% (0.595 g/L), 0.1% (1.19 g/L), 0.2% (2.38 g/L), 0.4% (4.76 g/L), or 0.8% (9.52 g/L). HCECs were treated with the different concentrations of atropine.

2.4. Cell counting kit‐8 assay

A diluted suspension of HCECs (1 × 10⁶ cells/ml, 100 μl per well) was added to a 96‐well plate (three wells per group). Following cell incubation for 2, 4, 8, 16, and 32 h, 10 μl of cell counting kit‐8 (CCK‐8) reagent (Dojindo, Tokyo, Japan) were added to each well. The cells were incubated for a further 2 h, following which the absorbance was measured at 450 nm.

2.5. Flow cytometry

HCECs were centrifuged at 1000 rpm for 10 min, washed three times with phosphate‐buffered saline (), and fixed with 70% ethanol (precooled at −20°C) for 1 h. The fixative was removed by centrifugation. A single‐cell suspension (1 × 10⁷ cells/ml) prepared with PBS was used for apoptosis analysis using the Annexin V‐FITC Cell Apoptosis Detection Kit (Beyotime, Shanghai, China). The apoptosis rate was determined using the FACSCanto II system and the data were analyzed using FlowJo 7.6.1 (LLC., USA).

2.6. Quantitative reverse transcription polymerase chain reaction

TRIzol reagent was used to extract total RNA from the HCECs. Total RNA (5 μl) was diluted 20 times with RNase‐free ultrapure water. The concentration and purity of the RNA were determined by measuring the ultraviolet absorbance at 260 and 280 nm. The cDNA templates were synthesized by reverse transcription. Gene expression was detected and quantified using an ABI 7500 real‐time polymerase chain reaction (PCR) System. The thermal cycling conditions included pre‐denaturation (95°C for 10 min) followed by 40 cycles of denaturation (95°C for 10 s), annealing (60°C for 20 s), and extension (72°C for 34 s). Three replicate wells were used for each group. U6 and glyceraldehyde 3‐phosphate dehydrogenase (GAPDH) served as the reference genes for miRNA and mRNA, respectively. The data were analyzed using the 2^−ΔΔCt method. ΔΔCt = (Ct _{target gene} − Ct _{internal control}) _{experimental group} − (Ct _{target gene} − Ct _{internal control}) _{control group}. Table 1 lists the PCR primers and their sequences used.

TABLE 1.

Primer sequences

Name of primer	Sequences
miR‐30c‐1‐F	TGTAAACATCCTACACT
miR‐30c‐1‐R	TGGTGTCGTGGAGTCG
SOCS3‐F	GCAGGGAGGTGACGAGC
SOCS3‐R	AAACTTGCTGTGGGTGACCA
U6‐F	CTCGCTTCGGCAGCACA
U6‐R	AACGCTTCACGAATTTGCGT
GAPDH‐F	AATGGGCAGCCGTTAGGAAA
GAPDH‐R	GCGCCCAATACGACCAAATC

Abbreviations: F, forward primer; R, reverse primer.

2.7. Western blotting

HCECs were washed three times with precooled PBS and lysed with a lysis buffer. The flask was then placed on ice for 30 min. The mixture was centrifuged at 12,000 rpm at 4°C for 10 min. The supernatant was aspirated into 0.5 ml centrifuge tubes and stored at −20°C. Protein concentration was measured using a bicinchoninic acid kit (Beyotime, Shanghai, China). Proteins were electrophoresed at 4°C for 1–2 h, during which the voltage was shifted from 60 to 120 V when bromophenol blue entered the separation gel. The proteins were transferred onto a polyvinylidene difluoride membrane by wet electroblotting (4°C, 2 h). The membranes were immersed in 5% skimmed milk‐Tris‐buffered saline with Tween (TBST) at room temperature for 1–2 h and incubated with antibodies against GAPDH (1:1000, ab8245), SOCS3 (1:1000, ab16030), phosphorylated (p)‐JAK2 (1:1000, ab32101), p‐STAT3 (1:1000, ab267373), total‐STAT3 (ab68153, 1:1000), and total‐JAK2 (ab108596, 1:1000) (Abcam, Cambridge, Massachusetts) at 4°C overnight. After washing with TBST for 3 × 10 min, the membranes were incubated with goat anti‐rabbit secondary antibodies at room temperature for 1 h. A color‐developing solution was added to the membrane for protein visualization.

