Skip to main content
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2021 Feb 20;37(6):459–467. doi: 10.1002/kjm2.12369

LINC01315 promotes the aggressive phenotypes of papillary thyroid cancer cells by sponging miR‐497‐5p

Jian Ren 1, Feng‐Jiao Zhang 1, Jing‐Hong Wang 1, Jian‐Dong Tang 1,
PMCID: PMC11896402  PMID: 33611825

Abstract

Dysregulation of the long intergenic noncoding RNA 01315 (LINC01315) has recently been demonstrated in cancer. However, the role of LINC01315 in papillary thyroid cancer (PTC) has not been determined. We attempted to determine the function of LINC01315 in PTC. The levels of LINC01315 were higher in thyroid carcinoma tissues and cell lines compared with that in noncancerous tissues or normal cells, respectively. LINC01315 knockdown significantly inhibited the in vitro colony formation and invasion of PTC cells. Upregulation of LINC01315 produced opposite effects. Bioinformatic analysis and luciferase reporter assays indicated direct binding of miR‐497‐5p to LINC01315. Gain‐ and loss‐of‐function assays indicated that miR‐497‐5p acts as a suppressive miRNA in PTC. Furthermore, LINC01315 facilitated the growth and invasion of PTC cells by sponging miR‐497‐5p. Our results demonstrated the critical role of the LINC01315‐miR‐497‐5p axis in the growth and invasion of PTC cells.

Keywords: invasion, LINC01315, MiR‐497‐5p, papillary thyroid cancer

1. INTRODUCTION

Incidence of thyroid cancer has been continuously increasing in recent years. Thyroid cancer has gradually become the most common endocrine malignancy. Papillary thyroid cancer (PTC) accounts for almost 80% of thyroid cancers and is the main histologic type of this cancer. 1 The majority of patients with PTC are curable and have a favorable clinical outcome of current therapeutic regimens. 2 However, a fraction of thyroid cancer cases have a poor prognosis due to metastases. 3 Hence, investigation of the molecular mechanism is needed to identify the biomarkers and therapeutic targets of aggressive thyroid cancer.

Many long noncoding RNAs (lncRNAs), such as HOTAIR, H19, and MALAT1, have been identified as the crucial regulators in carcinogenesis and cancer progression. 4 , 5 , 6 Recently, a novel posttranscriptional regulation has been proposed involving lncRNA interaction with miRNAs that function as competing endogenous RNAs (ceRNAs). 7 For example, lncRNA FOXP4‐AS1 is activated by PAX5 and promotes the growth of prostate cancer by sequestering miR‐3184‐5p to upregulate FOXP4. 8 LncRNA PVT1 regulates the growth, migration, and invasion of bladder cancer via miR‐31/CDK1. 9 Several lncRNAs haven been identified as crucial regulators of thyroid cancer. 10 , 11 Recently, LINC01315 has been reported to be dysregulated in nasopharyngeal carcinoma. 12 LINC01315 may be a prognostic biomarker in triple‐negative breast cancer (TNBC). 13 However, a potential role of LINC01315 in thyroid cancer is poorly understood.

Our study investigated the roles of LINC01315 in thyroid carcinoma. LINC01315 is upregulated in thyroid cancer. Moreover, loss‐ and gain‐of‐function assays suggested that LINC01315 promotes the colony formation, invasion, and epithelial‐mesenchymal transition (EMT) of thyroid cancer cells. However, upregulation of LINC01315 produces opposite effects. Furthermore, we demonstrate that LINC01315 regulates the colony formation and invasion of thyroid cancer cell by sponging miR‐497‐5p.

2. MATERIALS AND METHODS

2.1. Tissues and cell lines

Thyroid cancer and noncancerous tissues were obtained from 36 patients diagnosed with thyroid cancer at the Zhengzhou Central Hospital Affiliated to ZhengZhou University. Informed consent was obtained from all participants. Patient characteristics, including age, sex, tumor size, and lymph node status, are given in Table 1. PTC cell lines (TPC‐1 and B‐CPAP) and a normal thyroid cell line, HT‐ori3, were obtained from the Tumor Cell Bank of the Chinese Academy of Medical Science (Shanghai, China). Cells were cultured using DMEM (Thermo Fisher Scientific, Waltham, MA) supplemented with 10% FBS and maintained in humidified air with 5% CO2 at 37°C.

