Exosomal CLIC1 released by CLL promotes HUVECs angiogenesis by regulating ITGβ1‐MAPK/ERK axis

Abstract

Accumulating evidences have suggested that exosomes are closely associated with tumor progression by affecting cell‐cell communication. Here, we aimed to investigate the roles and regulatory mechanism of exosomes released from chronic lymphocytic leukemia (CLL). The expression levels of genes and proteins in cells and exosomes were examined by quantitative real‐time PCR and Western blotting, respectively. MEC‐1 cell‐derived exosomes were obtained and co‐cultured with human umbilical vein endothelial cells (HUVECs), then the capabilities of cell proliferation, metastasis and angiogenesis of HUVECs were measured by CCK‐8, wound healing, transwell and tube formation assay, respectively. Chloride intracellular channel 1 (CLIC1) was significantly increased in CLL patients and markedly enriched in exosomes secreted by CLL cells. Exosomal CLIC1 secreted from MEC‐1 cells were successfully transferred into HUVECs and significantly promoted the phenotypes of proliferation, metastasis and angiogenesis of HUVECs. Mechanically, exosomal CLIC1 secreted from MEC‐1 cells obviously activated MAPK/ERK signaling through upregulating integrin β1 (ITGβ1) expression in HUVECs. Furthermore, rescue experiments revealed that either silencing ITGβ1 or PD98059 treatment obviously reversed the regulatory effects of exosomal CLIC1 secreted from MEC‐1 cells in HUVECs. In conclusion, CLL cell‐derived exosomes accelerated HUVECs metastasis and angiogenesis through transferring CLIC1 to regulate ITGβ1‐MAPK/ERK signaling, indicating that CLIC1 may be a therapeutic target of CLL exosomes in the tumor microenvironment.

1. INTRODUCTION

Chronic lymphocytic leukemia (CLL) is a malignant tumor originating form hematopoietic tissue with complex etiology, and remains lack of effective treatment in current conditions. ¹ According to clinical statistics, the susceptibility was higher in men than women, and genetic factors may occupy a certain position in the pathogenesis of the disease. ¹ , ² , ³ Additionally, CLL can transform into other malignant lymphoproliferative diseases, such as prolymphocytic leukemia, diffuse large B‐cell lymphoma, or Hodgkin lymphoma, which due to the continuous recirculation of leukemic cells to bone marrow and lymph nodes. ⁴ Mounting reports consider that tumor microenvironment (TME) play critical roles in the development and deterioration of CLL, whereas the mechanism remains not been elucidated.

Exosomes, a small vesicles (50‐150 nm), are generated via an endocytic pathway and enriched with chaperones (HSP70, HSP90) and tetraspanins (CD9, CD63, and CD81). ⁵ Meanwhile, DNA, noncoding RNAs, mRNAs and proteins are specifically present in cell‐released exosomes in response to a wide range of physiological and pathological conditions. ⁶ , ⁷ , ⁸ Previous research has identified that exosomes are effective molecular carriers to regulate the development, diagnosis, and treatment of various diseases. ⁶ For example, exosomes released by acute myeloid leukemia (AML) markedly promoted the proliferation, chemoresistance and angiogenesis of human umbilical vein endothelial cells (HUVECs) by transferring vascular endothelial growth factor (VEGF) and VEGFR messenger RNA. ⁹ Another report also revealed that S100 calcium‐binding protein A9 (S100‐A9), a protein derived from CLL exosomes, could significantly accelerate CLL progression by activating nuclear factor kappa beta (NF‐κB) pathway. ¹⁰ However, the regulatory mechanism of CLL cell‐derived exosome in TME is rarely reported.

The chloride intracellular channel 1 (CLIC1) belongs to p64 family, which mainly exists in the nucleus, but also in the cytoplasm and cell membrane. ¹¹ , ¹² CLIC1, expressed in multiple tissues and organs, is highly conserved throughout evolution and its expression level varies little among different species. Meanwhile, it plays important roles in maintaining membrane stability, inter‐cell transmembrane transport, intracellular pH stability and cell volume. ¹² Recent reports have shown that CLIC1 was upregulated in a variety of cancers, such as nasopharyngeal carcinoma (NPC), gastric cancer (GC), prostate cancer (PCa), and associated with the regulation of multiple biological processes, suggesting CLIC1 might act as a tumor marker. ¹³ , ¹⁴ , ¹⁵ Recently, CLIC1 was also identified to work as a secretion protein that released in extracellular environment through endoplasmic reticulum/golgi pathway. ¹⁶ However, the functions and action network of exogenous CLIC1 remain unclear.

Here, we focused on the exploration of the roles and mechanism of exosomal CLIC1 derived from CLL cells on HUVECs. The results revealed the exosomal CLIC1 derived from CLL cells could be absorbed by HUVECs, thus promoting the capabilities of proliferation, metastasis and angiogenesis of HUVECs by regulating integrin β1 (ITGβ1)‐Mitogen‐activated protein kinase (MAPK)/Extracellular regulated protein kinases (ERK) pathway. Restore experiments further showed that either silencing ITGβ1 or inactivation of MAPK/ERK pathway dramatically impeded the effects of exosomal CLIC1 derived from MEC‐1 cell in HUVECs. These findings confirmed that CLIC1 may be an important therapeutic target of CLL exosomes in the TME.

2. MATERIALS AND METHODS

2.1. Clinical samples

Clinical blood samples were obtained from healthy volunteers and CLL patients, who have not received treatment within 3 months, and the total number of plasma lymphocyte >30 000/mL and a median age at 69.0 years (range, 52‐88 years, n = 16). And the information of patients is shown in Table 1. All patients signed an informed consent form, which was approved by Liaocheng People's Hospital.

TABLE 1.

Clinical information of CLL patients

Case no.	Gender	Age	Rai stage	IgVH
1	F	56	II	UM
2	F	75	I	M
3	F	86	I	M
4	M	61	III	M
5	F	65	IV	UM
6	M	78	0	UM
7	M	73	0	UM
8	M	80	I	M
9	M	65	II	UM
10	F	57	II	M
11	M	53	I	M
12	M	62	III	UM
13	F	69	0	UM
14	F	82	IV	M
15	F	76	II	UM
16	M	70	III	UM

Abbreviation: CLL, chronic lymphocytic leukemia.

2.2. Cell culture

HUVECs (Lonza, Verviers, Belgium) were cultured and grown in endothelial growth medium Bullet Kit (Lonza) according to instructions. Human chronic leukemia lymphocytes cell line (MEC‐1 cells) were obtained from DMSZ (Braunschweig, Germany) and cultured in Iscove's Modified Dulbecco's Medium (Hyclone, Logan, UT) containing 10% fetal bovine serum (FBS, Hyclone, Logan, UT). All cells were maintained at 37°C and 5% CO₂.

2.3. Exosome isolation

The plasmas of CLL patients and the medium supernatant of MEC‐1 cells were collected and centrifuged to isolate cells and debris (400g for 20 minutes, followed by 2000g for 40 minutes), and then filtered (0.45 mm). Exosomes were isolated using ultracentrifugation (110 000g for 70 minutes, 4°C). To remove nonexosomal proteins complexes, we followed by floatation on Opti prep cushion (Axis‐Shield, 17%) with at 4°C, 100000g for 75 minutes. Then, exosomes were washed using PBS and suspended in PBS and filtered (0.45 mm).

2.4. Transmission electron microscopy

Exosomes were isolated from the plasmas of CLL patients and suspended in phosphate belanced solution (PBS), and then 10 μL of the diluted mixture was adsorbed on a copper mesh for 10 minutes. Then, fixed in 3% glutaraldehyde and suspended for 5 minutes at 37°C. Subsequently, the copper mesh was cleaned using deionized water for 10 cycles, 2 minutes each time. Finally, the copper mesh was incubated with uranyl acetate for 1 minute. After drying naturally, the transmission electron microscope (Thermo scientific, New York) was used to take a picture.