2.8. Dual‐luciferase reporter assay

Sequences of the miR‐30c‐1 binding site on wild‐type (WT) and mutant (MUT) SOCS3 were designed according to the binding site predicted by starBase (http://starbase.sysu.edu.cn/). The sequence (SOCS3‐MUT or SOCS3‐WT) was cloned and inserted into the pGL3‐Promoter vectors. The pGL3‐Promoter vectors together with blank pRL‐TK vectors (Beyotime, Shanghai, China) were cotransfected with miR‐30c‐1 mimic or mimic NC into HEK293T cells via Lipo293™ transfection reagent (Beyotime). Luciferase intensity was detected using a luciferase assay kit (Wuhan Amyjet Scientific Inc., Hubei, China) 48 h after the transfection.

2.9. RNA‐binding protein immunoprecipitation

The HCECs were washed twice with precooled PBS, centrifuged at 1500 rpm for 5 min, and lysed with an equal volume of RNA‐binding protein immunoprecipitation (RIP) lysis buffer. For each centrifuge tube, 50 μl of the magnetic bead suspension and 500 μl of RIP wash buffer was added and vortexed. The tube was placed on a magnetic grate and rotated by 15° from left to right to make the beads form a straight line, and the supernatant was discarded. These steps were then repeated. The beads were resuspended in 100 μl of RIP wash buffer and incubated with 5 μg of antiargonaute 2 (Ago2) antibodies (ab186733, 1:30; Abcam, Cambridge, Massachusetts) at room temperature for 30 min. The centrifuge tube was placed on a magnetic grate, and the supernatant was discarded. The tube was washed with 500 μl of RIP wash buffer, which was repeated. Next, 500 μl of RIP wash buffer was added to the tube which was then placed on ice after vortexing.

The prepared bead tube was placed on a magnetic grate, and the supernatant was discarded. Then, 900 μl of RIP immunoprecipitation buffer was added to the tube. The prepared cell lysate was thawed and centrifuged at 14,000 rpm and 4°C for 10 min. Then, 100 μl of the supernatant aspirated from the lysate was added to the tube to obtain a total volume of 1 ml. The mixture was incubated at 4°C overnight and then briefly centrifuged. The tube was then placed on a magnetic grate, after which the supernatant was discarded. The tube was washed six times with 500 μl of RIP wash buffer.

Finally, the bead‐antibody complexes were incubated with 150 μl of proteinase K buffer at 55°C for 30 min. The tube was placed on a magnetic grate and the supernatant was collected for RNA isolation. Quantitative reverse transcription PCR (qRT‐PCR) was used to detect the expression levels of miR‐30c‐1 and SOCS3.

2.10. Statistical analysis

Data were analyzed using SPSS 17.0 and GraphPad Prism 5.0, and are shown as mean ± SD. For normally distributed data, the t‐test and one‐way analysis of variance were performed to compare differences between two groups and among multiple groups. Tukey's test was used for post hoc multiple comparisons. Statistical significance was set at p < 0.05.