TABLE 1.

Correlation between LINC01315 and clinical characteristics of patients with thyroid cancer (n = 36)

Clinical variables LINC01315
Low High Total P
Age, years NS
≥45 8 12 20
<45 10 6 16
Sex NS
Female 8 6 14
Male 10 12 22
Histologic NS
PTC 14 15 29
FTC 4 3 7
Tumor size 0.012 a
T1‐T2 16 9 25
T3‐T4 2 9 11
Lymph node status 0.043 a
N0 16 10 26
N1 2 8 10
TNM stage 0.038 a
I‐II 14 5 19
III‐IV 4 13 17

Abbreviations: FTC, follicular thyroid carcinoma; NS, no significant difference; PTC, papillary thyroid carcinoma.

a

P < 0.05.

2.2. Cell transfection

The pcDNA3.1 (+) vector for overexpression of LINC01315 (pcDNA3.1/LINC01315), pcDNA3.1 (negative control), shRNA targeting LINC01315 (sh‐LINC01315), and sh‐ctrl (control) were obtained from the Genscript. miR‐497‐5p mimics, miRNA negative control (miR‐ctrl), and miR‐497‐5p inhibitor (anti‐miR‐497‐5p) and anti‐miR‐ctrl were purchased from the Genscript (Nanjing, China). Transfections were carried out using a Lipofectamine 2000 kit (Thermo Fisher Scientific).

2.3. qRT‐PCR assay

Total RNA was extracted using Trizol reagent (Thermo Fisher Scientific). cDNA was synthesized from RNA using a reverse transcription kit (Takara, Dalian, China). For miR‐497‐5p quantification, reverse transcription was performed using a Mir‐X™ miRNA first strand synthesis kit (Takara). The level of miR‐497‐5p was detected using an All‐in‐One™ miRNA qPCR detection kit (GeneCopoeia Inc., China). The level of LINC01315 was measured using a SYBR Green kit (Takara Biotechnology Co., Ltd.) by a Roche Lightcycler 480 real‐time PCR system (Roche Applied Science, Penzberg, Germany). The levels of miR‐497‐5p and LINC01315 were calculated using the 2−ΔΔCt method and normalized to U6 or GAPDH levels, respectively. The primer sequences were as follows: forward, 5'‐AGCACTTGGCCCTAAAGAGA−3'; reverse, 5'‐AACATACTGGCCCAAACAGC−3' for LINC01315; forward, 5'‐AATGGATTTGGACGCATTGGT‐3'; reverse, 5'‐TTTGCACTGGTACGTGTTGAT‐3' for GAPDH; forward, 5'‐CTCGCTTCGGCAGCACA‐3'; reverse, 5'‐AACGCTTCACGAATTTGCGT‐3' for U6; and forward, 5'‐CAGCAGCACACUGUGGUUUGU‐3'; reverse, 5'‐AAACCACAGUGUGCUGCUGUU‐3' for miR‐497‐5p.

2.4. Cell viability

Cells (2 × 104 cells/well) were cultured in 96‐well plates overnight. At 24, 48, 72, or 96 h after the transfection, 10 μl CCK‐8 solution was added to 96‐well plates, and the plates were incubated at 37°C for 1 h. The absorbance at indicated time was measured at 450 nm.

2.5. Colony formation assay

Cells (500 cells/well) were plated in 6‐well plates. After 2 weeks, the cells were fixed and stained with 1% crystal violet. The number of visible cell colonies (>50 cells) was counted.

2.6. Invasion assay

Cells in serum‐free media were placed into Matrigel‐coated (Becton Dickinson, NY) upper Transwell chambers (8 μm pore size; Corning). Medium (500 μl) containing 10% FBS was added into the lower chambers. After 24 h, cells invaded across the membrane were fixed with methanol and stained with 1% crystal violet.

2.7. Bioinformatic analyses

The LIN01315 and miR‐497‐5p expression data in thyroid cancer specimens of TCGA were analyzed using GEPIA2, which is a newly developed interactive web server for analysis of the RNA sequencing expression data of 9736 tumors and 8587 normal samples from the TCGA and GTEx projects. The interaction between miRNAs and LINC01315 was predicted using LncBase Experimental v.2 (http://www.microrna.org/microrna/home.do, 21 August 2016).

2.8. Luciferase reporter assay

The sequences of LINC01315 containing the miR‐497‐5p‐binding site or mutated binding site, named as LIN01315‐WT or LINC01315‐MUT, were cloned into the pmirGLO plasmid (Beyotime, China). HEK‐293 cells were cotransfected with the LINC01315‐WT or LINC01315‐MUT plasmid and miR‐497‐5p. Luciferase reporter assay system (Promega, Madison, WI) was used to assay relative luciferase activities 48 h after the transfection.

2.9. RNA immunoprecipitation (RIP)

RIP was carried out using a RIP kit (Thermo Fisher Scientific) according to the manufacturer's protocol. An Ago2 antibody and a normal IgG used as a negative control were purchased from Abcam (Cambridge, MA). Immunoprecipitated RNA was isolated and detected by qRT‐PCR.

2.10. Immunoblotting assay

Total proteins were extracted using RIPA lysis buffer. Proteins were separated using 10% SDS‐PAGE and transferred onto polyvinylidene difluoride (PVDF) membranes (Millipore, Braunschweig, Germany). Membranes were incubated with antibodies to E‐cadherin (1:2000, Abcam, Cambridge, UK), N‐cadherin (1:2000, Abcam), or GAPDH (1:3000, Abcam) at 4°C overnight followed by incubation with an HRP‐conjugated secondary antibody. The bands were detected using an enhanced chemiluminescence (ECL) kit (Millipore).

2.11. Statistical analysis

Data are present as the mean ± SD of three independent experiments. Statistical analysis was performed using the SPSS 17.0 software (SPSS Inc., Chicago, IL). Two groups were compared using Student's t‐test, and multiple groups were compared using one‐way ANOVA. The correlation between LINC01315 and miR‐497‐5p was evaluated by Spearman correlation analysis. P < 0.05 was considered to be significant.

3. RESULTS

3.1. LINC01315 is upregulated in thyroid cancer

Initially, we investigated the expression levels of LINC01315 in The Cancer Genome Atlas (TCGA) using the GEPIA database. As shown in Figure 1(A,B), LINC01315 was notably upregulated in thyroid cancer compared with normal controls. Then, the expression levels of LINC01315 were evaluated in 36 pairs of thyroid cancer and noncancerous tissues. The level of LINC01315 was considerably higher in cancerous tissues compared with that in noncancerous tissues (Figure 1(C)). A positive correlation of overexpression of LINC01315 with an advanced stage of tumor and lymph node metastasis in these patients was observed (Table 1). Considering that PTC is the predominant type of thyroid cancer, we subsequently focused on the role of LINC01315 in PTC. The levels of LINC01315 were assayed in two PTC cell lines (TPC‐1 and B‐CPAP) and a normal thyroid cell line, HT‐ori3. As shown in Figure 1(D), the level of LINC01315 was significantly increased in PTC cell lines compared with that in HT‐ori3 cells. These data indicate that LINC01315 is upregulated in thyroid cancer.

FIGURE 1.

FIGURE 1

LINC01315 is upregulated in thyroid cancer tissues and PTC cells. (A) Expression profiles of LINC01315 in cancer tissues and normal tissues using GEPIA database. (B) Expression profiles of LINC01315 in thyroid cancer and normal tissues using the GEPIA dataset. (C) LINC01315 expression in 36 pairs of thyroid cancer tissues and corresponding histologically noncancerous tissues measured by qRT‐PCR. (D) the levels of LINC01315 in PTC cell lines (TPC‐1 and B‐CPAP) and normal thyroid cell line, HT‐ori3 were measured by qRT‐PCR. Data are presented as the mean ± SD of three independent experiments. ** P < 0.01 versus HT‐ori3

3.2. LINC01315 regulates the proliferation and invasion of PTC cells

To examine the functions of LINC01315 in PTC cells, LINC01315 was downregulated or overexpressed in TPC‐1 and B‐CPAP cells by transfection with LINC01315‐specific shRNA (sh‐LINC01315) or LINC01315 expression vector (pcDNA3.1/LINC01315). The transfection efficiency was evaluated by qRT‐PCR analysis (Figure 2(A)). The results of the CCK‐8 and colony formation assays demonstrated that sh‐LINC01315 decreases the proliferation of TPC‐1 and B‐CPAP cells, and pcDNA3.1/LINC01315 promotes the proliferation compared with that in sh‐ctrl‐ or pcDNA3.1/vector‐transfected PTC cells (Figure 2(B,C)). Moreover, the results of the Transwell assay indicated that LINC01315 silencing in TPC‐1 and B‐CPAP cells reduces cell invasion, and upregulation of LINC01315 increases the invasion of PTC cells (Figure 2(D)). Furthermore, the results of immunoblotting suggested that LINC01315 contributes to EMT in PTC cells (Figure 2(E)). sh‐LINC01315 increases the expression of E‐cadherin and reduces the level of N‐cadherin in TPC‐1 and B‐CPAP cells. However, pcDNA3.1/LINC01315 increases the expression of N‐cadherin and reduces the level of E‐cadherin in PTC cells. Additionally, normal thyroid cell line, HT‐ori3, was transfected with pcDNA3.1/LINC01315 (Figure 2(F)). As expected, upregulation of LINC01315 stimulates the colony formation and invasion of HT‐ori3 cells (Figure 2(G,H)). These results indicate that LINC01315 is involved in the growth and invasion of PTC cells.

FIGURE 2.

FIGURE 2

LINC01315 regulates the growth and invasion in PTC cells. (A) TPC‐1 and B‐CPAP was transfected with sh‐LINC01315 or pcDNA3.1/LINC01315. Satisfactory transfection efficiency was revealed by qRT‐PCR. (B,C) CCK‐8 and colony formation assays were performed to exam the function of LINC01315 in PTC cells proliferation and clone forming ability, respectively. (D) Transwell analysis was applied to detect the function of LINC01315 in PTC cells invasion. (E) the expressions of EMT markers (E‐cadherin and N‐cadherin) were detected using western blot analysis. Data are presented as the mean ± SD of three independent experiments. (E) HT‐ori3 cell was transfected with pcDNA3.1/LINC01315. Satisfactory transfection efficiency was revealed by qRT‐PCR. (F) Colony formation assay was performed to exam the function of LINC01315 in HT‐ori3 cell colony formation ability. (G) Transwell analysis was applied to detect the function of LINC01315 in HT‐ori3 cell invasion. ** P < 0.01 versus sh‐ctrl or pcDNA3.1

3.3. Identification of miR‐497‐5p as a target of LINC01315

LncRNAs may function as ceRNAs for miRNAs. To examine whether LINC01315 is a ceRNA, LncBase Experimental v.2 was used to predict potential miRNAs that bind to LINC01315. As shown in Figure 3(A), miR‐497‐5p has a potential binding site for LINC01315. The binding sequence of miR‐497‐5p on LINC01315 was determined, and a mutation was designed. Additionally, luciferase reporter assay confirmed these considerations. As shown in Figure 3(B), miR‐497‐5p decreases the luciferase activity of the wild‐type LINC01315 reporter vector (WT) but has no effect on the mutant reporter vector (MUT). Moreover, the level of miR‐497‐5p is decreased by pcDNA3.1/LINC01315 and increased by sh‐LINC01315 (Figure 3(C)). To identify associations between LINC01315 and miR‐497‐5p, we assayed the expression level of miR‐497‐5p in PTC and HT‐ori3 cells. As shown in Figure 3(D), the level of miR‐497‐5p was decreased in PTC cells compared with that in HT‐ori3 cells. Importantly, the level of miR‐497‐5p is downregulated in thyroid cancer tissues and is negatively associated with LINC01315 expression (Figure 3(E,F)). RIP assay was performed to validate the regulatory relationship between LINC01315 and miR‐497‐5p. The results of RIP assay showed that LINC01315 is pulled down by miR‐497‐5p (Figure 3(G)).

FIGURE 3.

FIGURE 3

Identification of miR‐497‐5p as a target of LINC01315. (A) MiR‐497‐5p and LINC01315 binding sequences and LINC01315 mutation sequences. (B) Luciferase reporter assay showed that over‐expression of miR‐497‐5p significantly reduced the luciferase activity in HEK‐293 cells that were transfected with the WT LINC01315 vector without reducing the luciferase activity in cells that were transfected with the MUT LINC01315 vector. ** P < 0.01 versus miR‐ctrl. (C) B‐CPAP was transfected with pcDNA3.1/LINC01315 and TPC‐1 was transfected with sh‐LINC01315. The level of miR‐497‐5p was measured by qRT‐PCR. ** P < 0.01 versus sh‐ctrl or pcDNA3.1. (D) qRT‐PCR was used to detect the level of miR‐497‐5p PTC cell lines (TPC‐1 and B‐CPAP) and normal thyroid cell line, HT‐ori3. ** P < 0.01 versus HT‐ori3. (E) miR‐497‐5p expression in 36 pairs of thyroid cancer tissues and corresponding noncancerous tissues were measured by qRT‐PCR. (F) Negative correlation between the expression levels of miR‐497‐5p and LINC01315 in thyroid cancer tissues. (G) RIP experiments were performed in TPC‐1 and B‐CPAP cells, and the co‐precipitated miR‐497‐5p was subjected to qRT‐PCR for LINC01315. ** P < 0.01 versus anti‐IgG

3.4. miR‐497‐5p inhibits the proliferation and invasion of PTC cells

To determine the role of miR‐497‐5p, miR‐ctrl or miR‐497‐5p mimic were transfected into PTC cells, and anti‐miR‐ctrl or anti‐miR‐497‐5p were transfected into TPC‐1 and B‐CPAP cells. The transfection efficiency was satisfactory as demonstrated by the data of the qRT‐PCR assay (Figure 4(A)). Colony formation assay indicated that miR‐497‐5p mimics decrease the colony formation of PTC cells, and the opposite effect was obtained in TPC‐1 and B‐CPAP cells transfected with anti‐miR‐497‐5p (Figure 4(B)). The data of the Transwell assay demonstrated that miR‐497‐5p decreases the invasion of PTC cells, and an opposite phenomenon is observed in TPC‐1 and B‐CPAP cells transfected with anti‐miR‐497‐5p (Figure 4(C)). Additionally, as shown in Figure 4(D), overexpression of miR‐497‐5p can reverse the EMT phenotype of PTC cells. MiR‐497‐5p increases the expression of E‐cadherin and reduces the level of N‐cadherin in PTC cells. However, anti‐miR‐497‐5p increases the expression of N‐cadherin and reduces the level of E‐cadherin in TPC‐1 and B‐CPAP cells. These data indicate that miR‐497‐5p may be involved in the growth and invasion of PTC cells.

FIGURE 4.

FIGURE 4

miR‐497‐5p negatively regulates proliferation and invasion of PTC cells. (A) Satisfactory transfection efficiency was revealed by the expression of miR‐45 mimics or inhibitor. (B) Colony formation assay was used to detect the function of miR‐497‐5p in B‐CPAP and TPC‐1 cells growth. (C) Transwell was employed to exam the function of miR‐497‐5p in cell invasion. (D) The expressions of EMT markers (E‐cadherin and N‐cadherin) were detected using western blot analysis. Data are presented as the mean ± SD of three independent experiments. ** P < 0.01 versus miR‐ctrl or anti‐miR‐ctrl