2.5. RNA extraction and quantitative real‐time PCR

Total RNA in peripheral blood mononuclear cells (PBMCs) isolated from blood samples and cells were extracted using Trizol reagent (Invitrogen, Carlsbad, CA). The reverse transcription reaction was conducted using reverse transcriptase (Promega, Madison, WI) for generating the first‐strand cDNA. Quantitative real‐time PCR (qRT‐PCR) was performed using SYBR Premix Ex Taq (TaKaRa, Dalian, China) on ABI 7900HT system (Applied Biosystems). The expression levels of genes were analyzed by 2^‐ΔΔCt method. The primers used in this experiment were synthesized by Genechem (Shanghai, China) and the sequence information as follows:

GAPDH: forward 5′‐TGACTTCAACAGCGACACCCA‐3′,

GAPDH: reverse 5′‐CACCCTGTTGCTGTAGCCAAA‐3′;

CLIC1: forward 5′‐ACCGCAGGTCGAATTGTTC‐3′,

CLIC1: reverse 5′‐ACGGTGGTAACATTGAAGGTG‐3′;

ITGβ1: forward 5′‐AGCTGAAGACTATCCCATTGACCTC‐3,

ITGβ1: reverse 5′‐TGGTGTTGTGCTAATGTAAGGCATC‐3′.

2.6. Cell transfection

Briefly, siRNA oligos of ITGβ1 and CLIC1 were designed and synthesized by Ambion (Austin, TX). MEC‐1 cells were transfected with premixture of siRNA by Lipofectamine RNAiMAX (Thermo Fisher, Waltham, MA), which were preincubated for 20 minutes at room temperature. Then the cells were gently rocked at 37°C in incubator for 24 hours. Then, the knockdown efficiencies of ITGβ1 and CLIC1 were determined by qRT‐PCR. Scrambled transfections using nonspecific siRNA were included in each experiment as negative controls.

2.7. CCK‐8 assay

HUVECs were co‐cultured with MEC‐1 cell‐derived exosomes for 0, 24, 48, 72 hours, Then the proliferation ability of HUVECs was determined using Cell Counting Kit‐8 (CCK‐8) (Dojindo Co. Ltd., Kumamoto, Japan). Briefly, 10 μL of CCK‐8 solution was added to each well of 96‐well plates and incubated for another 1 hour at 37°C. The absorbance at 450 nm was measured by SpectraMax M5 ELISA plate reader (Molecular Devices, LLC, Sunnyvale, CA).

2.8. Western blotting

The plasma samples, HUVECs and MEC‐1 cells, exosomes were collected to extract total proteins. The same amounts of protein (20 μg) was analyzed by 12% sodium salt‐polyacrylamide gel electrophoresis (SDS‐PAGE) and then transferred to polyvinylidene fluoride (PVDF) membranes (Millipore, MA). The membranes were separately probed with primary antibodies, including TSG101, CD63, CD81, ITGβ1, ERK, p‐ERK, MMP9, VEGF, CLIC1 (Santa Cruz Biotechnology, Santa Cruz, CA) and β‐actin, MAPK, p‐MAPK (Cell Signaling Technology, Beverly, MA) overnight at 4°C. Then, the membranes were incubated with horseradish peroxidase‐linked anti‐rabbit IgG (Santa Cruz Biotechnology, Santa Cruz, CA) for 1 hour. Protein bands were examined by enhanced chemiluminescence, and analyzed by the Image J software.

2.9. Transwell assay

HUVECs which co‐cultured with MEC‐1 exosomes were estimated for invasion capacity using Matrigel‐coated transwell method. Briefly, 5 × 10⁵ cells (200 μL/well) resuspended in serum‐free medium were seeded into the upper chamber coated with Matrigel, while the lower compartment was added with 600 mL complete medium supplemented with 20% FBS. After incubation for 48 hours at 37°C, the cells on the bottom were fixed with formaldehyde, then stained with crystal violet and counted under a microscope (Olympus Corp. Tokyo, Japan).

2.10. Wound healing assay

The migration of HUVECs co‐cultured with MEC‐1 cell‐derived exosomes were examined using wound healing assays. Cells (5 × 10⁵/mL) were seeded into 6‐well plate and incubated at 37°C for 24 hours. When cells grew to 90% confluent, complete medium was then replaced with serum‐free medium and parallel lines were marked in the dishes using a sterile tip. The Image J software (National Institute of Health, USA) was applied to evaluated the wound wide at 0 and 24 hours.

2.11. Tube formation assay

Tube formation was performed to test the effects of MEC‐1 cell‐secreted exosomes on HUVECs angiogenesis in vitro. Matrigel of endothelial basal medium with 2% FBS was added into 24‐well plate, then MEC‐1 cell exosomes and HUVECs were added into plate and incubated for 6 hours. The Image J software (National Institute of Health, USA) was used to estimate the length of the cable.

2.12. Statistical analysis

The SPSS 19.0 software (IBM, Chicago, IL) was performed to analyze statistical data. All results were presented as the mean ± SD. The student t test or one‐way analysis of variance followed by a post hoc Tukey test was used for calculation of statistical differences. P < .05 was considered to be statistically significant.

3. RESULTS

3.1. CLIC1 was enriched in CLL exosomes

Clinical samples of CLL patients and healthy volunteers were collected to examine the expression level of CLIC1. qRT‐PCR assay implied that the mRNA level of CLIC1 was much higher in CLL patients compared to healthy volunteers (Figure 1A). Next, we isolated and identified exosomes extracted form plasma samples of CLL patients by electron microscope, which described that the size of exosomes was ranging from 50 to 150 nm (Figure 1B). Subsequently, Western blotting was performed to further detect the exosomal markers. Results in Figure 1C verified that marker proteins (CD63, CD81 and TSG101) were enriched in exosomes compared to plasma lysis from the same samples, indicating exosomes were extracted successfully. Meanwhile, the level of CLIC1 in exosomal proteins were quantified and the data discovered that the CLIC1 was upregulated in exosomes isolated from CLL patients compared to healthy volunteers (Figure 1D), indicating that CLIC1 acted as a secretion protein and enriched in CLL exosomes.

FIGURE 1.

CLIC1 was enriched in CLL exosomes. A, The expression of CLIC1 in PBMCs isolated from the blood samples of CLL patients and healthy volunteers was detected using qRT‐PCR. B, Electron microscopy analysis of exosomes extracted from the plasma samples of CLL patients. C, Western blotting assay was used to evaluate the levels of exosomal markers in plasma lysis and exosomes from the samples of CLL patients and healthy volunteers. D, The protein level of CLIC1 was examined by Western blotting in exosomes extracted from the plasma samples of CLL patients and healthy volunteers, and CD63 was visualized as internal charge control. Data are presented as the mean ± SD. *P < .05; **P < .01; ***P < .001. CLIC1, chloride intracellular channel 1; CLL, chronic lymphocytic leukemia; qRT‐PCR, quantitative real‐time PCR; TSG101, tumor susceptibility gene 101 protein

3.2. Exosomal CLIC1 released by MEC‐1 cells were transferred into HUVECs

Previous studies showed that exosomes secreted by tumor cells could act on endothelial cells and induce a series of physiological processes, such as angiogenesis, proliferation and metastasis. ¹⁷ In present study, we mainly explored whether exosomal CLIC1 released by MEC‐1 exosomes transferred into HUVECs. Figure 2A disclosed that the mRNA level of CLIC1 was markedly reduced in HUVECs and MEC‐1 cells by transfecting with siCLIC1. Meanwhile, a similar trend was observed in Western blotting assay, which presented that transfection siCLIC1 markedly decreased the protein level of CLIC1 (Figure 2B). Next, we determined the expression pattern of CLIC1 in MEC‐1 cell‐derived exosomes. Consistently, the result disclosed that CLIC1 was notably decreased in MEC‐1 exosomes after silencing of CLIC1 (Figure 2C). Subsequently, further co‐cultured experiments discovered that MEC‐1 exosomes notably enhanced the protein level of CLIC1 in HUVECs transfected with or without siCLIC1 (Figure 2D), indicating that exosomal CLIC1 secreted by MEC‐1 cells were transfected into HUVECs.

FIGURE 2.

Exosomal CLIC1 released by MEC‐1 cells was transferred into HUVECs. A, qRT‐PCR was used to calculate the transfection efficiency of siCLIC1 in HUVECs and MEC‐1 cells. B, Western blotting assay was used to detect the CLIC1 protein level in HUVECs and MEC‐1 cells. C, Western blotting assay was performed to evaluate the protein level of CLIC1 in exosomes secreted by MEC‐1 cells transfected with or without siCLIC1. D, MEC‐1 cell exosomes were co‐cultured with HUVECs transfected with or without siCLIC1, and then CLIC1 protein was assessed by western blotting. Data are presented as the mean ± SD. *P < .05; **P < .01; ***P < .001. CLIC1, chloride intracellular channel 1; HUVECs, human umbilical vein endothelial cells; qRT‐PCR, quantitative real‐time PCR

3.3. Exosomal CLIC1 released by MEC‐1 cells promoted the metastasis and angiogenesis of HUVECs

To further study the functions of exosomal CLIC1 secreted by MEC‐1 cells on HUVECs, we co‐cultured HUVECs and exosomes secreted by MEC‐1 cells (with or without knockdown of CLIC1). Figure 3A described that MEC‐1 cell exosomes obviously increased CLIC1 expression in HUVECs while CLIC1‐silenced MEC‐1 cell exosomes had no significant effect on CLIC1 expression, compared to control group. The result of CCK‐8 assay implied that MEC‐1 exosomes remarkably enhanced the proliferation of HUVECs, whereas MEC‐1 exosomes transfected with siCLIC1 had no significant effect on HUVECs proliferation (Figure 3B). Concurrently, MEC‐1 exosomes served significantly promotion on the capacities of migration, invasion and angiogenesis of HUVECs, while CLIC1‐silenced MEC‐1 exosomes had no biological roles on HUVECs (Figure 3C‐E). The observations of corroborated that exosomal CLIC1 derived from MEC‐1 cells facilitated that the proliferation, metastasis and angiogenesis of HUVECs.

FIGURE 3.

Exosomal CLIC1 released by MEC‐1 cells promoted the proliferation, metastasis and angiogenesis of HUVECs. Exosomes isolated from MEC‐1 cells transfected with or without siCLIC1 were used to co‐culture with HUVECs. A, The protein level of CLIC1 was tested by Western blotting. B, CCK‐8 was used to detect the proliferation of HUVECs. C, Wound healing was performed to examine the migration of HUVECs. D, The invasion of HUVECs was estimated using transwell. E, Tube formation assay was applied to assess the angiogenesis of HUVECs. Data are presented as the mean ± SD. *P < .05; **P < .01; ***P < .001. CLIC1, chloride intracellular channel 1; HUVECs, human umbilical vein endothelial cells

3.4. ITGβ1 was a downstream target of exosomal CLIC1 secreted by MEC‐1 cells

Relevant studies identified that ITGβ1 was regulated by CLIC1 and associated with activation of MAPK/ERK signaling in vitro. ¹⁴ , ¹⁸ Therefore, qRT‐PCR and Western blotting were measured to clarify the dependency between ITGβ1 and exosomal CLIC1. We found that exosomal CLIC1 derived from MEC‐1 cells significantly increased the expression level of ITGβ1 in HUVECs (Figure 4A, B). Subsequently, we explored the functional effects of ITGβ1 on exosomal CLIC1 secreted by MEC‐1 cells. As shown in Figure 4C, small interfering RNA of ITGβ1 was successfully transfected into HUVECs and markedly reduced ITGβ1 expression. Knockdown of ITGβ1 significantly abolished the promotion on HUVECs proliferation mediated by MEC‐1 exosomes (Figure 4D). As we suspected, the promotion effects of migration, invasion and angiogenesis in HUVECs co‐cultured with MEC‐1 exosomes were dramatically reversed by silencing ITGβ1 (Figure 4E, F). Furthermore, Western blotting assay presented that MEC‐1 exosomes‐activated MAPK/ERK signaling and promoted the expression of angiogenesis‐related proteins (VEGF, MMP‐9) by upregulating ITGβ1(Figure 4H), indicating that ITGβ1 mediated the activation of MAPK/ERK pathway may be related to the regulatory network of exosomal CLIC1. These results illustrated that ITGβ1 was a functional target of exosomal CLIC1 derived from MEC‐1 cells in HUVECs.

FIGURE 4.

ITGβ1 was a downstream target of exosomal CLIC1 secreted by MEC‐1 cells. A, B, The effects of exosomal CLIC1 secreted by MEC‐1 cells on ITGβ1 expression was determined by qRT‐PCR and western blotting. HUVECs were transfected with siNC or siITGβ1, and then co‐cultured with MEC‐1 exosomes. C, The transfection efficiency of siITGβ1 in HUVECs was evaluated using qRT‐PCR. D, CCK‐8 assay was applied to detect the proliferation of HUVECs. E, The migration of HUVECs was assessed by wound healing. F, The invasion of HUVECs was analyzed by transwell. G, Tube formation assay was used to test the angiogenesis of HUVECs. H, The levels of MAPK/ERK signaling and angiogenetic proteins (MMP9, VEGF) in HUVECs were estimated by Western blotting. Data are presented as the mean ± SD. *P < .05; **P < .01; ***P < .001. CLIC1, chloride intracellular channel 1; ERK, extracellular regulated protein kinases; HUVECs, human umbilical vein endothelial cells; ITGβ1, Integrin β1; MAPK, mitogen‐activated protein kinase; MMP9, matrix metalloproteinase‐9; qRT‐PCR, quantitative real‐time PCR; VEGF, vascular endothelial growth factor

3.5. The inactivation of MAPK/ERK pathway abolished the regulatory roles of exosomal CLIC1 secreted by MEC‐1 cells

To explore the functional dependency between MAPK/ERK signaling and exosomal CLIC1 derived from MEC‐1 cells, we co‐cultured MEC‐1 exosomes and HUVECs treated with or without PD98059. Western blotting assay described that PD98059 prominently inhibited MAPK and ERK phosphorylation while had no effects on the protein levels of CLIC1 and ITGβ1 (Figure 5A). Functional analysis suggested that PD98059 remarkably alleviated the promotion of cell proliferation and angiogenesis brought by MEC‐1 exosomes (Figure 5B, C). Consistently, the levels of angiogenesis‐related proteins (VEGF, MMP‐9) were notably decreased by treatment with PD98059 (Figure 5D). All above finding illustrated that the angiogenic capability of exosomal CLIC1 released by MEC‐1 exosomes was relied on the activation of MAPK/ERK signaling.

FIGURE 5.

The inactivation of MAPK/ERK pathway abolished the regulatory roles of exosomal CLIC1 secreted by MEC‐1 cells. MEC‐1 exosomes were co‐cultured with HUVECs treated with or without PD98059. A, The inhibition efficiency of PD98059 was detected using Western blotting. B, CCK‐8 assay was performed to examine the proliferation of HUVECs. C, The angiogenesis of HUVECs was determined by tube formation assay. D, The levels of angiogenetic markers (MMP9, VEGF) in HUVECs were assessed using Western blotting. Data are presented as the mean ± SD. *P < .05; **P < .01; ***P < .001. CLIC1, chloride intracellular channel 1; ERK, extracellular regulated protein kinases; HUVECs, human umbilical vein endothelial cells; ITGβ1, Integrin β1; MAPK, mitogen‐activated protein kinase; MMP9, matrix metalloproteinase‐9; VEGF, vascular endothelial growth factor

4. DISCUSSION

CLL is one of the most common hematologic malignancies in older adults, which clinical manifestations range from asymptomatic, thrombocytopenia, and lymph node, spleen, and liver infections. ³ , ¹⁹ Growing evidences have suggested that exosomes released by CLL were perceived to have essential regulatory roles in many disease‐related events, including TME and angiogenesis. ¹⁰ , ²⁰ , ²¹ For example, exosomal microRNAs (miRNAs) released from CLL cells contributed to the progression of CLL cells through modulating multiple targets, such as Bcl2, c‐Myc, TP53, or STAT3 and the activation of B cells and B cell antigen receptor. ²² Paggetti et al showed that CLL‐derived exosomes elevated the proliferation, migration and the release of inflammatory cytokines of stromal cells, and also increased the angiogenesis of endothelial cells. ²³ Consistently, we also identified that CLL‐derived exosomes could significantly accelerate the capabilities of proliferation, metastasis and angiogenesis of HUVECs through transferring CLIC1, implying that exosomal CLIC1 may exert critical regulation in TME.

CLIC1 belongs to the ion channels of chlorine family, which contains with Cl⁻ permeation pores. ¹⁸ , ²⁴ Numerous studies have confirmed that CLIC1 was upregulated in a variety of tumors and can be used as a poor marker, which involved with the regulation of angiogenesis, migration, invasion and apoptosis. ¹⁴ , ²⁵ Francisco et al have revealed that overexpression of CLIC1 could cooperate with EAG2, leading to the dysregulation of cells volume homeostasis, RNA biosynthesis, and the activation of the p38 MAPK pathway, thus promoting cell proliferation and tumor growth in human medulloblastoma. ²⁶ Moreover, CLIC1 was also affirmed to be a secreted protein, existed in extracellular vesicles comprising exosomes and microvesicles which released by glioblastoma multiforme (GBM) cells, and could regulate the properties of cancer stem cells (CSCs) and pro‐tumorigenic response in GBM progression. ¹⁶ Another study identified that CLIC1 derived from SGC‐7901/VCR cells markedly enhanced the vincristine resistance of SGC‐7901 cells through increasing P‐gp and Bcl‐2. ²⁷ In addition, CLIC1 was confirmed to exist in CLL‐derived exosomes, whereas the roles and potential mechanism remains unknown. ²³ On these bases, we further identified that CLIC1 was higher expressed in CLL patients. Moreover, we also provided evidences to verify that CLIC1 served as a secreted protein, existed in CLL cell‐derived exosomes, which was released in extracellular environment and transferred into HUVECs to enhance the capabilities of proliferation, metastasis and angiogenesis, further confirming that CLIC1 was a regulator of CLL cell‐derived exosomes in the modulation of angiogenic microenvironment.

Integrin, as a transmembrane receptor that mediates the connection between a cell and its external environment, is involved in multiple physiological processes, including cell signaling, angiogenesis and cell movement. ²⁸ ITGβ1, a member of ITG family proteins, has been reported to work as an oncogene in tumorigenesis and development. ²⁸ , ²⁹ Li et al showed that ITGβ1 mediated by Gal‐3 contributed to the formation of Gal‐3 and FOXD1 positive regulatory loop through increasing ETS‐1/FOXD1 expression, and thus accelerating lung cancer aggressiveness. ³⁰ Meanwhile, other studies also suggested that ITGβ1 downregulated by CLIC1 knockdown was related to the regulation of proliferation, metastasis, angiogenesis as well as apoptosis in tumor progression. ¹⁴ , ¹⁸ In current work, a similar mechanism was identified that the expression of ITGβ1 was enhanced by exogenous CLIC1 secreted from MEC‐1 exosomes. Further functional experiments demonstrated that knockdown of ITGβ1 significantly abolished the regulatory roles of exosomal CLIC1 secreted from MEC‐1 cells on proliferation, metastasis and angiogenesis as well as the activation of MAPK/ERK signaling in HUVECs, indicating ITGβ1 was an action target of exogenous CLIC1.

MAPK/ERK signaling pathway is critical component in various processes including differentiation, proliferation, migration, and angiogenesis in a variety of human diseases development. ³¹ , ³² Clinical heterogeneity study on CLL showed that aberrant activation of MAPK‐ERK signaling promoted CLL cells proliferation and survival, and was closely related the dysregulation of homeostatic mechanisms in CLL cells. ³³ Wang et al also reported that MAPK/ERK signaling activated by CLIC1 could promote the migration and invasion of colon cancer cells. ¹⁵ Another report on GC revealed that the activation of MAPK/ERK and MAPK/p38 pathways was closely related with the regulatory effects of CLIC1 on the ITG family proteins, such as ITGαv and ITGβ1. ¹⁴ Thus, we hypothesized that MAPK/ERK signaling may be a downstream signaling of CLIC1 derived from CLL exosomes. As we hypothesized, our experimental results revealed that MAPK/ERK signaling could be activated by the increase of ITGβ1, which mediated by exosomal CLIC1 secreted by CLL cells. Moreover, the inactivation of MAPK/ERK signaling by treatment with PD980529 obviously weakened the promotion of exosomal CLIC1 on the capabilities of proliferation and angiogenesis of HUVECs, implying that MAPK/ERK signaling was involved in the regulation of exosomal CLIC1 secreted by CLL cells on angiogenetic environment.

In summary, our study has discovered and proposed a mechanism of CLL exosomes‐mediated tumor progression in vitro, that is, MEC‐1 cell exosomes enhanced the capacities of invasion, metastasis and angiogenesis of HUVECs by transferring CLIC1 via regulating ITGβ1‐MAPK/ERK signaling. However, the molecular mechanism between CLIC1 and ITGs protein family is unclear, which we would further research in future.

CONFLICT OF INTEREST

The authors declare no potential conflict of interest.

Abbreviations

AML

acute myeloid leukemia

Bcl‐2

B‐cell lymphoma‐2

CCK‐8

cell counting kit‐8

CLIC1

chloride intracellular channel 1

CLL

chronic lymphocytic leukemia

CSCs

cancer stem cells

ERK

extracellular regulated protein kinases

EVs

extracellular vesicles

FBS

fetal bovine serum

GBM

glioblastoma multiforme

GC

gastric cancer

HSP70

heat shock protein 70

HSP90

heat shock protein 90

HUVECs

human umbilical vein endothelial cells

ITG

integrin

ITGβ1

Integrin β1

MAPK

mitogen‐activated protein kinase

miRNAs

microRNAs

MMP‐9

matrix metalloproteinase‐9

NF‐κB

nuclear factor kappa beta

NPC

nasopharyngeal carcinoma

PBMCs

peripheral blood mononuclear cells

PBS

phosphate belanced solution

PCa

prostate cancer

P‐gp

P‐glycoprotein

PVDF

polyvinylidene Fluoride

qRT‐PCR

quantitative real‐time PCR

SDS‐PAGE

sodium salt‐polyacrylamide gel electrophoresis

S100‐A9

S100 calcium‐binding protein A9

TME

tumor microenvironment

TSG101

tumor susceptibility gene 101 protein

VEGF

vascular endothelial growth factor

Geng H‐Y, Feng Z‐J, Zhang J‐J, Li G‐Y. Exosomal CLIC1 released by CLL promotes HUVECs angiogenesis by regulating ITGβ1‐MAPK/ERK axis. Kaohsiung J Med Sci. 2021;37:226–235. 10.1002/kjm2.12287