Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2021 Oct 7;38(1):30–37. doi: 10.1002/kjm2.12457

RETRACTED: Role of miR‐490‐3p in blocking bladder cancer growth through targeting the RNA‐binding protein PCBP2

Cun‐Ming Zhang 1, Li‐De Song 2, Jun‐Wei Wang 1, Hai‐Bo Ye 1, Song Chen 1,✉
PMCID: PMC11896500  PMID: 34622526

Abstract

MiR‐490‐3p is regarded as a tumor suppressor in many cancers, but whether miR‐490‐3p is involved in the development of bladder cancer remains unknown. BALB/c nude mice (male, 15–20 g) were used to investigate the role of MiR‐490‐3p in bladder cancer. The relationship between miR‐490‐3p and PCBP2 involved in bladder cancer regulation were determined. Cell viability, proliferation, and cell cycle were estimated by cell counting kit‐8 (CCK‐8) assay, 5‐bromo‐2′‐deoxyuridine (BrdU) detection, and flow cytometry analysis, respectively. In animal experiments, lentivirus was transfected into bladder cancer cells to overexpress miR‐490‐3p, which were then injected into mice and the change of tumor volume was assessed. Principal findings: The expression of MiR‐490‐3p was decreased in bladder cancer cells. Overexpression of miR‐490‐3p inhibited bladder cancer cell viability and proliferation. Moreover, overexpression of miR‐490‐3p caused cell cycle arrest in bladder cancer cells. The inhibitory effect of miR‐490‐3p on bladder cancer cells growth could be counteracted by enhancing PCBP2 expression. In vivo, bladder cancer growth in mice was blocked by miR‐490‐3p upregulation. MiR‐490‐3p suppressed bladder cancer growth and bladder cancer cell proliferation by down‐regulating PCBP2 expression.

Keywords: bladder cancer, microRNA, miR‐490‐3p, PCBP2, proliferation

1. INTRODUCTION

The incidence of bladder cancer ranks ninth among all malignant tumors worldwide. 1 In the United States, approximately 16,000 people die from bladder cancer every year. 2 In China, bladder cancer is the most common tumor of urogenital system. 3 Although great progress has been made in the diagnosis and treatment of bladder cancer, 4 30% of urothelial carcinoma patients (the most common histological type of bladder cancer) are still at risk of recurrence and progression. 5 Therefore, finding new molecular targets is necessary for bladder cancer treatment.

MicroRNA (miRNA) is one type of non‐coding RNA that can modulate gene expressions and plays a variety of regulatory roles. 6 Studies have revealed that miRNAs play vital roles in bladder cancer. It has been shown that the expression of miR‐411 is decreased in bladder cancer, and miR‐411 can inhibit bladder cancer growth and metastasis through targeting EZH2 gene. 7 In addition, miR‐203a, miR‐103/107, miR‐125a‐5p, miR‐454‐3p, and miR‐374b‐5p are all abnormal in bladder cancer, which participated in the progression of bladder cancer by regulating the corresponding target genes. 8 , 9 , 10 , 11 MiR‐490‐3p functions as a antioncogene in many malignant tumors, such as breast cancer, 12 ovarian carcinoma, 13 gastric carcinoma, 14 and prostate cancer. 15 However, whether miR‐490‐3p participates in bladder cancer development remains elusive.

Poly‐(C) Binding Protein 2 (PCBP2) is an RNA‐binding protein, which has a pro‐oncogenic role in a variety of tumors. Researchers have reported that PCBP2 can promote gastric carcinoma development, 16 and increase the growth of glioma by regulating FHL3. 17 In bladder cancer, it has been proved that PCBP2 can promote cancer progression in nude mice. 18 Bioinformatics prediction discovered a targeting relationship between miR‐490‐3p and PCBP2. Thus, we speculated miR‐490‐3p might be associated with bladder cancer and play roles in bladder cancer through PCBP2.

In this study, the relationship between miR‐490‐3p and bladder cancer were analyzed and the regulatory role of miR‐490‐3p in bladder cancer growth were explored, aiming to find new therapeutic targets for treating bladder cancer.