3.5. LINC01315 serves as a “sponge” for miR‐497‐5p

Rescue experiments were performed to determine whether LINC01315 influences the growth and invasion of PTC cells by sponging miR‐497‐5p. pcDNA3.1 or pcDNA3.1/LINC01315 were transfected into B‐CPAP cells that have been transfected with miR‐497‐5p mimic (Figure 5(A)). The results of the colony formation assay showed that weakened decrease in the growth of B‐CPAP cells induced by miR‐497‐5p is in part abrogated by transfection of pcDNA3.1/LINC01315 (Figure 5(B)). Consistently, the invasion of B‐CPAP cells suppressed by miR‐497‐5p is partially rescued by the introduction of pcDNA3.1/LINC01315 (Figure 5(C)). Additionally, sh‐LINC01315 or sh‐ctrl were transfected into TPC‐1 cells that have been transfected with anti‐miR‐497‐5p (Figure 5(D)). The data of the colony formation assay showed that the growth of TPC‐1 cells promoted by ant‐miR‐497‐5p is partially abolished by transfection of sh‐LINC01315 (Figure 5(E)). Similarly, the results of the Transwell assay indicated that a decrease in the invasion induced by anti‐miR‐497‐5p is partially abolished by sh‐LINC01315 (Figure 5(F)). These data indicate that LINC01315 contributes to the progression of TPC‐1 cells by sponging miR‐497‐5p.

FIGURE 5.

FIGURE 5

LINC01315 serves a “sponge” for miR‐497‐5p in PTC cells. (A) B‐CPAP cells were transfected with miR‐497‐5p mimics alone or cotransfected with miR‐497‐5p combination with pcDNA3.1/LINC01315. The level of miR‐497‐5p was measured by qRT‐PCR. (B) Colony formation assay was utilized to detect the growth ability of B‐CPAP cells transfected with miR‐497‐5p mimics alone or cotransfected with miR‐497‐5p combination with pcDNA3.1/LINC01315. (C) Transwell assay was utilized to detect the invasion capability of ability of B‐CPAP cells transfected with miR‐497‐5p mimics alone or cotransfected with miR‐497‐5p combination with pcDNA3.1/LINC01315. ** P < 0.01 versus miR‐ctrl, ## P < 0.01 versus miR‐497‐5p + pcDNA3.1. (D) TPC‐1 cells were transfected with anti‐miR‐497‐5p alone or cotransfected with anti‐miR‐497‐5p combination with sh‐LINC01315. The level of miR‐497‐5p was measured by qRT‐PCR. (E) Colony formation assay was utilized to detect the growth ability of TPC‐1 cells. (F) Transwell assay was utilized to detect the invasion capability of ability of TPC‐1 cells. Data are presented as the mean ± SD of three independent experiments. ** P < 0.01 versus anti‐miR‐ctrl, ## P < 0.01 versus anti‐miR‐497‐5p + sh‐LINC01315

4. DISCUSSION

Considerable evidence indicates that lncRNAs play key roles in various human cancers, including thyroid cancer. 14 Long noncoding RNAs (lncRNAs) are RNA molecules over 200 nucleotides in length with low protein‐coding potential. 15 LncRNAs function as tumor‐promoting or ‐suppressing factors by influencing key processes, such as migration, invasion, proliferation, and apoptosis, during thyroid cancer pathogenesis. 16 , 17 Although many lncRNAs have been reported to regulate cancer progression, the roles of LINC01315 in the carcinogenesis of thyroid cancer are incompletely understood. In this study, the TCGA thyroid cancer cohort was used to determine that the expression level of LINC01315 is significantly higher in thyroid cancer compared with that in normal tissues indicating the important role of lncRNA in thyroid cancer. Our results demonstrate that the expression of LINC01315 is considerably increased in thyroid cancer tissues and PTC cell lines.

Recent reports have suggested that several lncRNAs can play critical roles in the progression of PTC cells. The results of the loss‐of‐function assays in the present study indicated that LINC01315 silencing inhibits the proliferation and colony formation of PTC cells. However, the upregulation of LINC01315 promotes the proliferation and colony formation of PTC cells indicating that LINC01315 plays a role in the growth regulation similar to other lncRNAs. Our data demonstrate that downregulation of the LINC01315 expression inhibits the invasion of PTC cells. However, overexpression of LINC01315 causes opposite results. EMT refers to the transformation of epithelial cells to a mesenchymal cell phenotype and has an important function in tumor metastasis since EMT may promote the migration and invasion of cancer cells. 18 The data of this study indicate that LINC01315 is involved in EMT of PTC cells. The upregulation of LINC01315 increases the expression of N‐cadherin and reduces the level of E‐cadherin. LINC01315 knockdown causes opposite effects in PTC cells.

Bioinformatic analysis (LncBase Experimental v.2) of miRNA recognition sequences on LINC01315 revealed the presence of binding sites of miR‐497‐5p on LINC01315. Luciferase assay was used to validate the direct binding of miR‐497‐5p to LINC01315. Our data confirmed that miR‐497‐5p is downregulated in thyroid cancer tissues compared with noncancerous tissues, and miR‐497‐5p is a tumor suppressor in PTC cells. These results are in agreement with the results of knockdown of LINC01315 expression. MiR‐497‐5p has been reported as a suppressor in several types of cancer, including lung cancer, melanoma, and gastric cancer. 19 Importantly, rescue assays indicated that LINC01315 abolishes the impact of miR‐497‐5p on the growth and invasion of PTC cells. The growth and invasion of thyroid cancer cells are regulated by many signaling pathways, including PI3K‐AKT, TGF‐β1/Smads, and Wnt/β‐catenin. 16 , 17 , 20 It is reported that LINC01315 exhibits pro‐oncogenic function in colorectal carcinoma cells invasion by positively modulated protein kinase AMP‐activated catalytic subunit α 1 (PRKAA1) expression. 21 In the future studies, we plan to use the gene microarray technique to identify the metastasis‐associated genes influenced by LINC01315. Meanwhile, the limitations of this study should not be overlooked. First of all, the number of cases analyzed is low. Thyroid cancers have been sub‐classified as follicular (FTC), papillary (PTC), or anaplastic (ATC) thyroid cancer. The FTC and PTC forms are characterized as differentiated cancers, and the PTCs alone account for approximately 80% of all thyroid tissue malignancies. Further in‐depth studies of various types of thyroid cancer are recommended. More importantly, the cell lines we chose here were derived from the major pathological type of thyroid cancer, PTC. The cell types are not be abundant enough for further validation of the great significance of LINC01315 in the progression of thyroid cancer, including FTC and ATC. Future studies will need to address these questions.

In conclusion, our study demonstrates that LINC01315 is upregulated in thyroid cancer and serves as a potential oncogene. LINC01315 promotes the growth and invasion of PTC cells. miR‐497‐5p may be a potential target of LINC01315. LINC01315 regulates the aggressiveness of PTC cells by serving as a “sponge” for miR‐497‐5p. These results suggest potential application of LINC01315 in the treatment of thyroid cancer.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Ren J, Zhang F‐J, Wang J‐H, Tang J‐D. LINC01315 promotes the aggressive phenotypes of papillary thyroid cancer cells by sponging miR‐497‐5p. Kaohsiung J Med Sci. 2021;37:459–467. 10.1002/kjm2.12369

REFERENCES

  • 1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2019. CA Cancer J Clin. 2019;69(1):7–34. [DOI] [PubMed] [Google Scholar]
  • 2. Lin P, Guo YN, Shi L, Li XJ, Yang H, He Y, et al. Development of a prognostic index based on an immunogenomic landscape analysis of papillary thyroid cancer. Aging. 2019;11(2):480–500. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Zhou X, Xia E, Bhandari A, Zheng C, Xiang J, Guan Y, et al. LRP4 promotes proliferation, migration, and invasion in papillary thyroid cancer. Biochem Biophys Res Commun. 2018;503(1):257–263. [DOI] [PubMed] [Google Scholar]
  • 4. Li ZX, Zhu QN, Zhang HB, Hu Y, Wang G, Zhu YS. MALAT1: a potential biomarker in cancer. Cancer Manag Res. 2018;10:6757–6768. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 5. Yang L, Peng X, Li Y, Zhang X, Ma Y, Wu C, et al. Long non‐coding RNA HOTAIR promotes exosome secretion by regulating RAB35 and SNAP23 in hepatocellular carcinoma. Mol Cancer. 2019;18(1):78. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Ding D, Li C, Zhao T, Li D, Yang L, Zhang B. LncRNA H19/miR‐29b‐3p/PGRN axis promoted epithelial‐mesenchymal transition of colorectal cancer cells by acting on Wnt signaling. Mol Cells. 2018;41(5):423–435. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Wang L, Cao L, Wen C, Li J, Yu G, Liu C. LncRNA LINC00857 regulates lung adenocarcinoma progression, apoptosis and glycolysis by targeting miR‐1179/SPAG5 axis. Hum Cell. 2020;33(1):195–204. [DOI] [PubMed] [Google Scholar]
  • 8. Wu X, Xiao Y, Zhou Y, Zhou Z, Yan W. LncRNA FOXP4‐AS1 is activated by PAX5 and promotes the growth of prostate cancer by sequestering miR‐3184‐5p to upregulate FOXP4. Cell Death Dis. 2019;10(7):472. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9. Tian Z, Cao S, Li C, Xu M, Wei H, Yang H, et al. LncRNA PVT1 regulates growth, migration, and invasion of bladder cancer by miR‐31/ CDK1. J Cell Physiol. 2019;234(4):4799–4811. [DOI] [PubMed] [Google Scholar]
  • 10. Zhou T, Zhong M, Zhang S, Wang Z, Xie R, Xiong C, et al. LncRNA CASC2 expression is down‐ regulated in papillary thyroid cancer and promotes cell invasion by affecting EMT pathway. Cancer Biomark. 2018;23(2):185–191. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Wu DM, Wang S, Wen X, Han XR, Wang YJ, Shen M, et al. LncRNA SNHG15 acts as a ceRNA to regulate YAP1‐hippo signaling pathway by sponging miR‐200a‐3p in papillary thyroid carcinoma. Cell Death Dis. 2018;9(10):947. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Gao W, Chan JY, Wong TS. Differential expression of long noncoding RNA in primary and recurrent nasopharyngeal carcinoma. Biomed Res Int. 2014;2014:404567. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13. Naorem LD, Prakash VS, Muthaiyan M, Venkatesan A. Comprehensive analysis of dysregulated lncRNAs and their competing endogenous RNA network in triple‐negative breast cancer. Int J Biol Macromol. 2020;145:429–436. [DOI] [PubMed] [Google Scholar]
  • 14. Zhao H, Huang T, Li H. Risk factors for skip metastasis and lateral lymph node metastasis of papillary thyroid cancer. Surgery. 2019;166(1):55–60. [DOI] [PubMed] [Google Scholar]
  • 15. Xu W, Hu GQ, Da Costa C, Tang JH, Li QR, Du L, et al. Long noncoding RNA UBE2R2‐AS1 promotes glioma cell apoptosis via targeting the miR‐877‐3p/TLR4 axis. Onco Targets Ther. 2019;12:3467–3480. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Liu H, Deng H, Zhao Y, Li C, Liang Y. LncRNA XIST/miR‐34a axis modulates the cell proliferation and tumor growth of thyroid cancer through MET‐PI3K‐AKT signaling. J Exp Clin Cancer Res. 2018;37(1):279. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 17. Chen Y, Gao H, Li Y. Inhibition of LncRNA FOXD3‐AS1 suppresses the aggressive biological behaviors of thyroid cancer via elevating miR‐296‐5p and inactivating TGF‐beta1/Smads signaling pathway. Mol Cell Endocrinol. 2020;500:110634. [DOI] [PubMed] [Google Scholar]
  • 18. Wang Y, Gu J, Lin X, Yan W, Yang W, Wu G. lncRNA BANCR promotes EMT in PTC via the Raf/MEK/ERK signaling pathway. Oncol Lett. 2018;15(4):5865–5870. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Chai L, Kang XJ, Sun ZZ, Zeng MF, Yu SR, Ding Y, et al. MiR‐497‐5p, miR‐195‐5p and miR‐455‐3p function as tumor suppressors by targeting hTERT in melanoma A375 cells. Cancer Manag Res. 2018;10:989–1003. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Ding S, Qu W, Jiao Y, Zhang J, Zhang C, Dang S. LncRNA SNHG12 promotes the proliferation and metastasis of papillary thyroid carcinoma cells through regulating Wnt/beta‐catenin signaling pathway. Cancer Biomark. 2018;22(2):217–226. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Liang R, Zhang J, Zhang RM, Qiu H. LINC01315 silencing inhibits the aggressive phenotypes of colorectal carcinoma by sponging miR‐205‐3p. Biochem Biophys Res Commun. 2021;534:1033–1039. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES