Herp knockout protects against nonalcoholic fatty liver disease in mice on a high fat diet

Abstract

This study aims to discover the role of Homocysteine‐induced ER protein (Herp) deficiency in high‐fat diet (HFD)‐induced nonalcoholic fatty liver disease (NAFLD). After 8 weeks of feeding with normal‐fat diet (NFD) or HFD, WT (wild type) and Herp ^−/− mice were measured for the body weight, liver weight and serum biochemical parameters. HE, Oil Red O, and Sirius red stainings were used to evaluate the histopathological changes of liver tissues. QRT‐PCR, Western blotting and Immunohistochemistry were employed to detect the mRNA and protein expression. TUNEL staining was used to observe the hepatocyte apoptosis. Herp knockout reduced the liver/body weight ratio of mice fed with HFD with the decreased serum levels of TG, TC, HDL, LDL, GGT, Hcy, ALT, and AST. Besides, WT mice fed with HFD presented obvious steatosis, inflammation and hepatocytes ballooning, which was relieved in Herp ^−/− mice. HFD‐induce NFALD mice demonstrated increased Oil Red, Sirius red, and α‐SMA staining than NFD‐induced mice, but mice in the Herp ^−/− + HFD group was lower than the WT + HFD group. HFD‐induce NFALD mice showed up‐regulated expression of Grp78, Chop, and Atf4 in liver tissues when compared with NFD fed mice. However, regarding to the mice fed with HFD, Herp deficiency decrease in the expression of Grp78, Chop, and Atf4 in liver tissues with the reduced hepatocyte apoptosis. Herp was highly expressed in HFD‐induced NAFLD mice. Herp knockout improved liver function and histopathological conditions with the decreased hepatocyte apoptosis and endoplasmic reticulum stress (ERS) of HFD‐induce NFALD mice.

1. INTRODUCTION

Nonalcoholic fatty liver disease (NAFLD), the most common cause of abnormal liver function test, is the most prevalent liver disease containing a series of disease status. ¹ From initial simple steatosis, this disease can develop into pathological nonalcoholic steatohepatitis (NASH) to further cause liver fibrosis and even other end‐stage liver diseases, such as liver cirrhosis, liver failure and liver cancer. ² , ³ Endoplasmic reticulum (ER) is an important organelle responsible for protein synthesis and processing, lipid metabolism, and calcium storage. ⁴ There are a lot of ER in liver cells, and their cavity is rich in triacylglycerol synthetase and acyl‐CoA transferase, thus involving in fatty acid metabolism and functioning as the primary place of fatty acid metabolism. ⁵ Once the balance of ER homeostasis is broken, the accumulation of misfolded proteins in the ER would induce endoplasmic reticulum stress (ERS), and the deepening of research also demonstrates a close association between ERS and the occurrence of NAFLD. ⁶ , ⁷

Homocysteine‐induced ER protein (Herp), encoded by homocysteine‐inducible, endoplasmic reticulum stress‐inducible, ubiquitin‐like domain member 1 (HERPUD 1), functions as a stress‐response protein in the ER membrane with the molecular weight of 54 kDa. ⁸ , ⁹ As an ERS‐related protein, the expression of Herp could be enhanced by ERS inducers, such as 2‐mercaptoethanol, tunicamycin, carotene and A23187. ⁸ In addition, Herp was found to be widely and highly expressed in many tissues and organs, including heart, liver, skeletal muscles, kidney and pancreas. As is known to all, NAFLD is often coexisted with disorders, like insulin resistance, type 2 diabetes mellitus (T2DM), and coronary atherosclerosis, which is collectively referred as the metabolic syndrome. ¹⁰ Meanwhile, Herp was shown to be linked to T2DM, and the deficiency of Herp was reported to hinder atherosclerosis development by reducing ERS‐induced inflammatory reactions according to a previous study. ¹¹ , ¹² However, it has not been elucidated whether Herp could influence the occurrence and development of NAFLD. Currently, studies on NASH pathogenesis and therapeutic efficacy have been mainly conducted by using animal models, and HFD‐induced NAFLD model is most similar to human NAFLD, which could increase the body weight and body fat content, as well as induce insulin resistance. ¹³ , ¹⁴ Thus, we detected the Herp expression in the liver tissues of HFD‐induce NFALD mice and then investigated the effect of Herp knockout on NAFLD by feeding mice with HFD/NFD in this work.

2. MATERIALS AND METHODS

2.1. Ethics statement

This study was conducted in compliance with Guide for the Care and Use of Laboratory Animals, ¹⁵ and all animal experiments were performed under the supervision of Medical Ethics Committee of Laboratory Animals in our hospital.

2.2. Establishment of NAFLD model in mice

Herp ^−/− mice and WT mice were provided by Jackson Laboratory (USA) and kept in an animal room at 21 ± 2°C with the humidity of 55%–70% under the 12 h light/12 h darkness cycle. Four groups were set with 10 mice in each group: WT + NFD group, WT + HFD group, Herp ^−/− + NFD group and Herp ^−/− + HFD group. Among them, Herp ^−/− + NFD and WT + NFD groups were fed on normal‐fat diet (NFD, 3.85 kcal/g, 10% calories from fat, 20% calories from protein, and 70% calories from carbohydrate), while Herp ^−/− + HFD and WT + HFD groups were given high‐fat diet (HFD, 5.24 kcal/g, 60% calories from fat, 20% calories from protein, and 20% calories from carbohydrate). The NFD and HFD were bought from Research Diets Inc. The changes in body weight (BW) gain were recorded during the 8 weeks of feeding. At the end of the experiment, the mice were sacrificed under anesthesia.

2.3. Serum biochemical assay

Direct cardiac puncture was used to draw blood samples, which were placed at room temperature for 1 h of coagulation. Next, blood samples were centrifuged at the rate of 3000 rpm for 15 min to collect serum. To quantify the serum levels of glucose, γ‐glutamyltransferase (GGT), triglycerides (TG), total cholesterol (TC), alanine aminotransferase (ALT), aspartate aminotransferase (AST), as well as low‐density lipoprotein (LDL) and high‐density lipoprotein (HDL) cholesterol, biochemical assays were performed using Fuji Dri‐Chem NX500 (Fujifilm Corporation®) in accordance with the manufacturer's instructions. Serum homocysteine (Hcy) and insulin levels were determined by enzyme immunoassay kit (IBL International GmbH Diagnostics, Hamburg, Germany) and ELISA Kit (Shibayagi), respectively. The homeostatic model assessment‐insulin resistance (HOMA‐IR) index = fasting serum glucose (mmol/L) × fasting serum insulin (μU/ml)/22.5. ¹³

2.4. Acquisition and preservation of mouse liver tissues

The intact liver of mouse was taken out carefully and weighed (wet weight). The liver was divided into three parts, with one part fixed in 4% paraformaldehyde, embedded in paraffin, and made into routine pathological sections, one part embedded in optimal cutting temperature (OCT) compound and made into frozen sections, and the third part rapidly frozen in liquid nitrogen and preserved at −80°C for RNA and protein quantification.

2.5. HE staining

Tissue sections (4 μm) were deparaffinized with xylene, dehydrated with gradient alcohol, stained for 5 min in Hematoxylin Stain, and rinsed with tap water. Then, after differentiated with 1% hydrochloric ethanol, the tissues were rinsed with tap water for 5 min, stained for 3 min in 1% Eosin alcohol, differentiated for 30 s in 90% alcohol, washed for 1 min with 95% alcohol, washed for 1 min with xylene carbonate, and rinsed with xylene 3 times × 2 min. The sections were finally mounted with neutral resin prior to observation under a microscope. Steatosis was represented by the percentage of hepatocytes with fat droplets and scored as 0 (<0.5%), 1 (5%–33%), 2 (>33%–66%), or 3 (>66%). Hepatocyte ballooning was scored as 0 (none), 1 (few cells), or 2 (many cells). Lobular inflammation was scored as 0 (no foci), 1 (<2 foci per field), 2 (2–4 foci), or 3 (>4 foci). NAFLD activity score was calculated by taking into consideration the steatosis, inflammation, and ballooning scores. ¹⁶

2.6. Oil red staining and sirius red staining

Liver tissues were fixed in 4% paraformaldehyde for 24 h, embedded with OCT, cut into sections (10 μm). Then the sections were treated with distilled water and 60% isopropanol, stained in Oil Red stain for 30 min, washed with distilled water three times, and finally stained in Hematoxylin, prior to observation and evaluation under a microscope. Sirius red staining was done with the paraffin sections by following the instruction of the commercial kit (Abcam). Sirius red positive areas were quantified using Image J software (National Institutes of Health).

2.7. Immunohistochemistry

Epitope retrieval was done in an antigen retrieval buffer for 20 min that had been heated in a water bath. Peroxidase blocking solution was then applied to the sections, followed by incubating with the goat serum blocking solution. The tissue sections were then incubated in a monoclonal antibody against α‐SMA (ab7817, 0.034 μg/ml, Abcam, USA) for 30 min at 37°C and overnight at 4°C, followed by incubation with a secondary antibody and the streptavidin‐HRP for 30 min at room temperature. The sections were then developed with diaminobenzidine solution (DAB) for 1–3 min.

2.8. qRT‐PCR

The RNeasy Mini kit (Qiagen) was used to extract total RNA, which was quantified for RNA content using an ultraviolet spectrophotometer. Omniscript Reverse Transcription (Qiagen) was used for the reverse transcription of RNA into cDNA, which was employed as template for PCR reaction. Primers were designed using Primer 5.0 and synthesized by GenScript (Nanjing) Co., Ltd. The primers were as follows: Herp: 5′‐ATCAGAACTTGCGGATGAATG‐3′; 5′‐GTTATTGTTGGGGTCCTCCTGGTT‐3′; Grp78: 5′‐TGGAGTTCCCCAGATTGAAG‐3′; 5′‐GCGCTCTTTGAGCTTTTTGT‐3′; Atf4: 5′‐CCGAGATGAGCTTCCTGAAC‐3′; 5′‐ACCCATGAGGTTTCAAGTGC‐3′; Chop: 5′‐CTGCCTTTCACCTTGGAGAC‐3′; 5′‐CGTTTCCTGGGGATGAGATA‐3′; β‐actin: 5′‐TGTTACCAACTGGGACGACA‐3′; 5′‐GGGGTGTTGAAGGTCTCAAA‐3′. Then, qRT‐PCR were conducted according to instructions of PCR kit (KR011A1, Tiangen Biotech (Beijing) Co., Ltd.) and relative expression of target genes was calculated using 2^‐△△Ct method.

2.9. Western blotting

Total proteins of liver tissues were extracted, and determined for the protein concentration using BCA assay. The protein samples were adjusted to the same level regarding protein content and loading volume. Polyacrylamide gel electrophoresis was performed to separate proteins, which were transferred to Polyvinylidene fluoride (PVDF) membranes using semi‐dry transfer system (Bio‐Rad). The membrane was blocked in skimmed milk at room temperature and washed with PBST buffer, before the addition of primary antibodies for 1 h reaction at room temperature: anti‐Grp78 antibody (ab21685, 1/1000 dilution, Abcam), anti‐Atf‐4 antibody (ab23760, 1 μg/ml), anti‐Chop antibody (ab11419, 1/1000 dilution), and anti‐β‐actin antibody‐loading control (ab8224, 1 μg/ml). Next, the membrane was washed with PBST for 5 times × 3 min, incubated for 1 h with horseradish peroxidase (HRP) labeled Goat anti rabbit IgG (Beijing Zhongshan Gold Bridge Biotechnology Co., Ltd.), and rinsed with PBST for 5 times × 3 min. HRP substrate (Bio‐Rad) was used for visualization of target proteins. The relative expression of target protein was set as the gray value ratio of target protein to β‐actin.

2.10. TUNEL staining

Liver tissues were washed with xylene 2 times × 5 min, dehydrated with gradient alcohol (100%, 95%, 90%, 80%, 70%), and washed twice with PBS. Next, tissues were treated with Proteinase K working solution for 15–30 min, washed twice with PBS, blended with 50 μl TUNEL reaction mixture for 1 h reaction at 37°C in a dark wet box, and washed again three times with PBS. Then, 50 μl converter‐POD was added to tissue samples for 30 min of reaction at 37°C in a dark wet box, followed by washing three times with PBS and addition of 50–100 μl DAB substrate for 10 min of reaction at 15–25°C. Subsequently, tissues were washed with PBS three times, counterstained in Hematoxylin, rinsed with tap water, dehydrated in gradient alcohol, hyalinized with xylene, and mounted with neutral resin. The number of apoptotic bodies per high‐power field was counted.

2.11. Statistical methods

All statistical data were analyzed using SPSS 22.0 (SPSS, Inc). Measurement data were presented by mean ± standard deviation. Comparison among multiple groups was analyzed using One‐Way ANOVA, while inter‐group difference was compared using Turkey HSD's test. p < 0.05 was regarded as statistical significance.

3. RESULTS

3.1. Effects of Herp knockout on body weight (BW) and liver weight of HFD‐induce NFALD mice

As shown in Figure 1(A), during the 8 weeks of feeding, mice fed with HFD significantly increased in cumulative BW gain when compared with mice fed with NFD. However, Herp knockout can effectively reduce the cumulative BW gain induced by HFD. Besides, HFD also led to an apparent increase of liver weight and liver/body weight ratio in mice after 8 weeks of feeding (all p < 0.05). Compared with WT + HFD group, Herp ^−/− + HFD group declined obviously regarding liver weight and liver/body weight ratio (p < 0.05, Figure 1(B),(C)).

FIGURE 1.

Effects of Herp knockout on body weight and liver weight of HFD‐induce NFALD mice. Note: (A) The cumulative body weight (BW) gain in mice of each group during treatment; (B) and (C), The liver weight (B) and the ratio of liver weight to body weight (C) of mice in each group after 8 weeks; *, p < 0.05 compared with WT + NFD group; #, p < 0.05 compared with Herp ^−/− + NFD group; &, p < 0.05 compared with WT + HFD group; HFD, high‐fat diet; NFD, normal‐fat diet

3.2. Effects of Herp knockout on serum biochemical parameters of HFD‐induce NFALD mice

As shown in Figure 2(A)–(H), there was no difference regarding serum biochemical parameters, including TG, TC, HDL, LDL, GGT, Hcy, ALT, and AST between Herp ^−/− + NFD group and WT + NFD group (all p > 0.05). However, mice in the WT + HFD group had higher serum TG, TC, HDL, LDL, GGT, Hcy, ALT, and AST levels than those in the WT + NFD group, but mice in the Herp ^−/− + HFD group showed declined serum TG, TC, HDL, LDL, GGT, Hcy, ALT, and AST levels than those in the WT + HFD group (all p < 0.05).

FIGURE 2.

Effects of Herp knockout on serum biochemical parameters of HFD‐induce NFALD mice. Note: (A) Triglycerides (TG, mg/dl); (B) Total cholesterol (TC, mg/dl); (C) High density lipoprotein (HDL, mg/dl); (D) Low density lipoprotein (LDL, mg/dl); (E) γ‐glutamyltransferase (GGT, IU/L); F: Homocysteine (Hcy, μmol/L); (G) Alanine aminotransferase (ALT, U/L); (H) Aspartate aminotransferase (AST, U/L); (I) Serum glucose (mg/dl); (J) Serum insulin (ng/ml); (K) Homeostatic model assessment‐insulin resistance (HOMA‐IR); *, p < 0.05 compared with WT + NFD group; #, p < 0.05 compared with Herp ^−/− + NFD group; &, p < 0.05 compared with WT + HFD group; HFD, high‐fat diet; NFD, normal‐fat diet

3.3. Effects of Herp knockout on insulin resistance and insulin sensitivity of HFD‐induce NFALD mice

The HFD impaired both glucose tolerance and insulin sensitivity with increased serum glucose, serum insulin and HOMA‐IR (all p < 0.05, Figure 2(I)–(K)). Herp knockout significantly suppressed the increases in the insulin and glucose levels, as well as the HOMA‐IR value in HFD‐induce NFALD mice (all p < 0.05).

3.4. Herp knockout ameliorates histopathological conditions of HFD‐induce NFALD mice

The liver tissues of mice were performed by HE staining in Figure 3(A)–(D). Mice fed with NFD presented hepatocytes with clear structure and orderly arrangement, without obvious inflammation, while mice in WT + HFD group showed apparent steatosis accompanied by obvious inflammation and ballooning degeneration of hepatocytes, which was significantly alleviated in mice of Herp ^−/− + HFD group (all p < 0.05). From Figure 3(E), Herp ^−/− + NFD group and WT + NFD group had no obvious difference in NAFLD activity score (p > 0.05). However, Herp ^−/− + HFD group was decreased remarkably in NAFLD activity score when compared with WT + HFD group (all p < 0.05), but it was still higher than Herp ^−/− + NFD group (all p < 0.05). Besides, Oil Red staining was also conducted on the liver tissues of mice in each group (Figure 3(F),(G)). As a result, mice fed with HFD were obviously higher than NFD mice regarding Oil Red positive area, but those in the Herp ^−/− + HFD group was lower in Oil Red positive area than those in the WT + HFD group (all p < 0.05).

FIGURE 3.

Herp knockout ameliorates histopathological conditions of HFD‐induce NFALD mice. Note: (A) Histopathological conditions of liver tissues of mice from each group observed after HE staining; (B)–(E) Histology scores for liver steatosis (B), inflammation (C), hepatocyte ballooning (D), and NAFLD activity score (E); (F) and (G), Oil Red staining (F) and Oil Red positive area (G) of liver tissues of mice in each group; *, p < 0.05 compared with WT + NFD group; #, p < 0.05 compared with Herp ^−/− + NFD group; &, p < 0.05 compared with WT + HFD group; HFD, high‐fat diet; NFD, normal‐fat diet

3.5. Herp knockout protects against liver fibrosis in HFD‐induce NFALD mice

The effect of Herp knockout on liver fibrosis was examined based on Sirius red staining (Figure 4(A),(B)) and α‐SMA immunohistochemistry (Figure 4(C)), which revealed that administration of HFD diet resulted in signs of fibrosis (p < 0.05), and the Herp ^−/− mice fed with HFD showed alleviated liver fibrosis as compared with the WT fed with HFD (p < 0.05). On the contrary, no substantial Sirius red or α‐SMA staining in either WT or Herp ^−/− NFD‐fed mice (p > 0.05). The result of α‐SMA mRNA expression detected using qRT‐PCR was similar with the protein expression in liver tissues (Figure 4(D)).

FIGURE 4.

Herp knockout protects against liver fibrosis in HFD‐induce NFALD mice. (A)–(C) The liver fibrosis in mice was examined using Sirius red staining (A) and (B) and α‐SMA immunohistochemistry (C); (D) Gene expression of α‐SMA in liver tissues of mice detected by qRT‐PCR; *, p < 0.05 compared with WT + NFD group; #, p < 0.05 compared with Herp ^−/− + NFD group; &, p < 0.05 compared with WT + HFD group; HFD, high‐fat diet; NFD, normal‐fat diet

3.6. Herp knockout alleviates endoplasmic reticulum stress (ERS) in liver tissues of HFD‐induce NFALD mice

The results of Herp protein expression in liver tissues of mice were illustrated in Figure 5(A),(B). Obviously, Herp expression was not observed in mice with Herp knockout. Compared with WT + NFD group, the Herp expression level in liver tissues of WT + HFD group was increased significantly (all p < 0.05). Western blotting was conducted to quantify the expression of endoplasmic reticulum stress (ERS)‐related proteins, including Grp78, Chop, and Atf4. According to the results, mice fed with HFD were remarkably increased in Grp78, Chop, and Atf4 protein expression (all p < 0.05). Compared with WT + HFD group, mice in Herp ^−/− + HFD group were apparently reduced in these protein expressions (all p < 0.05). However, WT + NFD group and Herp ^−/− + NFD group had no observable difference regarding the above indicators (all p > 0.05). The results of qRT‐PCR demonstrated that the expression of ERS‐related mRNAs was consistent with their corresponding protein expressions (Figure 5(C)).

FIGURE 5.

Herp knockout alleviates endoplasmic reticulum stress (ERS) in liver tissues of HFD‐induce NFALD mice. Note: (A) and (B) Protein expression of Herp, Grp78, Chop, and Atf4 in liver tissues of mice detected by Western blotting; (C) Gene expression of Herp, Grp78, Chop, and Atf4 in liver tissues of mice detected by qRT‐PCR; *, p < 0.05 compared with WT + NFD group; #, p < 0.05 compared with Herp ^−/− + NFD group; &, p < 0.05 compared with WT + HFD group; HFD, high‐fat diet; NFD, normal‐fat diet

3.7. Herp knockout reduces hepatocyte apoptosis of HFD‐induce NFALD mice

As illustrated by TUNEL staining results in Figure 6, mice fed with HFD were aggravated significantly in hepatocyte apoptosis (all p < 0.05). WT + NFD group and Herp ^−/− + NFD group did not differ from each other regarding hepatocyte apoptosis (all p > 0.05). However, in comparison with WT + HFD group, Herp knockout can significantly reduce the hepatocyte apoptosis in liver tissues of HFD‐induce NFALD mice (all p < 0.05).

FIGURE 6.

Herp knockout reduces hepatocyte apoptosis of HFD‐induce NFALD mice observed by TUNEL staining. Note: The number of apoptotic bodies per high‐power field (HPF) was measured; *, p < 0.05 compared with WT + NFD group; #, p < 0.05 compared with Herp ^−/− + NFD group; &, p < 0.05 compared with WT + HFD group; HFD, high‐fat diet; NFD, normal‐fat diet

4. DISCUSSION

Herp was a homocysteine‐induced ER protein initially found up‐regulated in vascular endothelial cells under the effect of Homocysteine (Hcy). ¹² In our study, the HFD‐induced NAFLD mice had increased Hcy level. Similarly, a recent study identified the elevated plasma Hcy level in NAFLD patients, ¹⁷ and this level exhibited a relation with the grade of hepatocellular ballooning and the stage of liver fibrosis. ¹⁸ Here in this study, mice fed with HFD had significantly increased Herp expression, which may result from the fact that Herp is the most inducible protein during ER‐stress. ⁹ Many animal studies have stated a relationship between ERS and NAFLD. For example, environmental pollutants‐induced ERS in combination with the unfolded protein response (UPR) activation were likely to induce NAFLD development in male zebrafish. ¹⁹ Also, TMAO mitigated hepatic ERS and cell apoptosis under cholesterol overload, and thereby alleviating steatohepatitis in high‐fat high‐cholesterol (HFHC) diet‐induced rats. ²⁰

As we know, obesity can lead to NAFLD, which is characterized by an increase in the intrahepatic TG content. ²¹ It is reported that HFD induces NAFLD by inducing insulin resistance, which impaires the glucose‐lowering effect of insulin and causes the increased TG and TC levels in serum, ¹⁴ and it also increases body and liver weights and elevates the levels of hepatic injury markers in mice, thus resulting in the development of hepatic steatosis and injury. ²² In this study, Herp knockout effectively reversed the highly elevated serum levels of TG, TC, HDL, LDL, glucose, insulin, and HOMA‐IR in HFD‐fed mice with reduction in the body weight, liver weight and liver/body weight ratio in mice, indicating that Herp knockout could improve hepatic lipid profiles, glucose tolerance and insulin sensitivity in HFD‐fed mice with the decreased body weight and live weight. However, whether the improvement of biochemical profiles and histopathogic features were directly via the reduction of weight is still unknown, because the effect of Herp knockout on other NASH models showing lean body weight instead of obesity, such as methionine choline‐deficient (MCD) diet induced NASH mice, was not explored. It is well known that the serum levels of ALT and AST, which are major enzymes presented in hepatocytes, would be greatly increased when hepatocytes and mitochondria of liver cells are damaged. ²³ , ²⁴ It is also generally accepted that GGT, which is an enzyme abundant in the liver, is elevated as a result of obesity and liver damage, and thus regarded as one of the predictors of liver mortality. ²² In this study, HFD‐induced Herp ^−/− mice were, and serum TG, TC, GGT, ALT, and AST levels than WT mice, which suggested that Herp knockout can slow down the development and progression of HFD‐induced NAFLD.

According to a previous study, ERS could lead to the increase of cholesterol synthesis in hepatocytes, resulting in lipid deposition and further aggravating NAFLD. ²⁵ Grp78 as a major ER‐resident chaperone and the most abundant glycoprotein in the ER is widely used as a biomarker of ERS for its role in protein folding and ER Ca2⁺ binding, ²⁶ which could be regulated by Herp. ¹² As reported, Herp promoter contains ERS‐responsive elements, including a cisacting element that can be identified by Atf4 (a downstream molecular of PERK). ²⁷ , ²⁸ Besides, knockdown of Herp decreased Chop to activate protective autophagy and inhibit ER stress for cell survival in RAW 264.7 macrophages induced by zearalenone. ²⁹ Furthermore, among the various ER stress‐related proteins, Shohei Shinozaki revealed that the amount of mRNA for Grp78, Chop and Atf4 was significantly lower in Herp ^−/−; apoE^−/− mice than in apoE^−/− mice, while ATF6‐dependent genes (SEL1L and PID1A) were not significantly different between apoE^−/− and Herp ^{−/−. 12} Worth mentioning, significant increases in hepatic markers of ER stress (Atf4, Chop, and Grp78) were found in NASH patients as compared with non‐alcoholic steatosis (NAS) patients. ³⁰ Therefore, we detected the expression of ERS‐related genes (Grp78, Chop, and Atf4) in the liver tissues of mice and observed significantly decreased these gene and protein expressions in Herp knockout mice fed with HFD. Meanwhile, HE, Oil Red O, and Sirius red stainings were also performed to observe the histopathological changes of liver tissues. As a result, Herp knockout can significantly ameliorate the hepatic histopathological conditions, alleviate steatosis, inflammation, and hepatocyte ballooning degeneration, and reduce NAFLD activity score in HFD‐induced NAFLD mice with attenuated fibrosis. In fact, a previous study also revealed that Herp deficiency may reduce inflammatory response by inhibiting the expression of MCP‐1, IL‐1b, and TNF‐a. ¹² All these findings supported that knockdown of Herp can affect ERS‐induced inflammation by regulating the expression of ERS‐response genes.

Furthermore, hepatocyte apoptosis plays an important role in cell inflammation, injury, repair, fibrosis, and even cancer, which is closely related to the development and progression of NAFLD. ³¹ Generally, apoptosis pathways include death receptor signal transduction pathway, mitochondrial signaling pathway, and endoplasmic reticulum pathway. ³² Currently, many studies found inhibiting ERS can significantly reduce hepatocyte apoptosis in NAFLD liver tissues. ³³ , ³⁴ Additionally, Herp, as an ERS‐apoptosis marker, is found involved in the apoptosis of many different cells. ³⁵ As reported by Xiao et al., CsA can promote the expression of Herp, Grp78 and Chop, and thus regulating the renal cell apoptosis. ³⁶ Chen et al. also revealed that Herp depletion can hinder zearalenone‐induced apoptosis of ovarian granulosa cells by activating autophagy and blocking apoptotic pathway. ³⁷ In this study, Herp knockout apparently reduced hepatocyte apoptosis in liver tissues of HFD‐induce NFALD mice, which demonstrated that inhabiting Herp may ameliorate hepatocyte apoptosis by regulating ERS.

To conclude, Herp was highly expressed in liver tissues of HFD‐induced NAFLD mice, whereas Herp knockout can significantly improve liver function, ameliorate hepatic pathological conditions, reduce hepatocyte apoptosis and attenuate ERS in HFD‐induce NFALD mice. The strength of this study is the use of Herp knockout mice, which showed completely inhibited Herp expression in mice. Besides, there are several limitations in our experiment, including certain subjective biases due to the relatively small sample sizes, and some differences in features relevant to human NAFLD. In addition, the corresponding lean and nondiabetic db/m mice fed with MCD diet would be further constructed to explore whether there exist a direct hepatoprotective effect of Herp knockout in treating NASH via controlling the body weight of mice.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

Lei Z‐X, Wang J‐J, Li K, Liu P. Herp knockout protects against nonalcoholic fatty liver disease in mice on a high fat diet. Kaohsiung J Med Sci. 2021;37:487–496. 10.1002/kjm2.12349