3. RESULTS

3.1. High‐concentration atropine induces HCEC cytotoxicity and inhibits miR‐30c‐1 expression

HCECs were cultured in normal medium (control cells) or treated with different concentrations of atropine (0.01%, 0.03%, 0.05%, 0.1%, 0.2%, 0.4%, and 0.8%) for 2, 4, 8, 16, and 32 h. Treatment with 0.01% or 0.03% atropine had no impact on the morphology of HCECs (Figure 1A). When treated with 0.05%, 0.1%, 0.2%, 0.4%, and 0.8% atropine, the cells showed dose‐dependent morphological changes, such as contraction, cytoplasmic vacuolization, and isolation from the culture substrate (Figure 1A). The results of the CCK‐8 assay showed that HCECs treated with 0.01% atropine and control cells showed no difference in viability; however, treatment with 0.03% atropine resulted in an insignificant decline in the viability of HCECs (Figure 1B). The viability of HCECs treated with 0.05%, 0.1%, 0.2%, 0.4%, and 0.8% atropine, were significantly decreased in a dose‐dependent and time‐dependent manner (Figure 1B, p < 0.05). Flow cytometry was used to detect apoptosis in HCECs 8 h after treatment with different concentrations of atropine. The apoptosis rates of HCECs treated with 0.01% and 0.03% atropine were not significantly different from those of the control cells (Figure 1C). Apoptosis of HCECs was significantly increased by 0.05%, 0.1%, 0.2%, 0.4%, and 0.8% atropine in a dose‐dependent manner (Figure 1C, p < 0.05). qRT‐PCR was used to detect the expression of miR‐30c‐1 in HCECs 8 h after treatment with different concentrations of atropine. When compared with control cells, HCECs treated with 0.01%, 0.03%, 0.05%, 0.1%, and 0.2% atropine showed a dose‐dependent decrease in the expression of miR‐30c‐1 (Figure 1D, p < 0.05). These results indicated that high‐concentration atropine inhibited viability, increased apoptosis, and downregulated miR‐30c‐1 in HCECs. The following experiments used 0.1% atropine to treat HCECs.

FIGURE 1.

High‐concentration atropine treatment induces HCEC cytotoxicity and inhibits miR‐30c‐1 expression. HCECs were cultured in normal medium or treated with different concentrations of atropine (0.01%, 0.03%, 0.05%, 0.1%, 0.2%, 0.4%, and 0.8%). (A) The morphology of HCECs was observed 8 h after drug treatment. (B) CCK‐8 was used to assess the viability of HCECs treated with atropine for 2, 4, 8, 16, and 32 h. (C) Flow cytometry was used to assess the apoptosis of HCECs 8 h after drug treatment. (D) qRT‐PCR was used to detect the expression of miR‐30c‐1 in HCECs 8 h after drug treatment. Data are expressed as mean ± SD. Each experiment was repeated thrice. *p < 0.05, **p < 0.01, ***p < 0.001. CCK‐8, cell counting kit‐8; HCECs, human corneal epithelial cells; miR, microRNA; qRT‐PCR, quantitative reverse transcription polymerase chain reaction

3.2. Overexpression of miR‐30c‐1 reduces high‐concentration atropine‐induced HCEC cytotoxicity

miR‐30c‐1 was overexpressed in HCECs by miR‐30c‐1 mimic transfection, and transfection effectiveness was validated by qRT‐PCR (Figure 2A, p < 0.001). The transfected HCECs were then treated with 0.1% atropine for 8 h, and the effect of miR‐30c‐1 on high‐concentration atropine‐induced cytotoxicity was evaluated using CCK‐8 and flow cytometry. The experimental results indicated that overexpression of miR‐30c‐1 increased viability (Figure 2B, p < 0.05) and inhibited apoptosis (Figure 2C, p < 0.05) of the HCECs in the presence of high concentrations of atropine.

FIGURE 2.

Overexpression of miR‐30c‐1 reduces high‐concentration atropine‐induced HCEC cytotoxicity. (A) HCECs were transfected with miR‐30c‐1 mimic or mimic NC, and qRT‐PCR was used to detect the expression of miR‐30c‐1. Then the transfected HCECs were treated with 0.1% atropine for 8 h, and CCK‐8 assay (B) and flow cytometry (C) were used to assess the viability and apoptosis of these cells. Data are expressed as mean ± SD. Each experiment was repeated thrice. *p < 0.05, **p < 0.01, ***p < 0.001. CCK‐8, cell counting kit‐8; HCECs, human corneal epithelial cells, miR, microRNA; NC, negative control

3.3. miR‐30c‐1 directly downregulates the expression of SOCS3

miR‐30c‐1 was predicted by the starBase database (http://starbase.sysu.edu.cn/starbase2/index.php) to have a binding site for SOCS3 (Figure 3A). To investigate the relationship between miR‐30c‐1 and SOCS3, HCECs were transfected with the miR‐30c‐1 mimic, mimic NC, miR‐30c‐1 inhibitor, or inhibitor NC. As shown by qRT‐PCR, the expression of miR‐30c‐1 was significantly altered (Figure 3B, p < 0.001). The results of qRT‐PCR and western blotting further showed that the expression of SOCS3 mRNA and protein were reduced in the miR‐30c‐1 mimic group and increased in the miR‐30c‐1 inhibitor group (Figure 3C,D, p < 0.05, vs. the mimic NC or inhibitor NC group). qRT‐PCR and western blotting were used to detect the expression of SOCS3 in HCECs after treatment with different concentrations of atropine for 8 h. At concentrations >0.03%, atropine significantly increased SOCS3 mRNA and protein levels in HCECs (Figure 3E,F, p < 0.05). Next, the relationship between miR‐30c‐1 and SOCS3 was investigated. In the luciferase reporter assay, the miR‐30c‐1 mimic induced a decrease in the luciferase intensity in cells transfected with SOCS3‐WT but not with SOCS3‐MUT (Figure 3G, p < 0.05). The RNA‐induced gene‐silencing complex is responsible for the binding of miRNAs to target genes. Ago2 is one of the components of this complex. Therefore, the Ago2 antibody can be used in RIP experiments to verify the binding of miRNAs to target genes. The RIP assay in this study showed that the Ago2 antibody, instead of immunoglobulin G antibody, resulted in the enrichment of miR‐30c‐1 and SOCS3 mRNA (Figure 3H, p < 0.001). The above evidence indicates that miR‐30c‐1 binds to SOCS3 mRNA.

FIGURE 3.

miR‐30c‐1 directly downregulates the expression of SOCS3. (A) StarBase predicted the binding site between miR‐30c‐1 and SOCS3 mRNA, and mutation was generated on SOCS3 in the complementary site for the seed region of miR‐30c‐1. qRT‐PCR was used to detect the expression of miR‐30c‐1 (B) and SOCS3 mRNA (C), and western blotting was used to detect SOCS3 protein (D) in HCECs transfected with miR‐30c‐1 mimic, mimic NC, miR‐30c‐1 inhibitor, or inhibitor NC. qRT‐PCR (E) and western blotting (F) were used to detect the expression of SOCS3 mRNA and protein in HCECs treated with different concentrations of atropine for 8 h. Dual‐luciferase reporter assay (G) and RNA immunoprecipitation (H) were used for determining the targeting relationship between miR‐30c‐1 and SOCS3. Data are expressed as mean ± SD. Each experiment was repeated thrice. *p < 0.05, **p < 0.01, ***p < 0.001. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; HCECs, human corneal epithelial cells; IgG, immunoglobulin G; miR, microRNA; MUT, mutant; qRT‐PCR, quantitative reverse transcription polymerase chain reaction; SOCS3, suppressor of cytokine signaling 3; WT, wild‐type

3.4. High‐concentration atropine induces HCEC cytotoxicity via miR‐30c‐1/SOCS3

HCECs were transfected with miR‐30c‐1 mimic, mimic NC, pcDNA3.1‐SOCS3, pcDNA3.1, or miR‐30c‐1 mimic + pcDNA3.1‐SOCS3, and treated with 0.1% atropine for 8 h. In contrast to the mimic NC group, the miR‐30c‐1 mimic group showed decreased expression of SOCS3 mRNA and protein levels (Figure 4A,B, p < 0.05), higher viability (Figure 4C, p < 0.05), and reduced apoptosis (Figure 4D, p < 0.05). SOCS3 was upregulated in the pcDNA3.1‐SOCS3 group compared with that in the pcDNA3.1 group (Figure 4A,B, p < 0.05). Moreover, the viability of atropine‐treated HCECs was reduced (Figure 4C, p < 0.001) and the apoptosis was increased (Figure 4D, p < 0.01) in the pcDNA3.1‐SOCS3 group compared with the pcDNA3.1 group. When compared with the miR‐30c‐1 mimic group, the miR‐30c‐1 mimic + pcDNA3.1‐SOCS3 group exhibited higher expression of SOCS3 (Figure 4A,B, p < 0.05), lower viability (Figure 4C, p < 0.05), and increased apoptotic cells (Figure 4D, p < 0.05). In conclusion, a high concentration of atropine inhibits cell viability and promotes apoptosis in HCECs by upregulating SOCS3 through miR‐30c‐1 inhibition.

FIGURE 4.

High‐concentration atropine induces HCEC cytotoxicity via miR‐30c‐1/SOCS3. HCECs were transfected with miR‐30c‐1 mimic, mimic NC, pcDNA3.1‐SOCS3, pcDNA3.1, or miR‐30c‐1 mimic + pcDNA3.1‐SOCS3 and treated with 0.1% atropine for 8 h. qRT‐PCR (A) and western blotting (B) were used to detect the expression of SOCS3 mRNA and protein. CCK‐8 assay (C) and flow cytometry (D) were used to assess the viability and apoptosis of HCECs. Data are expressed as mean ± SD. Each experiment was repeated thrice. *p < 0.05, **p < 0.01, ***p < 0.001. CCK‐8, cell counting kit‐8; HCECs, human corneal epithelial cells; miR, microRNA; NC, negative control; qRT‐PCR, quantitative reverse transcription polymerase chain reaction; SOCS3, suppressor of cytokine signaling 3

3.5. High‐concentration atropine blocks JAK2/STAT3 signaling pathway via miR‐30c‐1/SOCS3

SOCS is an established negative feedback regulator of the JAK/STAT pathway. ¹⁷ Activation of the JAK2/STAT3 signaling pathway can increase the expression of SOCS3, which in turn negatively regulates the JAK2/STAT3 pathway by inactivating STAT3. ¹⁸ The JAK2/STAT3 pathway plays an important role in the apoptosis of various tumor and nontumor cells. ¹⁹ , ²⁰ Therefore, we investigated the effect of atropine on the JAK2/STAT3 signaling pathway. HCECs were transfected with miR‐30c‐1 mimic, mimic NC, pcDNA3.1‐SOCS3, or pcDNA3.1 for 48 h and then treated with 0.1% atropine for 8 h. Western blotting showed that atropine treatment significantly decreased the levels of p‐JAK2 and p‐STAT3 in HCECs (Figure 5A,B, p < 0.05). The expression levels of p‐JAK2 and p‐STAT3 were elevated in the miR‐30c‐1 mimic group (vs. the mimic NC group) and reduced in the pcDNA3.1‐SOCS3 group (vs. the pcDNA3.1 group) and the miR‐30c‐1 mimic + pcDNA3.1‐SOCS3 group (vs. the miR‐30c‐1 mimic group; Figure 5A,B, p < 0.05). These results indicate that high‐concentration atropine could inhibit the activation of the JAK2/STAT3 signaling pathway via miR‐30c‐1/SOCS3.

FIGURE 5.

High‐concentration atropine blocks JAK2/STAT3 signaling pathway via miR‐30c‐1/SOCS3. HCECs were transfected with miR‐30c‐1 mimic, mimic NC, pcDNA3.1‐SOCS3, pcDNA3.1, or miR‐30c‐1 mimic + pcDNA3.1‐SOCS3 and treated with 0.1% atropine for 8 h. (A,B) Western blotting was used to detect the expression of JAK2/STAT3‐related proteins. Data are expressed as mean ± SD. Each experiment was repeated thrice. *p < 0.05, **p < 0.01, ***p < 0.001. GAPDH, glyceraldehyde 3‐phosphate dehydrogenase; HCECs, human corneal epithelial cells; JAK2, Janus kinase 2; miR, microRNA; NC, negative control; SOCS3, suppressor of cytokine signaling 3; STAT3, signal transducer and activator of transcription 3

4. DISCUSSION

Atropine is the most effective pharmaceutical agent for slowing myopia progression, with dose‐dependent efficacy and with fewer side effects than other pharmaceutical products. ²¹ Consistent with its ability to control myopia, atropine stimulated the biosynthesis of collagen and fibronectin in scleral fibroblast cells and enhanced scleral blood perfusion; however, continuous treatment with 0.03% atropine for 96 h significantly reduced the viability of HCECs. ²² In this study, treatment with atropine at concentrations ranging from 0.05% to 0.8% reduced the viability of HCECs in a dose‐dependent and time‐dependent manner. Furthermore, long‐term treatment with atropine caused dose‐dependent adverse morphological changes and increased apoptosis of HCECs. More importantly, HCECs showed dose‐dependent increases in the expression of SOCS3 and decreases in the expression of miR‐30c‐1 after atropine treatment. We further investigated the roles of SOCS3 and miR‐30c‐1 in atropine‐induced cytotoxicity in HCECs treated with 0.1% atropine.

Differential expression of miR‐30c‐1 has been observed in various disease conditions, such as Toxoplasma gondii infection, myocardial fibrogenesis, neuropathic pain, and carcinomas. ²³ , ²⁴ , ²⁵ , ²⁶ The specific regulation of miR‐30c‐1 has primarily been investigated in cancers. For example, methyltransferase 14‐mediated maturation of miR‐30c‐1‐3p was inhibited in lung cancer to facilitate tumor cell proliferation and metastasis. ²⁷ Overexpression of miR‐30c‐1‐3p sensitized prostate cancer cells to androgen ablation therapy by inhibiting the expression of androgen receptor variant 7. ²⁸ The antitumor effect of miR‐30c‐1 was also detected in hepatomas, where overexpression of miR‐30c‐1 enhanced natural killer cell‐induced cytotoxicity to hepatomas by downregulating homeobox containing 1. ²⁹ In addition to its implications for tumor development, miR‐30c‐1‐3p was downregulated by the coexistence of sulfur dioxide and polycyclic aromatic hydrocarbons to promote pulmonary fibrosis. ³⁰ Despite the multiple roles of miR‐30c‐1, no observation of its expression in HCECs has been reported previously. In this study, overexpression of miR‐30c‐1 increased viability and inhibited apoptosis in HCECs treated with high concentrations of atropine. Moreover, miR‐30c‐1 decreased the expression of SOCS3 by binding to the 3'‐UTR of SOCS3 mRNA. Overexpression of miR‐30c‐1 elevated the levels of p‐JAK2 and p‐STAT3 in atropine‐treated HCECs.

SOCS3 plays a critical role in many cellular processes, such as inflammatory responses, cell growth, and cell death, by mediating the signal transduction of various cytokines, growth factors, and hormones through binding to both JAK kinase and cytokine receptors. ³¹ Mukwaya et al. ³² found that SOCS3 is involved in the regulation of the anti‐inflammatory liver X receptor/retinoid X receptor pathway during inflammatory corneal angiogenesis. Platelet‐derived growth factor promotes the growth, migration, and IL‐8 secretion of human corneal fibroblasts by activating the JAK2/STAT3/SOCS3 signaling pathway. ³³ SOCS3 is also regulated by STAT3 to maintain the homeostasis of corneal endothelial cells. ³⁴ Consistent with previous findings, this study showed that atropine treatment reduced the levels of p‐JAK2 and p‐STAT3 in HCECs, and SOCS3 overexpression further downregulated the expression of these two proteins. Overexpression of SOCS3 promoted the apoptosis of atropine‐treated HCECs and simultaneously decreased the cell viability. Moreover, overexpression of SOCS3 abrogated the effects of the miR‐30c‐1 mimic on the JAK2/STAT3 signaling pathway and on the viability and apoptosis of atropine‐treated HCECs.

In summary, a high concentration of atropine induced apoptosis in HCECs by regulating the miR‐30c‐1/SOCS3 axis and inactivating the JAK2/STAT3 signaling pathway. This study uncovers a molecular axis regulated by atropine‐induced cytotoxicity in HCECs and provides new avenues for improving the efficacy of atropine in preventing the progression of myopia.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Chen X‐J, Hu P, Yi S. High‐concentration atropine induces corneal epithelial cell apoptosis via miR‐30c‐1/SOCS3 . Kaohsiung J Med Sci. 2022;38(11):1113–1122. 10.1002/kjm2.12598