Curcumin regulates EZH2/Wnt/β‐Catenin pathway in the mandible and femur of ovariectomized osteoporosis rats

Abstract

Osteoporosis (OP) behaves in different manners in different parts of the skeleton. This study aims to investigate the effects of curcumin on bone mass of the mandibular and femur from ovariectomized OP rats and to validate whether enhancer of zeste homolog 2 (EZH2)/Wnt/β‐Catenin pathway is involved in this process. Curcumin was administered intragastrically into ovariectomized rats for 12 weeks. The bone parameters and the morphology of the trabecular bone of the left mandible and left femur were assessed by micro‐computed tomography assay. Morphological changes of the left mandible and left femur were evaluated by hematoxylin and eosin staining. The mRNA levels of EZH2, β‐Catenin, and Runx2 in the right mandible and right femur were examined by quantitative real‐time polymerase chain reaction. Immunohistochemistry was performed to assess EZH2 expression. Both the mandible and femur exhibited OP‐like changes in ovariectomized rats, while the mandible bone resorption was less than the femur bone resorption. Curcumin intragastric administration improved bone microstructure and promoted bone formation in the mandible and femur. Curcumin inhibited EZH2 mRNA level and induced that of β‐Catenin and Runx2 in the mandible and femur. Collectively, curcumin exerts protective effects against OP, possibly by regulating the EZH2/Wnt/β‐Catenin pathway.

1. INTRODUCTION

Osteoporosis (OP) is a skeletal disorder characterized by low bone mineral density, microarchitectural deterioration of the bone and a subsequent increase in fracture risk. ¹ The common related risk factors for OP include age, gender, low intake of calcium and vitamin D, lack of estrogen and low physical activity, and so forth. ² The jaw is an integral part of the skeletal system of the whole body and derived from an embryonic layer that is different from the limb bones. The jawbone OP is not completely consistent with systemic OP. ³ , ⁴ A reduction of bone mass in the maxillofacial region can lead to loosening or loss of teeth and is one of most important factors leading to dental restoration failure. ⁵ Therefore, there is an urgent need to improve pharmaceutical treatment to relieve jawbone OP.

The abnormal differentiation of bone marrow‐derived mesenchymal stem cells (BMSCs) into osteoblasts and adipocytes leads to the imbalance between bone mass and fat, which may contribute to the pathogenesis of OP. ⁶ Wnt/β‐Catenin signaling pathway and Runx2 (runt‐related transcription factor 2) play critical roles in regulating osteogenic differentiation of BMSCs. ⁷ , ⁸ Wnt/β‐Catenin signaling can stimulate osteoblast proliferation and differentiation. ⁹ Runx2, a bone‐related transcription factor that is indispensable for bone formation, can be activated by the Wnt/β‐Catenin signaling pathway. ¹⁰ Enhancer of zeste homolog 2 (EZH2) is responsible for epigenetic silencing through histone H3 lysine 27 trimethylation (H3K27me3). ¹¹ Jing et al reported that EZH2 was increased in osteoporotic BMSCs and regulated osteogenic differentiation. ¹² EZH2 epigenetically silenced Wnt via increasing H3K27me3 levels on the promoters of Wnt genes and subsequently inhibited Wnt/β‐catenin signaling. ¹² Administration of the H3K27me3 inhibitor DZNep derepressed Wnt signaling and enhanced osteogenic differentiation of osteoporotic BMSCs in vitro as well as increased bone formation in osteoporotic mice. ¹²

Curcumin, a bioactive constituent from Curcuma longa, has been shown to possess diverse biologic effects, including antiinflammatory, antioxidant, antiviral, antiinfectious, and wound‐healing activities. ¹³ , ¹⁴ , ¹⁵ , ¹⁶ , ¹⁷ In addition, curcumin has been shown to improve bone microarchitecture in experimental OP mice. ¹⁸ Curcumin administration reduces bone mineral losses and increases bone strength in ovariectomized OP rats. ¹⁹ However, the mechanism underlying the therapeutic effects of curcumin in OP remains not fully clarified. In addition, the effect of curcumin on bone mass in the mandible is rarely reported.

In the present study, we attempted to investigate the effects of curcumin administration on the mandibular and femur in ovariectomized OP rats and to validate whether EZH2/Wnt/β‐Catenin pathway is involved in this process.

2. MATERIALS AND METHODS

2.1. Animals

Female specific pathogen‐free Sprague–Dawley (SD) rats (age, 6 months; weight, 350–390 g) without a history of pregnancy or lactation were maintained in a controlled temperature (20 ± 2°C) and had free access to food and water. All the rats were fed adaptively for 7 days prior to the experiment. All animal experiments were conducted under university guideline and approved by the ethical committee for Animal Care and Use of the Xiangya Hospital of Central South University (Changsha, China).

2.2. Experimental groups and drug administration

Twenty‐four female 6‐months old SD rats were randomly divided into three groups (n = 8/group): the sham‐operated group (Sham), the ovariectomized group (OVX) and the curcumin group (Cur). Bilateral ovariectomy was carried out on each rat in the OVX group and Cur group under anesthesia (3% sodium pentobarbital) with an abdominal longitudinal incision. The rats in the Sham group underwent a sham surgery in which the fat tissue near the ovary with the same volume as the ovary (approximately 60 mm³) was removed. The rats were allowed to recover for 1 week after ovariectomy. Then the rats in the Cur group were given 110 mg/kg curcumin (dissolved in 0.5% carboxymethylcellulose sodium solution) by intragastric administration, while rats in the Sham group and OVX group were given the same dosage of 0.5% carboxymethylcellulose sodium solution, once a day for 12 weeks. The dosages of drugs were adjusted per week in accordance with their body weights. All rats were sacrificed after the last intragastric administration.

2.3. Micro‐computed tomography assay

The left mandibles and left femurs were disserted, fixed in 4% paraformaldehyde solution, and stored in at 4 °C until assay. The left mandible and left femur samples were placed in the micro‐computed tomography (Micro‐CT) coil and subjected to 360° continuous spiral scanning along the long axis of the bone within the region of interest (the distal metaphysis of the femur, the first mandibular molar and its lower part). Samples were scanned at a voltage of 90 kV, a current of 80 μA, and a resolution of 20 μm. Then the scanning area of each sample was subjected to three‐dimensional reconstruction. The bone volume/total volume (BV/TV), trabecular number (Tb.N), trabecular thickness (Tb.Th) and trabecular separation (Tb.Sp) were determined.

2.4. Histopathological analysis

The left mandibles and left femurs (the distal metaphysis of the femur, the first mandibular molar and its lower part) were decalcified in 10% EDTA, washed with tap water for 24 h, dehydrated with alcohol, and embedded in paraffin. Serial 5 μm sections were subjected to hematoxylin and eosin (H&E) staining using the H&E stain (Sigma–Aldrich, St. Louis, MO, USA) and EZH2 immunohistochemistry using anti‐EZH2 (1:200 dilution; Abcam, Cambridge, MA, USA) following the routine procedures. The sections were observed under an Olympus BH‐2 light microscope (Olympus, Tokyo, Japan).

2.5. Quantitative real‐time polymerase chain reaction

The right mandibles and right femurs were crushed with the sterilized bone crushing forceps and homogenized in TRIzol reagent (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA, USA) using a homogenizer. Total RNA was reverse transcribed into cDNA using PrimeScript RT reagent Kit (Takara, Dalian, China). The cDNA template was synthesized through quantitative real‐time polymerase chain reaction (qRT‐PCR) using SYBR‐Green qPCR master mix (Takara). The primers were synthesized by Sangon Biotechnology (Shanghai, China) and listed as follow. The expression levels of candidate genes were calculated by the 2^−ΔΔCt method and normalized to the internal control GAPDH.

2.6. The sequence of primers used for qRT‐PCR

Genes		Sequences
EZH2	Forward	5′‐GAATGTGGAGTGGAGTGGTGCTG‐3′
	Reverse	5′‐GTCACAAGGCTGCCGTGGATG‐3′
Runx2	Forward	5′‐CTCAGCAGCAGCAGCAGCAG‐3′
	Reverse	5′‐GCACGGAGCACAGGAAGTTGG‐3′
β‐Catenin	Forward	5′‐GAGTGCTGAAGGTGCTGTCTGTC‐3′
	Reverse	5′‐CAGATGGCAGGCTCGGTAATGTC‐3′
GAPDH	Forward	5′‐CTCCACGAACCTGCTGACAGATTC‐3′
	Reverse	5′‐CGGCGGAGGTGATTGCGAAG‐3′

2.6.1. Statistical analysis

Statistical analysis was performed using SPSS 22.0 (IBM, Chicago, IL, USA). The differences between two groups or multi‐groups were analyzed using ttest and one‐way ANOVA, respectively. p‐value <0.05 was considered statistically significant.

3. RESULTS

3.1. Effect of curcumin on bone microstructural parameters

The results of micro‐CT analysis demonstrated that the OVX rats exhibited reduced trabecular number, sparse trabecular distribution, and increased number of trabecular ends when compared with the sham‐operated rats (Figure 1). Furthermore, the OVX rats had significantly decreased Tb.N, Tb.Th and BV/TV and increased Tb.Sp in the mandible and femur (Figure 2) compared with the sham‐operated rats. Of note, compared with the OVX group, the Tb.N and BV/TV were significantly increased while the Tb.Sp was decreased in the mandible and femur in the Cur group (Figure 2(A),(C),(D)). A notable decrease in Tb.Th was also observed in the rat mandible following curcumin treatment, however, there was no statistically significant difference in rat femur Tb.Th between the OVX and Cur group (Figure 2(B)).

FIGURE 1.

Effect of curcumin on morphology of mandible and femur. Representative micro‐CT images of the left mandible and left femur in the three groups. N = 8 per group. Cur, curcumin group; micro‐CT, micro‐computed tomography; OVX, ovariectomized group; Sham, sham‐operated group

FIGURE 2.

Effect of curcumin on bone microstructural parameters. Quantification of Tb.N (A), Tb.Th (B), Tb.Sp (C), and BV/TV (D) of the left mandible and left femur as assessed by micro‐CT assay. N = 8 per group. ^* p < 0.05, versus Sham; ^# p < 0.05, versus OVX. BV/TV, bone volume/totalvolume; OVX, ovariectomized group; Tb.N, trabecular number; Tb.Th, trabeclar thickness; Tb.Sp, trabecular separation

3.2. Effect of curcumin on morphology of the mandible and femur

In the Sham group, the femoral trabeculae were thick and orderly‐arranged; the mandible bone trabeculae were flake‐shaped. In the OVX group, femoral trabeculae were smaller, loosely arranged, and partially disrupted; the mandible trabeculae were sparse and exhibited severe ruptures. Notably, curcumin intragastric administration attenuated the ovariectomy‐induced morphological changes in the mandible and femur (Figure 3).

FIGURE 3.

Morphological changes of the left mandible and left femur in the three groups (H&E staining, ×100). N = 8 per group. H&E, hematoxylin and eosin

3.3. Curcumin downregulated EZH2 mRNA level but upregulated that of β‐Catenin and Runx2

EZH2 mRNA level in the mandible and femur in the OVX group was significantly higher than that in the Sham group (Figure 4(A)). In contrast, the mRNA levels of β‐Catenin (a key component of Wnt/β‐catenin signaling pathway) and Runx2 (a downstream target of Wnt/β‐catenin signaling pathway) in the mandible and femur were noticeably decreased in the OVX group when compared with the Sham group (Figure 4(B),(C)). Curcumin intragastric administration notably inhibited the ovariectomy‐induced EZH2 mRNA level while elevated the ovariectomy‐inhibited mRNA levels of β‐Catenin and Runx2 in the mandible and femur (Figure 4).

FIGURE 4.

Effect of curcumin on mRNA levels of EZH2, β‐catenin, and Runx2. The mRNA levels of EZH2 (A), β‐Catenin (B), and Runx2 (C) in the right mandible and right femur in the three groups were determined by qRT‐PCR. N = 8 per group. ^* p < 0.05, versus Sham; ^# p < 0.05, versus OVX. EZH2, enhancer of zeste homolog 2; OVX, ovariectomized group; qRT‐PCR, quantitative real‐time polymerase chain reaction

3.4. Curcumin downregulated EZH2 protein level

To further validate the qRT‐PCR results, we performed immunohistochemistry using a specific antibody against EZH2 in the mandible and femur of rats. As shown in Figure 5(A),(B), the mandible and femur of OVX rats exhibited increased number of EZH2‐positive cells (brown) when compared with the sham‐operated rats. Intragastric administration of curcumin diminished the OVX‐induced number of EZH2‐positive cells in both the mandible and femur. Our immunohistochemistry results consolidated the above qRT‐PCR results.

FIGURE 5.

Effect of curcumin on EZH2 protein level. (A) Immunohistochemistry analysis of EZH2 of the left mandible and left femur in the three groups (magnification, ×400). Positive signals are shown in brown. (B) Quantification of the percentage of EZH2‐positive cells from 10 randomly chosen fields. Rats in the OVX group exhibited increased number of EZH2‐positive cells in both the mandible and femur, which was then decreased by curcumin administration. N = 8 per group. EZH2, enhancer of zeste homolog 2; OVX, ovariectomized group

4. DISCUSSION

Ovariectomized models are most frequently used for studying postmenopausal OP with estrogen deficiency. ²⁰ Micro‐CT scanning to study bone morphology and parameters showed OP‐like changes in both the rat mandible and femur after ovariectomy, as evidenced by decreased Tb.N, Tb.Th and BV/TV and increased Tb.Sp. Importantly, the degree of declining of Tb.N and BV/TV in the femur was more than that of the mandible, indicating that the mandible bone resorption was less than the femur bone resorption. Of note, curcumin intragastric administration increased Tb.N, Tb.Th and BV/TV but decreased Tb/Sp. Furthermore, H&E staining revealed that curcumin intragastric administration attenuated the ovariectomy‐induced morphological changes in the mandible and femur. Collectively, our findings revealed the protective effects of curcumin in OP rats. One of the limitations of this study was that the circulating levels of curcumin or an appropriate metabolite were not measured, which requires further investigation.

Increased EZH2 expression is associated with decreased osteoblastogenesis. ²¹ EZH2 is transcriptionally induced by estradiol in vitro and in vivo and its expression is potentially dysregulated upon exposure to estrogenic endocrine disrupting chemicals. ²² High expression of EZH2 and its regulation of bone‐related signaling pathways may contribute to the pathogenesis of OP induced by estrogen deficiency. In this current investigation, EZH2 mRNA level was markedly upregulated in both the mandible and femur from rats after ovariectomy. Consistently, further immunohistochemistry analysis of EZH2 showed that the OVX rats exhibited increased number of EZH2‐positive cells in both the mandible and femur. These results implied that the increased EZH2 expression induced by ovariectomy was involved in the pathogenesis of OP, which was consistent with previous studies. ²¹

It should be noted that Wnt/β‐Catenin signaling can stimulate osteoblast proliferation and differentiation. ⁹ Wnt/β‐Catenin signaling pathway can activate its downstream target Runx2, a transcription factor that is indispensable for bone formation. ¹⁰ Wnt/β‐catenin signaling regulates BMSC osteogenesis by controlling the transcription of early‐stage osteo‐related markers. ²³ , ²⁴ In this study, we found that in contrast with EZH2 expression, the mRNA levels of β‐Catenin and Runx2 were notably downregulated in both the mandible and femur from rats after ovariectomy, indicating the involvement of inactivation of Wnt/β‐catenin signaling in the pathogenesis of OP.

EZH2/Wnt/β‐catenin signaling pathway has been shown to play an important role in regulating osteogenic differentiation of BMSCs. Knockdown of EZH2 inhibited BMSC adipogenic differentiation and increased bone formation during OP. ¹² Mechanistically, EZH2 epigenetically silenced Wnt via increasing H3K27me3 levels on the promoters of Wnt genes (Wnt1, Wnt6, and Wnt10a) and subsequently inhibited Wnt/β‐catenin signaling. ¹² Our results in the present study showed that curcumin intragastric administration inhibited the OVX‐induced EZH2 mRNA level in the mandible and femur. Furthermore, immunohistochemistry analysis of EZH2 in the mandible and femur showed that the OVX‐induced upregulation of EZH2‐positive cell number was diminished after curcumin intragastric administration. In contrast, the OVX‐mediated downregulation of mRNA levels of β‐Catenin and Runx2 was restored by curcumin intragastric administration. These findings indicated that the protective effects of curcumin against OP might be related to its inhibition of EZH2 transcription and subsequent derepression of Wnt/β‐Catenin signaling.

In conclusion, the findings in the present study demonstrate that curcumin exerts protective effects against OP in the mandible and femur in ovariectomized rats, possibly by regulating the EZH2/Wnt/β‐Catenin pathway. Our results suggest that curcumin can be considered as a potential therapeutic candidate agent for preventing bone loss in postmenopausal OP. This study provides a new mechanism of curcumin protecting against ovariectomy‐induced OP.

CONFLICT OF INTEREST

The authors declare no potential conflicts of interest.

Jiang Q, Lei Y‐H, Krishnadath DC, Zhu B‐Y, Zhou X‐W. Curcumin regulates EZH2/Wnt/β‐Catenin pathway in the mandible and femur of ovariectomized osteoporosis rats. Kaohsiung J Med Sci. 2021;37:513–519. 10.1002/kjm2.12346