2. MATERIALS AND METHODS

2.1. Cells

Bladder cells (HCV‐29 and CCC‐HB‐2) were donated by Chinese Academy of Medical Sciences and cultured in Dulbecco's Modified Eagle's Medium. Bladder cancer cell lines (HT‐1376, J82, SCaBER, and TCCSUP; ATCC, Rockville, MD) were maintained in Eagle's Minimum Essential Medium. All medium contained 100 U/ml penicillin, 100 μg/ml streptomycin, and 10% fetal bovine serum (FBS). The above cells were cultured in 5% CO2 incubator under 37°C.

2.2. Cell transfection

MiR‐490‐3p mimic (50 nM), miR‐490‐3p inhibitor (50 nM), PCBP2 overexpression vector (PCBP2, 2 μg), and the negative control (NC mimic, NC inhibitor, vector) were obtained from Biomics (Nantong, China). Lipofectamine 2000 (Invitrogen, Carlsbad, California) was used for cell transfection according to the protocol of the manufacture.

2.3. qRT‐PCR (quantitative real‐time PCR)

The total RNAs were extracted from cells with Trizol reagent (Invitrogen). Then, cDNA was reverse‐transcribed using Transcriptase Kit (Yeasen, Shanghai, China). The expression levels were determined by qRT‐PCR via SYBR Green PCR Master Mix. Relative expression value was calculated by 2−ΔΔCt formula. The primer sequences were displayed in Table 1.

TABLE 1.

The primer sequences

Name Primer Sequences (5′–3′)
miR‐490‐3p Forward CGGCGGTCAACCTGGAGGACTCC
Reverse CCAGTGCAGGGTCCGAGGTAT
PCBP2 Forward AGGCAGGTTACCATCACTGG
Reverse CATTGTTCTAGCTGCTCCCC
U6 Forward CTCGCTTCGGCAGCAGCACATATA
Reverse AAATATGGAACGCTTCACGA
GAPDH Forward TGCACCACCAACTGCTTAGC
Reverse GGCATGGACTGTGGTCATGAG
Open in a new tab

2.4. CCK‐8 (cell counting kit‐8) assay

CCK‐8 assay was performed for detecting cell viability. Briefly, cells were plated on 96‐well plates (1 × 105 cells/well). After transfection for 48 h, 10 μl CCK8 solution was added to each well and cultured for another 2 h. Finally, the optical density (OD) values were read at 450 nm.

2.5. BrdU (5‐bromo‐2′‐deoxyuridine) assay

Cell proliferation was determined by BrdU Cell Proliferation Assay Kit (AmyJet Scientific, Wuhan, China) following the manufacturer's instruction.

2.6. Western blot

The total protein of cells or tissues was extracted with RIPA lysis buffer. The protein concentrations were quantitated by using BCA protein assay kit (Beyotime). The protein samples were separated through SDS/PAGE (12%) and transferred to PVDF membranes. The membranes were blocked with skim milk (5%) for 2 h at room temperature. Afterwards, the membranes were incubated with primary antibodies (Abcam) followed by secondary antibody incubation (ab97080, diluted at 1:5000, Santa Cruz). Primary antibodies included anti‐PCBP2 antibody (ab184962, 1:1000 dilution), anti‐AKT antibody (ab38449, diluted at 1:1000), anti‐p‐AKT antibody (ab8805, diluted at 1:500), anti‐GSK3β antibody (ab32391, diluted at 1:5000), anti‐p‐GSK3β antibody (ab75814, diluted at 1:10000), and anti‐β‐actin antibody (ab8227, diluted at 1:5000). The blots were measured by enhanced chemiluminescence detection system (GE Healthcare, Buckinghamshire, UK).

2.7. Flow cytometry

Cell cycle was analyzed by flow cytometry. Briefly, cells were collected after reaching 40–50% confluence. RNA was degraded with RNase A (100 μg/ml) for 30 min at 37°C after cells were fixed with ethanol (70%) at 4°C overnight. Next, cells were stained with propidium iodide (50 μg/ml) for 30 min and analyzed on a flow cytometer (Thermo Fisher Scientific, Waltham, Massachusetts).

2.8. Dual‐luciferase (DL) reporter assay

Research‐bio (Shanghai, China) was used to amplify the 3′UTR fragment of PCBP2 containing WT (wild type) or MUT (mutant) miR‐490‐3p putative binding region. Then, the fragments were inserted into pGL3‐PCBP2 plasmid (Invitrogen). Lipofectamine 2000 (Invitrogen) was used to co‐transfect miR‐490‐3p mimics and luciferase plasmids into bladder cancer cells (J82 and TCCSUP) according to manufacturer's protocol. A DL reporter assay system (Promega, Beijing, China) was utilized to determine the luciferase activity after 48 h post transfection.

2.9. Animal experiment

Five to six weeks old BALB/c nude mice (male, 15–20 g) were obtained from Shanghai Kay Biological Technology Co., Ltd. (China), and housed at 25 ± 2°C under 12 h light/12 h dark cycles in a specific pathogen‐free facility (standard rectangular mouse cages, each cage had four mice). LV‐miR‐490‐3p (miR‐490‐3p overexpression lentivirus) and its negative control (LV‐NC mimic) were constructed by GenePharma (Shanghai, China). J82 cells were transfected with LV‐miR‐490‐3p or LV‐NC mimic. To evaluate the influence of miR‐490‐3p on tumor growth in vivo, these transfected cells were subcutaneously injected into the right flank of mice (n = 6). Tumor volume was estimated by caliper from day 3 to day 21 post‐injection. Then, mice were euthanized with CO2 asphyxiation, and tumor tissues were collected for western blot and immunohistochemistry (IHC). The Ethics Committee of The xxx Hospital approved all experimental protocols.

2.10. IHC

Tumor tissues of mice were collected, and embedded into paraffin sections as previously described. 19 After blockade with serum, sections were stained with anti‐KI67 antibody (ab16667. diluted at 1:200, Abcam) overnight at 4°C,followed by incubation with secondary antibody at room temperature for 1 h. After that, the sections were incubated with DAB chromogen reagent for 5 min, and Hematoxylin (0.1%) was added for counter stain. Finally, sections were dehydrated, mounted and imaged.

2.11. Statistical analysis

Data was presented as mean ± SD. Statistical analysis was performed using SPSS 19.0 (SPSS, Chicago, Illinios). p < 0.05 was considered as significant difference. The difference between two groups was analyzed by Student's t test. All experiments were repeated at least three times.

3. RESULTS

3.1. miR‐490‐3p suppressed bladder cancer cell proliferation and Akt pathway activation

The expression of miR‐490‐3p was measured in normal bladder cells (HCV‐29 and CCC‐HB‐2) and bladder cancer cell lines (HT‐1376, J82, SCaBER, and TCCSUP). As shown in Figure 1A, the expression level of miR‐490‐3p in bladder cancer cell lines was significantly lower than that in normal bladder cells (Figure 1A). In addition, a difference was observed in expression of miR‐490‐3pbetween J82 and SCaBE cells, while there was no significant difference in miR‐490‐3p expression among other bladder cancer cells (Figure 1A). To test whether miR‐490‐3p can influence bladder cancer cell growth y, miR‐490‐3p mimic was transfected into J82 and TCCSUP cells to enhance miR‐490‐3p expression (Figure 1B). CCK8 and BrdU assay showed that cell viability and proliferation of J82 and TCCSUP cells was lower in miR‐490‐3p mimic group compared to NC mimic group (Figure 1C,D). Meanwhile, p‐AKT and p‐GSK3β protein levels were downregulated in J82 and TCCSUP cells in miR‐490‐3p mimic group (Figure 1E). These above findings revealed that overexpression of miR‐490‐3p could suppress bladder cancer cell proliferation and Akt signaling pathway activation.

FIGURE 1.

FIGURE 1

Open in a new tab

miR‐490‐3p expression level in bladder cancer cells and the role of miR‐490‐3p on bladder cancer cell proliferation and Akt pathway. (A) MiR‐490‐3p expression levels in normal bladder cells (HCV‐29 and CCC‐HB‐2) and bladder cancer cell lines (HT‐1376, J82, SCaBER, and TCCSUP) measured by qRT‐PCR. (B) Expression of miR‐490‐3p in J82 and TCCSUP cells transfected with miR‐490‐3p mimic and NC mimic analyzed by qRT‐PCR. (C) Cell viability in different groups measured by CCK‐8 assay. (D) Cell proliferation in different groups determined by BrdU assay. (E) The protein levels of AKT, p‐AKT, GSK3β, and p‐GSK3β in different groups measured by western blot. ***p < 0.001 versus HCV‐29 or CCC‐HB‐2 or NC mimic. **p < 0.01 versus NC mimic

3.2. miR‐490‐3p induced cell cycle arrest in bladder cancer cells

To explore whether miR‐490‐3p affects cell cycle of bladder cancer cells, flow cytometry analysis was performed. J82 and TCCSUP cells were transfected with miR‐490‐3p mimic. As shown in Figure 2, transfection of miR‐490‐3p mimic increased percentage of J82 and TCCSUP cells in G1 phase. In contrast, the percentage of cells in S phase was decreased in J82 and TCCSUP cells transfected with miR‐490‐3p mimic compared with that transfected with NC mimic. No significant difference was observed in percentage of J82 cell in G2 phase. While, the percentage TCCSUP cells in G2 phase was decreased by miR‐490‐3p mimic transfection. Thus, overexpression of miR‐490‐3p induced cell cycle arrest in bladder cancer cells.

FIGURE 2.

FIGURE 2

Open in a new tab

The role of miR‐490‐3p on cell cycle in bladder cancer cells. Cell cycle in J82 and TCCSUP cells transfected with miR‐490‐3p mimic and NC mimic analyzed by flow cytometry. **p < 0.01 versus NC mimic

3.3. miR‐490‐3p targeted 3′UTR of PCBP2 protein

To investigate the mechanism of miR‐490‐3p regulating the growth of bladder cancer cells, the target gene of miR‐490‐3p was analyzed through Targetscan (http://www.targetscan.org). It was found that there was a binding site for miR‐490‐3p in the 3′UTR of PCBP2 (Figure 3A). DL reporter assay results showed that overexpression of miR‐490‐3p inhibited the luciferase reporter activity of PCBP2‐WT in bladder cancer cells, but had no effect on the luciferase reporter activity of PCBP2‐MUT (Figure 3B). To explore the influence of miR‐490‐3p on PCBP2 expression, bladder cancer cells (J82 and TCCSUP) were transfected with miR‐490‐3p mimic or inhibitor to up‐regulate or down‐regulate miR‐490‐3p level (Figure 3C). The qPCR‐PCR and western blot results suggested that the expression of PCBP2 in both mRNA and protein level was lowered inmiR‐490‐3p mimic group. However, the miR‐490‐3p inhibitor increased the mRNA and protein expression of PCBP2 (Figure 3D,E). Altogether, miR‐490‐3p negatively regulated PCBP2 expression via targeting its 3′UTR.

FIGURE 3.

FIGURE 3

Open in a new tab

PCBP2 was a target protein of miR‐490‐3p. (A) The binding sites between miR‐490‐3p and PCBP2. (B) The 3′UTR fragments of PCBP2 containing WT or MUT miR‐490‐3p putative binding region were inserted into pGL3‐PCBP2 plasmid. Lipofectamine 2000 was used to co‐transfect miR‐490‐3p mimics and luciferase plasmids into J82 and TCCSUP cells. DL reporter assay was used to detect the luciferase reporter activity. (C) miR‐490‐3p expression in J82 and TCCSUP cells transfected with miR‐490‐3p mimic, NC mimic, miR‐490‐3p inhibitor, and NC inhibitor measured by qRT‐PCR. (D) The mRNA level of PCBP2 in different groups analyzed by qRT‐PCR. (E) The protein level of PCBP2 measured by western blot assay. **p < 0.01 versus NC mimic or NC inhibitor. ***p < 0.001 versus NC mimic or NC inhibitor. *p < 0.05 versus NC inhibitor

3.4. Overexpression of PCBP2 reversed the effect of miR‐490‐3p on bladder cancer cell growth

To test the effect of PCBP2 on the role of miR‐490‐3p in bladder cancer cells, J82 cells was transfected with miR‐490‐3p mimic and PCBP2 overexpression vector (PCBP2). qRT‐PCR results revealed that miR‐490‐3p mimic inhibited the mRNA expression PCBP2, but PCBP2 overexpression vector rescued the PCBP2 expression (Figure 4A). CCK8 and BrdU results showed that cell activity and proliferation was diminished after overexpressing miR‐490‐3p, while overexpression of PCBP2‐partially reversed the inhibitory effect of miR‐490‐3p (Figure 4B,C). Additionally, miR‐490‐3p reduced the expression of p‐AKT and p‐GSK3β protein was, which was restored by PCBP2 overexpression (Figure 4D). Taken together, these results revealed that the inhibitory effect of miR‐490‐3p on bladder cancer cells growth could be counteracted by PCBP2 overexpression.

FIGURE 4.

FIGURE 4

Open in a new tab

The effect of PCBP2 on bladder cancer cells. J82 cells were transfected with NC mimic+vector, miR‐490‐3p mimic+vector, NC mimic+PCBP2, and miR‐490‐3p mimic+PCBP2. (A) The mRNA level of PCBP2 analyzed by qRT‐PCR. (B) Cell viability measured by CCK‐8. (C) Cell proliferation determined by BrdU assay. (D) The protein levels of AKT, p‐AKT, GSK3β, and p‐GSK3βmeasured by western blot assay. **p < 0.01 or ***p < 0.001 versus NC mimic+vector. **p < 0.01 or ***p < 0.001 versus NC mimic+PCBP2

3.5. Overexpression of miR‐490‐3p inhibited tumor growth in mice

LV‐miR‐490‐3p (miR‐490‐3p overexpression lentivirus) was firstly transfected into J82 cells, which increased the expression of miR‐490‐3p (Figure 5A). In animal experiment, the transfected cells were injected subcutaneously into mice, and the size of tumor was measured (Figure 5B). The tumor volume in LV‐miR‐490‐3p group was larger than that in LV‐NC mimic group (Figure 5B). Moreover, the expression of PCBP2 protein in tumor was decreased in LV‐miR‐490‐3p group (Figure 5C). Cell proliferation was assessed by immunostaining for Ki67, and the results showed that the number of proliferated (Ki67) cells was decreased in tumors in LV‐miR‐490‐3p group (Figure 5D). Taken together, these data indicated that overexpression of miR‐490‐3p could repress the growth of bladder cancer.

FIGURE 5.

FIGURE 5

Open in a new tab

The effect of miR‐490‐3p on tumor growth in mice. (A) MiR‐490‐3p expression in J82 cells transfected with MiR‐490‐3p overexpression lentivirus (LV‐miR‐490‐3p) analyzed by qRT‐PCR. (B) A schematic representation of the animal experiments. Mice were divided into LV‐NC mimic and LV‐miR‐490‐3p groups. The tumor volume was measured. (C) PCBP2 protein level in tumor was measured by western blot. (D) IHC analysis of bladders cancer samples from mice treated with anti‐KI67 antibody. The scale bar is 50 μm. ***p < 0.001 or **p < 0.01 versus LV‐NC mimic

4. DISCUSSION

Bladder cancer is a common malignant tumor of the urinary system that seriously threatens the human health. 20 The aim of this study is to discover new molecular pathway that regulates the progression of bladder cancer. Studies have shown that miRNA is involved in the regulation of cell proliferation, differentiation, apoptosis, aging, and other cellular functions, and is closely related to the occurrence and development of tumors. 21 , 22 , 23 In current study, the effect of a certain miRNA on the growth of bladder cancer was investigated.

A large number of researchers have found that miR‐490‐3p has a obvious tumor suppressor effect on various tumors. Ou et al. found that miR‐490‐3p was down‐regulated in hepatocellular carcinoma, and upregulation of miR‐490‐3p inhibited hepatocellular carcinoma cell growth by targeting ATG7. 24 Liu and his colleagues reported that miR‐490‐3p was down‐regulated in osteosarcoma cells, and overexpression of miR‐490‐3p promoted the cell apoptosis via reducing HMGA2 in osteosarcoma. 25 In addition, miR‐490‐3p can also suppress the progression of ovarian epithelial carcinoma, 26 acute myeloid leukemia, 27 lung cancer, 28 breast cancer, 29 and colorectal carcinoma. 30 MiR‐490‐3p is also associated with the progression of bladder cancer. 31 Zhang et al. pointed out that the role of lncRNA CCAT1 in bladder cancer was related to multiple miRNAs, including miR‐490‐3p. 32 However, they did not delve into the role of miR‐490‐3p in bladder cancer. In the present study, miR‐490‐3p expression was detected in normal bladder cells and bladder cancer cell lines and the results indicated that miR‐490‐3p was downregulated in bladder cancer cells. To further study the effect of miR‐490‐3p on bladder cancer, functional experiments were conducted in two bladder cancer cell lines. miR‐490‐3p‐overexpression effectively decreased the viability and proliferation of bladder cancer cells and induced cell cycle arrest. These data implied that miR‐490‐3p had an anti‐tumor effect on bladder cancer. It has been known that activation of Akt pathway plays a key role in the occurrence and development of bladder cancer. 33 Inactivating Akt pathway can inhibit the growth of bladder cancer cells. 34 Consistent with reported results, miR‐490‐3p inhibited Akt signaling activation in bladder cancer cells in this study.

Generally, miRNAs exert carcinogenic or tumor suppressor functions through targeting target genes. 35 Herein, it was found that PCBP2 had a binding cite for miR‐490‐3p according to bioinformatical analysis, and DL reporter assay confirmed the interaction of miR‐490‐3p and PCBP2. As a member of the PCBP family, PCBP2 has the function of maintaining mRNA stability and regulating translation. 36 PCBP2 is involved in the regulation of signal molecule post‐transcription and translation via binding to the single‐stranded poly(C) motifs. 37 In recent years, PCBP2 has been found to act as a regulator in multiple tumors. For example, PCBP2 can promote the progression of esophageal squamous cell carcinoma 38 and increased PCBP2 expression is associated with poor prognosis of hepatocellular carcinoma. 37 In bladder cancer, PCBP2 was highly expressed, and knockdown of PCBP2 suppressed bladder cancer cell proliferation, migration and invasion. 18 In this study, it was discovered that the inhibitory effect of miR‐490‐3p on bladder cancer cells growth can be counteracted by overexpressing PCBP2, while up‐regulation of miR‐490‐3pd can suppress bladder cancer growth in mice by downregulating PCBP2 expression. However, the e of miR‐490‐3p on bladder cancer cell migration and invasion remains to be explored in the further research.

5. CONCLUSIONS

The current study demonstrated that miR‐490‐3p was involved in the development of bladder cancer. Upregulation of miR‐490‐3p can suppress bladder cancer cell proliferation and bladder cancer growth by decreasing PCBP2 expression, which provided a new potential therapeutic target for bladder cancer treatment.

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Zhang C‐M, Song L‐D, Wang J‐W, Ye H‐B, Chen S. Role of miR‐490‐3p in blocking bladder cancer growth through targeting the RNA‐binding protein PCBP2 . Kaohsiung J Med Sci. 2022;38:30–37. 10.1002/kjm2.12457

Cun‐Ming Zhang and Li‐De Song have contributed equally to this study.

REFERENCES

  • 1. Antoni S, Ferlay J, Soerjomataram I, Znaor A, Jemal A, Bray F. Bladder cancer incidence and mortality: a global overview and recent trends. Eur Urol. 2017;71(1):96–108. [DOI] [PubMed] [Google Scholar]
  • 2. DeGeorge KC, Holt HR, Hodges SC. Bladder cancer: diagnosis and treatment. Am Fam Physician. 2017;96(8):507–14. [PubMed] [Google Scholar]
  • 3. Pang C, Guan Y, Li H, Chen W, Zhu G. Urologic cancer in China. Jpn J Clin Oncol. 2016;46(6):497–501. [DOI] [PubMed] [Google Scholar]
  • 4. Jacobs BL, Lee CT, Montie JE. Bladder cancer in 2010: how far have we come? CA Cancer J Clin. 2010;60(4):244–72. [DOI] [PubMed] [Google Scholar]
  • 5. Gorin MA, Ayyathurai R, Soloway MS. Diagnosis and treatment of bladder cancer: how can we improve? Postgrad Med. 2012;124(3):28–36. [DOI] [PubMed] [Google Scholar]
  • 6. Lu TX, Rothenberg ME. MicroRNA. J Allergy Clin Immunol. 2018;141(4):1202–7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Liu Y, Liu T, Jin H, Yin L, Yu H, Bi J. MiR‐411 suppresses the development of bladder cancer by regulating ZnT1. Onco Targets Ther. 2018;11:8695–704. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 8. Na XY, Shang XS, Zhao Y, Ren PP, Hu XQ. MiR‐203a functions as a tumor suppressor in bladder cancer by targeting SIX4. Neoplasma. 2019;66(2):211–21. [DOI] [PubMed] [Google Scholar]
  • 9. Yu QF, Liu P, Li ZY, Zhang CF, Chen SQ, Li ZH, et al. MiR‐103/107 induces tumorigenicity in bladder cancer cell by suppressing PTEN. Eur Rev Med Pharmacol Sci. 2018;22(24):8616–23. [DOI] [PubMed] [Google Scholar]
  • 10. Zhang Y, Zhang D, Lv J, Wang S, Zhang Q. MiR‐125a‐5p suppresses bladder cancer progression through targeting FUT4. Biomed Pharmacother. 2018;108:1039–47. [DOI] [PubMed] [Google Scholar]
  • 11. Wang S, Zhang G, Zheng W, Xue Q, Wei D, Zheng Y, et al. MiR‐454‐3p and miR‐374b‐5p suppress migration and invasion of bladder cancer cells through targetting ZEB2. Biosci Rep. 2018;38(6):BSR20181436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12. Jia Z, Liu Y, Gao Q, Han Y, Zhang G, Xu S, et al. miR‐490‐3p inhibits the growth and invasiveness in triple‐negative breast cancer by repressing the expression of TNKS2. Gene. 2016;593(1):41–7. [DOI] [PubMed] [Google Scholar]
  • 13. Tian J, Xu YY, Li L, Hao Q. MiR‐490‐3p sensitizes ovarian cancer cells to cisplatin by directly targeting ABCC2. Am J Transl Res. 2017;9(3):1127–38. [PMC free article] [PubMed] [Google Scholar]
  • 14. Qu M, Li L, Zheng WC. Reduced miR‐490‐3p expression is associated with poor prognosis of Helicobacter pylori induced gastric cancer. Eur Rev Med Pharmacol Sci. 2017;21(15):3384–8. [PubMed] [Google Scholar]
  • 15. Fan H, Zhang YS. miR‐490‐3p modulates the progression of prostate cancer through regulating histone deacetylase 2. Eur Rev Med Pharmacol Sci. 2019;23(2):539–46. [DOI] [PubMed] [Google Scholar]
  • 16. Hu CE, Liu YC, Zhang HD, Huang GJ. The RNA‐binding protein PCBP2 facilitates gastric carcinoma growth by targeting miR‐34a. Biochem Biophys Res Commun. 2014;448(4):437–42. [DOI] [PubMed] [Google Scholar]
  • 17. Han W, Xin Z, Zhao Z, Bao W, Lin X, Yin B, et al. RNA‐binding protein PCBP2 modulates glioma growth by regulating FHL3. J Clin Invest. 2013;123(5):2103–18. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Wang J, Zhang H, Situ J, Li M, Sun H. KCNQ1OT1 aggravates cell proliferation and migration in bladder cancer through modulating miR‐145‐5p/PCBP2 axis. Cancer Cell Int. 2019;19:325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Muftah AA, Aleskandarany MA, Al‐Kaabi MM, Sonbul SN, Diez‐Rodriguez M, Nolan CC, et al. Ki67 expression in invasive breast cancer: the use of tissue microarrays compared with whole tissue sections. Breast Cancer Res Treat. 2017;164(2):341–8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Martinez Rodriguez RH, Buisan Rueda O, Ibarz L. Bladder cancer: present and future. Med Clin (Barc). 2017;149(10):449–55. [DOI] [PubMed] [Google Scholar]
  • 21. Mishra S, Yadav T, Rani V. Exploring miRNA based approaches in cancer diagnostics and therapeutics. Crit Rev Oncol Hematol. 2016;98:12–23. [DOI] [PubMed] [Google Scholar]
  • 22. Lee YS, Dutta A. MicroRNAs in cancer. Annu Rev Pathol. 2009;4:199–227. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 23. Ganju A, Khan S, Hafeez BB, Behrman SW, Yallapu MM, Chauhan SC, et al. miRNA nanotherapeutics for cancer. Drug Discov Today. 2017;22(2):424–32. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Ou Y, He J, Liu Y. MiR‐490‐3p inhibits autophagy via targeting ATG7 in hepatocellular carcinoma. IUBMB Life. 2018;70(6):468–78. [DOI] [PubMed] [Google Scholar]
  • 25. Liu W, Xu G, Liu H, Li T. MicroRNA‐490‐3p regulates cell proliferation and apoptosis by targeting HMGA2 in osteosarcoma. FEBS Lett. 2015;589(20 Pt B):3148–53. [DOI] [PubMed] [Google Scholar]
  • 26. Chen S, Chen X, Xiu YL, Sun KX, Zhao Y. MicroRNA‐490‐3P targets CDK1 and inhibits ovarian epithelial carcinoma tumorigenesis and progression. Cancer Lett. 2015;362(1):122–30. [DOI] [PubMed] [Google Scholar]
  • 27. Wang C, Chen F, Fan Z, Yao C, Xiao L. lncRNA CCAT1/miR‐490‐3p/MAPK1/c‐Myc positive feedback loop drives progression of acute myeloid leukaemia. J Biochem. 2020;167(4):379–88. [DOI] [PubMed] [Google Scholar]
  • 28. Gu H, Yang T, Fu S, Chen X, Guo L, Ni Y. MicroRNA‐490‐3p inhibits proliferation of A549 lung cancer cells by targeting CCND1. Biochem Biophys Res Commun. 2014;444(1):104–18. [DOI] [PubMed] [Google Scholar]
  • 29. Tao W, Sun W, Zhu H, Zhang J. Knockdown of long non‐coding RNA TP73‐AS1 suppresses triple negative breast cancer cell vasculogenic mimicry by targeting miR‐490‐3p/TWIST1 axis. Biochem Biophys Res Commun. 2018;504(4):629–34. [DOI] [PubMed] [Google Scholar]
  • 30. Xu X, Chen R, Li Z, Huang N, Wu X, Li S, et al. MicroRNA‐490‐3p inhibits colorectal cancer metastasis by targeting TGFβR1. BMC Cancer. 2015;15:1023. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31. Vinchure OS, Kulshreshtha R. miR‐490: a potential biomarker and therapeutic target in cancer and other diseases. J Cell Physiol. 2020;236:3178–93. [DOI] [PubMed] [Google Scholar]
  • 32. Zhang C, Wang W, Lin J, Xiao J, Tian Y. lncRNA CCAT1 promotes bladder cancer cell proliferation, migration and invasion. Int Braz J Urol. 2019;45(3):549–59. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33. Kachrilas S, Dellis A, Papatsoris A, Avgeris S, Anastasiou D, Gavriil A, et al. PI3K/AKT pathway genetic alterations and dysregulation of expression in bladder cancer. J BUON. 2019;24(1):329–37. [PubMed] [Google Scholar]
  • 34. Li Y, Zhang X, Zhou X, Zhang X. LHPP suppresses bladder cancer cell proliferation and growth via inactivating AKT/p65 signaling pathway. Biosci Rep. 2019;39(7):BSR20182270. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35. Liu B, Li J, Cairns MJ. Identifying miRNAs, targets and functions. Brief Bioinform. 2014;15(1):1–19. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36. Smirnova VV, Shestakova ED, Bikmetov DV, Chugunova AA, Osterman IA, Serebryakova MV, et al. eIF4G2 balances its own mRNA translation via a PCBP2‐based feedback loop. RNA (New York, N.Y.). 2019;25(7):757–67. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37. Zhang X, Hua L, Yan D, Zhao F, Liu J, Zhou H, et al. Overexpression of PCBP2 contributes to poor prognosis and enhanced cell growth in human hepatocellular carcinoma. Oncol Rep. 2016;36(6):3456–64. [DOI] [PubMed] [Google Scholar]
  • 38. Ye J, Zhou G, Zhang Z, Sun L, He X, Zhou J. Poly (C)‐binding protein 2 (PCBP2) promotes the progression of esophageal squamous cell carcinoma (ESCC) through regulating cellular proliferation and apoptosis. Pathol Res Pract. 2016;212(8):717–25. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES