microRNA‐1321 and microRNA‐7515 contribute to the progression of non‐small cell lung cancer by targeting CDC20

Abstract

Cell division cycle 20 (CDC20) and microRNAs (miRNAs) are differentially expressed in non‐small cell lung cancer (NSCLC). The current study aimed to investigate the role of miR‐1321 and miR‐7515 regulation in CDC20 during NSCLC development. CDC20 expression in paracancerous and tumor tissues was assessed using quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR). The relationship between CDC20 expression and prognosis of patients was analyzed using the TCGA database. The expression profile of CDC20 in healthy lung cells and NSCLC cells was detected using qRT‐PCR and western blotting. After the knockdown of CDC20 in NSCLC cells, the cell proliferation, apoptosis, migration, invasion, and cell cycle changes were investigated by CCK8, EdU, flow cytometry, wound healing, and Transwell assays. The miRNAs targeting CDC20 were predicted using two bioinformatics websites and validated using dual‐luciferase assays. CDC20 was enhanced in NSCLC tissues and cells, thus predicting the poor prognosis in NSCLC patients. After CDC20 inhibition, the malignant phenotype of NSCLC cells was reverted. miR‐1321 and miR‐7515 targeted CDC20 and exhibited the same anti‐tumor effects as CDC20 silencing. Functional rescue experiments showed that CDC20 overexpression averted the anti‐tumor effects of miR‐1321 and miR‐7515 on NSCLC cells. miR‐1321 and miR‐7515 inhibited NSCLC development by targeting CDC20. Thus, the current study has implications in NSCLC treatment and provides novel insights into NSCLC management.

1. INTRODUCTION

Non‐small cell lung cancer (NSCLC), accounting for about 85% of lung cancers, is more common in senior citizens with an exponential increase in morbidity and mortality in patients over 65 years of age. ¹ , ² NSCLC can be categorized into three subtypes, including adenocarcinoma, squamous‐cell carcinoma, and large‐cell carcinoma. ³ Smoking habits, radon exposure and air pollution, genetic factors, and dyslipidemia are risk factors for NSCLC. ⁴ , ⁵ , ⁶ A majority of NSCLC cases are not diagnosed until the disease develops into an advanced stage because of inadequate screening and late‐onset clinical features, during which surgical resection is not feasible, and treatment options are limited. ⁴ , ⁷ Even for NSCLC patients who were diagnosed at an early stage and underwent surgical treatment, up to 20% of patients still suffer from postoperative tumor recurrence. ⁸ Therefore, exploring novel therapeutic approaches for better treatment and prognosis of NSCLC patients is imperative.

Recently, cell division cycle 20 (CDC20) has been gaining attention in multiple cancers because its abnormal expression is strongly associated with malignant tumor progression and poor prognosis, making it a possible cancer treatment strategy. ⁹ As previously evidenced, CDC20 is found differentially expressed in NSCLC, promising to be a critical biomarker for the diagnosis and prognosis of NSCLC patients. ¹⁰ CDC20 is a critical mitotic factor governing the anaphase initiation and the exit from mitosis, which may indirectly affect cell proliferation. ¹¹ Moreover, the suppression of CDC20 enhanced the sensitivity of temozolomide‐resistant glioma cells by restoring the levels of epithelial marker E‐cadherin and reducing the expression of mesenchymal marker vimentin. ¹² Therefore, we designed the current study to examine the role of CDC20 in regulating epithelial–mesenchymal transition (EMT), migration, and invasion properties of NSCLC cells in addition to proliferation, apoptosis, and cell cycle. Mechanically, a previous study has pointed out that CDC20 can interact with microRNAs (miRNAs) to exert effects on hepatocellular carcinoma. ¹³

miRNAs, a group of small noncoding RNAs, are essential regulators of gene expression post‐transcriptionally, indicating their potent roles in diverse cellular events such as cell growth and apoptosis in various cancers. ¹⁴ miRNAs are commonly dysregulated and are profoundly involved in NSCLC initiation and progression. ¹⁵ , ¹⁶ Among them, miR‐1321 is implicated in ovarian cancer, associated with the enhanced EMT, invasion, and migration of ovarian cancer cells. ¹⁷ miR‐7515 plays a vital role in the modulation of the proliferation and migration of lung cancer cells. ¹⁸ However, the potential regulatory effects of miR‐1321 and miR‐7515 on CDC20 expression in NSCLC remain unclear.

Therefore, our reasonable hypothesis was that CDC20, regulated by miR‐1321 and miR‐7515, may play a crucial role in NSCLC. Consequently, we performed gain‐ and loss‐of‐function assays to identify the regulatory function and mechanism of CDC20 in NSCLC progression to provide some novel insights for NSCLC treatment.

2. METHODS

2.1. Sample collection

Sixty‐five pairs of tumor tissues and adjacent normal tissues were obtained from patients with NSCLC at Jiangxi Cancer Hospital from January 2019 to December 2019. Patients with a complete medical history and diagnosed at Jiangxi Cancer Hospital were enrolled. Patients who had other malignancies or had received radiotherapy and chemotherapy before tissue sampling were excluded. The pathological diagnosis results were obtained according to the histology or biopsy of tumor specimens and assessed by experienced pathologists. The collected tissues were preserved in liquid nitrogen. All participants offered written informed consent under the Declaration of Helsinki. The experiments involving clinical samples were approved by the ethics review committee of Jiangxi Cancer Hospital (approval no. #20190107002).

2.2. Cell culture and transfection

Human lung epithelial cells BEAS‐2B and human NSCLC lines H1299, A549, NCI‐H23, and NCI‐H522 were purchased from the American Type Culture Collection (ATCC). All cell lines were incubated in 90% Roswell Park Memorial Institute‐1640 medium containing 10% fetal bovine serum (FBS) (Thermo Fisher Scientific Inc., Waltham, MA, USA), 100 U/ml penicillin, and 100 mg/L streptomycin at 37°C with saturated humidity and 5% CO₂.

Transfection vectors were procured from Guangzhou RiboBio Co., Ltd. (Guangzhou, Guangdong, China). Small interfering RNAs (siRNAs) targeting CDC20 (siCDC20‐1 sense strand: CGCCUGAAAUCCGAAAUGAUU, antisense strand: UUGCGGACUUUAGGCUUUACU; siCDC20‐2 sense strand: CACAGAACCAGCUAGUUAUUU, antisense strand: UUGUGUCUUGGUCGAUCAAUA) were produced by Thermo Fisher. A549 and H1299 cells plated in six‐well plates with 1 × 10⁶ cells/well were cultured overnight and then transfected using Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA).

2.3. Quantitative reverse transcription‐polymerase chain reaction (qRT‐PCR)

Total RNA was isolated using TRIzol (Sigma‐Aldrich, St Louis, MO, USA) at 48 h post‐transfection. Then, 5 μl of RNA sample was diluted 20 times with RNase‐free ultrapure water. The concentration and purity of RNA were determined by reading an optical density (OD) value at 260 and 280 nm. As per the instructions of BeyoRT™ II cDNA First‐Strand Synthesis Kit (Beyotime, Shanghai, China), reverse transcription was performed in a PCR amplification instrument to synthesize complementary DNA (cDNA). The primers generated by Sangon (Shanghai, China) are listed in Table 1. Glyceraldehyde‐3‐phosphate dehydrogenase (GAPDH) was used as an internal control for CDC20, and U6 was used as an internal control for miR‐1321 and miR‐7515.

TABLE 1.

Primer sequences for qRT‐qPCR

Gene	Sequence (5′–3′)
miR‐1321	F: CAGGGAGGTGAATGTGAT
	R: GTGCAGGGTCCGAGGT
miR‐7515	F: AGAAGGGAAGATGGTGAC
	R: GGAACGCTTCACGAATTTG
CDC20	F: GGCACCAGTGATCGACACATTCGCAT
	R: GCCATAGCCTCAGGGTCTCATCTG
U6	F: CGCAAGGATGACACG
	R: GAGCAGGCTGGAGAA
GAPDH	F: ATTGTTGCCATCAATGACCC
	R: AGTAGAGGCAGGGATGATGT

Abbreviations: CDC20, cell division cycle 20; F, forward; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase; miR, microRNA; qRT‐PCR, quantitative reverse transcription‐polymerase chain reaction; R, reverse.

2.4. Western blot (WB) analysis

The cell‐lysis buffer was prepared using radioimmunoprecipitation‐assay‐lysis buffer (Cat. No.: HY‐K1001, MedChemExpress, Monmouth Junction, NJ, USA) containing 10% proteinase inhibitors at 48 h post‐transfection. The sample was transferred into 1.5‐ml centrifuge tubes and centrifuged for 10 min at 13,000g to harvest the supernatant. Total protein concentration was determined by the bicinchoninic acid assay method, and the protein was preserved at −20°C. Then, a 12% separation gel and concentrated gel were prepared. After separating polyacrylamide gel electrophoresis, the protein was transferred to nitrocellulose membranes by the wet transfer method and sealed with 5% skim milk at 1 h. Then, the membranes were subjected to overnight incubation with the diluted primary antibodies against CDC20 (ab26483, Abcam, Cambridge, UK), E‐cadherin (ab231303, Abcam), vimentin (ab92547, Abcam), and GAPDH (60004‐1‐Ig, Proteintech Group, Chicago, IL, USA) at 4°C, and 2‐h incubation with the secondary goat anti‐mouse antibody to immunoglobulin G (IgG) (ab6789, Abcam) or goat anti‐rabbit antibody to IgG (ab6721, Abcam). The protein bands were visualized using a Bio‐Rad gel imaging system (Bio‐Rad Laboratories, Hercules, CA, USA) and quantitatively analyzed using the IPP7.0 software (Media Cybernetics, Bethesda, MD, USA).

2.5. Dual‐luciferase assay

The binding sites of miR‐1321/miR‐7515 and CDC20 were predicted using the bioinformatics websites StarBase (http://starbase.sysu.edu.cn/) and TargetScan (www.targetscan.org), and then the target relation between miR‐1321/miR‐7515 and CDC20 was verified using the dual‐luciferase reporter system. CDC20 plasmids containing the binding sites of miR‐1321 and miR‐7515 (CDC20‐wild type [wt] and CDC20‐mut) were constructed. The Rellina plasmid (Promega Corporation, Madison, WI, USA) and two reporter plasmids were co‐transfected with miR‐1321 mimic, miR‐7515 mimic, and NC mimic plasmids into HEK293T (ATCC) cells. At 24 h post‐transfection, the dual‐luciferase assay was performed. The cells were first lysed and centrifuged at 12000 rpm for 1 min to collect the supernatant. According to the manufacturer's instructions, the luciferase activity was measured using the dual‐luciferase reporter kit (Promega). The lysed cell sample was added into the Eppendorf tube, and 100 μl of firefly luciferase working solution was added in every 10‐μl sample. After the measurement of firefly luciferase activity, 100 μl of Rellina working solution was added to determine the activity of Rellina luciferase. Relative luciferase activity = firefly luciferase activity/Rellina luciferase activity.

2.6. Cell count kit (CCK)‐8 assay

Cell proliferation was measured using CCK‐8 kits (Bimake, Houston, TX, USA). At 24 h post‐transfection, the cells were plated in 96‐well plates at 3000 cells/well. CCK8 solution diluted by medium was added every other day and cultured in the dark for 1 h. Finally, the OD value at 450 nm was assessed using a microplate reader.

2.7. 5‐Ethynyl‐2′‐deoxyuridine (EdU) staining

DNA synthesis of cells was examined using the EdU staining kit (Beijing Solabio Life Sciences Co., Ltd., Beijing, China). Briefly, an appropriate amount of 50 μM EdU medium was prepared by diluting EdU solution with a cell culture medium at the ratio of 1:1000. The cells cultured in 96‐well plates (1 × 10⁵ cells/well) were incubated for 2 h in 100 μl of 50 μM EdU medium per well. After that, the cells in each well were fixed with 50 μl of 4% paraformaldehyde for 30 min and treated with 50 μl of 2 mg/ml glycine, followed by the addition of 100 μl of 0.5% TritonX‐100 for permeabilization. After a 30‐min reaction with 100 μl of Apollo staining solution in the dark at room temperature, 100 μl of Hoechst 33342 solution was added for staining of the nuclei and incubated for 30 min in the dark. The cells were observed by fluorescence microscopy, and the rate of EdU‐positive cells was calculated using the ImageJ software (National Institutes of Health, Bethesda, MD, USA).

2.8. Flow cytometry

The cells were detached using 0.25% trypsin solution at 48 h post‐transfection. When the cells were contracted and round under the microscope, the culture medium containing serum was added to terminate the detachment of cells. The cells were dispersed into cell suspension. After 5‐min centrifugation at 1000 rpm, the supernatant was aspirated. The cells were fixed with 70% ethanol for 24 h at −20°C, centrifuged, and collected. Next, the cells were incubated with 100 μg/ml RNAase at 37°C for 30 min and with 50 μg/ml propidium iodide (PI) at 4°C for 30 min. The suspension was filtered through a 300‐mesh nylon membrane, and then the volume was adjusted to 1 ml using PBS balanced salt solution. Samples were injected into a BD‐Aria flow cytometer (FACS Calibur, Beckman Coulter, Chaska, MN, USA), carefully cleaned according to the manufacturer's instructions to detect the cell cycle.

The concentration of cells was adjusted to 1 × 10⁶ cells/ml at 48 h post‐transfection, and the cells were fixed with 70% precooled ethanol overnight at 4°C. After that, the cell suspension of 100 μl (no less than 10⁶ cells/ml) was washed with PBS twice and centrifuged. The cells were resuspended in 200 μl of binding buffer solution and treated with 10 μl of annexin V‐FITC and 5 μl of PI for 15 min in the dark, followed by the addition of 300 μl of binding buffer. Apoptosis was detected using the BD‐FACS Calibur flow cytometer at an excitation wavelength of 488 nm. Apoptosis rate was defined as the sum of early apoptotic cells (Annexin V‐FITC⁺/PI⁻) and late apoptotic cells (Annexin V‐FITC⁺/PI⁺).

2.9. Wound healing assay

Wound healing assays were used to assess the migration ability of cells. A total of 1 × 10⁴ cells were seeded into 6‐well plates and cultured to attain a 80%–90% confluence. Wounds were created using a 200‐μl pipette and incubated with a serum‐free medium. Images were obtained using a microscope (DMI1, Leica, Bannockburn, IL, USA) at 0 and 48 h. Cell migration was analyzed using the ImageJ software.

2.10. Transwell assay

The invasion of the cells was detected using the Transwell culture system. The apical chamber coated with Matrigel (BD Biosciences) was used. The chamber was rehydrated with a serum‐free medium at 37°C for 2 h. The apical chamber was then hydrated with 200 μl of cell suspension (1 × 10⁵ cells). The basolateral chamber was filled with 500 μl of medium containing 10% FBS. After culturing at 37°C for 24 h, the cells on the surface of the membrane were fixed for 5 min with formaldehyde, stained for 10 min with 10% crystal violet, and counted using the microscope.

2.11. Chromosome stability analysis

The chromosomal stability of the cells was analyzed according to a previous report. ¹⁹ BASE‐2 cells were treated with 0.01 μg/ml colcemid for 1 h and 75 mM KCl at 37°C for 45 min. The cells were fixed in freshly prepared Carnoy's fixative, and the fixative solution was changed three times. The cells were loaded onto a cooled slide and air‐dried. After air drying, the slides were stained with Giemsa (Beijing Solarbio Life Sciences Co., Ltd., Beijing, China). Chromosomes in control (NC inhibitor) and anti‐miR (miR‐1321/miR‐7515 inhibitor) cells were counted, and the proportion of cells with different chromosome numbers in each group was plotted.

2.12. Statistical analysis

The data were analyzed using SPSS 21.0 (IBM Corp. Armonk, NY, USA), GraphPad Prism 8.0.2 software (GraphPad, San Diego, CA, USA) and GPower 3.1.9.2 software (Beijing, China). The normal distribution of the data was confirmed by the Kolmogorov–Smirnov test. The measurement data of three independent experiments are expressed as mean ± standard deviation. The pairwise comparisons were performed using the t‐test, and the comparisons among multiple groups were performed using the one‐way or two‐way analysis of variance. Secondary validation of the analysis procedure was also performed. Log‐rank test was used to analyze the survival rate of patients, whereas Fisher's exact test was used to analyze the clinicopathological parameters of patients. A p value of <0.05 was considered statistically significant.

3. RESULTS

3.1. CDC20 is highly expressed in NSCLC tissues and cell lines, thus predicting the dismal prognosis of NSCLC patients

qRT‐PCR showed that CDC20 in NSCLC tissues was upregulated compared with normal tissues (p < 0.05) (Figure 1A). Patients were divided into CDC20 low expression group (n = 35) and CDC20 high expression group (n = 30) based on the mean value of CDC20 expression in tumor tissues of patients (3.658). We found that the expression of CDC20 was correlated with the tumor size and the Tumor, Node, Metastases (TNM) stage of patients (Table 2). The correlation between CDC20 expression and prognosis was assessed using the TCGA database. The survival time of patients with high CDC20 expression was shorter than that of patients with low CDC20 expression (Figure 1B, p < 0.05). CDC20 expression in BEAS‐2 cells and human NSCLC cell lines H1299, A549, NCI‐H23, and NCI‐H522 was also detected. Compared with BEAS‐2B cells, the CDC20 mRNA and protein expression in NSCLC cell lines were increased to varying degrees (Figure 1C,D, p < 0.05). A549 and H1299 cells with relatively high CDC20 expression were selected for further experiments.

FIGURE 1.

CDC20 is highly expressed in NSCLC tissues and cells and predicts poor prognosis. (A) CDC20 expression in NSCLC tissues determined by qRT‐PCR. (B) The relationship between CDC20 expression and the prognosis of patients with NSCLC was analyzed by TGCA data. (C,D) CDC20 mRNA and protein expression in cells examined by qRT‐PCR and WB. *p < 0.05, versus BEAS‐2B cells. The values in the figure are measurement data of three independent experiments, which are exhibited by mean ± SD. The comparison between two groups was conducted by paired t‐test (A), while the comparison among multiple groups was carried out by one‐way ANOVA (C,D). Log‐rank test was used to analyze the survival rate of patients (B)

TABLE 2.

The clinicopathological parameters of NSCLC patients with differential expressions of CDC20

Parameters		Total case	CDC20 expression		p value
		(n = 65)	Low (n = 35)	High (n = 30)
Sex	Male	42	19	23	0.073
	Female	23	16	7
Age (year)	≥55	34	20	14	0.4605
	<55	31	15	16
Tumor size (cm)	≥3	29	11	18	0.0262*
	<3	36	24	12
Smoking	Yes	39	18	21	0.2038
	No	26	17	9
TNM stage	I/II	37	26	11	0.0029**
	III/IV	28	9	19

Note: Fisher's exact test was used to analyze the clinicopathological parameters of the patients.

^* p < 0.05,

^** p < 0.01.

3.2. Silencing of CDC20 reverts the malignant phenotype of NSCLC cells

CDC20 was highly expressed in NSCLC cells, and we silenced CDC20 expression in A549 and H1299 cells using two siRNAs. siCDC20‐2 having a higher inhibitory effect on CDC20 expression, as evidenced by WB analysis, was selected for subsequent experiments (Figure 2A). The CCK‐8 analysis showed that the proliferation of siCDC20‐treated cells was significantly decreased compared with the siNC group (Figure 2B, p < 0.05). By detecting the DNA synthesis activity of cells using EdU staining, we observed that the loss of CDC20 inhibited the DNA synthesis in cells (Figure 2C, p < 0.05). Flow cytometry showed that the apoptosis rate of siCDC20‐treated cells was increased, and more cells were arrested in the G2/M phase and fewer cells in the S phase (Figure 2D,E, p < 0.05). Wound healing and Transwell assays indicated that the migration and invasion abilities of siCDC20‐treated cells were hindered (Figure 2F,G, p < 0.05). The results of WB experiments showed that the inhibition of CDC20 promoted the expression of E‐cadherin and inhibited the expression of vimentin, indicating the suppression of EMT (Figure 2H, p < 0.05). These results suggested that CDC20 silencing inhibited the proliferation, migration, and invasion capacities of NSCLC cells and enhanced apoptosis.

FIGURE 2.

Knockdown of CDC20 suppresses the proliferation, migration, and invasion capacities of NSCLC cells and promotes apoptosis and cell cycle arrest. (A) The efficiency of siCDC20 in A549 and H1299 cells measured by WB. (B) Cell proliferation evaluated by CCK‐8 method. (C) DNA synthesis activity in cells examined by EdU staining. (D,E) Cell apoptosis and cell cycle tested by flow cytometry. (F) Cell migration rate at 48 h determined by wound healing assay. (G) Cell invasion examined by Transwell assay. (H) EMT‐related protein expression in A549 and H1299 cells examined by WB. *p < 0.05, versus siNC group. The values in the figure are measurement data of three independent experiments, which are exhibited by mean ± SD. The comparison between two groups was conducted by unpaired t‐test (C,D,F,G), while the comparison among multiple groups was carried out by one‐way (A) or two‐way ANOVA (B,E,H)

3.3. miR‐1321 and miR‐7515 target CDC20 in NSCLC cells

To investigate the causes of elevated CDC20 expression in NSCLC, we analyzed all miRNAs targeting CDC20 in TargetScan (Figure 3A) and StarBase (Figure 3B). The miR‐7515 with the highest |Context++ score| was selected for study in the TargetScan. Only two miRNAs (miR‐1321 and miR‐140‐5p) were screened out to be the possible upstream miRNAs for CDC20. While StarBase did not score miRNAs, we analyzed the correlation between CDC20 expression and the expression of these two miRNAs in NSCLC using the Pan‐cancer platform of StarBase (Figure 3C). CDC20 expression was not significantly correlated with miR‐140‐5p in NSCLC (p > 0.05), while miR‐1321 has not been studied in the StarBase platform. Therefore, miR‐1321 was selected in StarBase for further study. The potential binding sites between CDC20 and miR‐1321 (Figure 3D) or miR‐7515 (Figure 3E) were downloaded from StarBase and TargetScan. Subsequently, we designed the corresponding mutations based on their respective binding sites. The dual‐luciferase analysis confirmed the association between miR‐1321/miR‐7515 and CDC20. Overexpression of miR‐1321 and miR‐7515 significantly inhibited CDC20‐wt activity and had no significant effect on the luciferase activity of CDC20‐mut (Figure 3F,G, p < 0.05). Compared with BEAS‐2B cells, the expression of miR‐1321 and miR‐7515 in NSCLC cell lines was less (Figure 3H, p < 0.05).

FIGURE 3.

miR‐1321 and miR‐7515 target CDC20 in NSCLC cells. (A) miRNAs targeting CDC20 predicted in TargetScan. (B) miRNAs targeting CDC20 predicted in StarBase. (C) Correlation of CDC20 expression with miR‐140‐5p and miR‐1321 in NSCLC analyzed in the Pan‐cancer platform of Starbase. (D,E) Binding site between CDC20 to miR‐1321 and miR‐7515, respectively, and designed mutation sites. (F,G) Luciferase analysis of the targeting relationship between miR‐1321/miR‐7515 and CDC20; *p < 0.05, versus NC mimic group; (H) miR‐1321 and miR‐7515 expression in cells measured by qRT‐PCR; *p < 0.05, versus BEAS‐2B cells; (I) miR‐1321 and miR‐7515 overexpression efficiency by qRT‐PCR. (J,K) CDC20 transcription and protein levels in response to miR‐1321 mimic or miR‐7515 mimic transfection measured by qRT‐PCR and WB; *p < 0.05, versus NC mimic group. (L) The expression of miR‐1321, miR‐7515, and CDC20 in BEAS‐2B cells in response to miR‐1321 inhibitor or miR‐7515 inhibitor transfection examined using qRT‐PCR; *p < 0.05, versus NC inhibitor group. (M) Stability of chromosomes in BEAS‐2B cells in response to miR‐1321 inhibitor or miR‐7515 inhibitor transfection. The values in the figure are measurement data of three independent experiments, which are exhibited by mean ± SD. The comparison among multiple groups was carried out by one‐way (J,K) or two‐way ANOVA (F,G,H,I,L)

We transfected the A549 and H1299 cells with NC mimic, miR‐1321 mimic, or miR‐7515 mimic and verified their efficiency by qRT‐PCR. Compared with the cells transfected with NC mimic, the expression of miR‐1321 and miR‐7515 was significantly upregulated in the cells transfected with miR‐1321 mimic or miR‐7515 mimic, respectively (Figure 3I, p < 0.05). After upregulation of miR‐1321 and miR‐7515 in A549 and H1299 cells, CDC20 mRNA and protein expression was assessed. Compared with the NC mimic group, CDC20 mRNA and protein expression in miR‐1321 mimic‐ and miR‐7515 mimic‐treated cells was decreased (Figure 3J,K, all p < 0.05). We transfected anti‐miR (miR‐1321 inhibitor or miR‐7515 inhibitor) into BEAS‐2B cells and found that the inhibition of either miR‐1321 or miR‐7515 increased the expression of CDC20 in the cells using qRT‐PCR (Figure 3L, p < 0.05). Cellular chromosome stability analysis analyzed the effect of miR‐1321 inhibitor or miR‐7515 inhibitor transfection on chromosome number changes in BEAS‐2B cells. We found that the inhibition of miR‐1321 and miR‐7515 increased the incidence of cells with different chromosome numbers, inducing chromosome instability (Figure 3M, p < 0.05).

3.4. Overexpression of miR‐1321/miR‐7515 inhibits malignant episodes of NSCLC cells

The CCK‐8 analysis showed that the proliferation of cells transfected with miR‐1321/miR‐7515 mimic was decreased (Figure 4A, p < 0.05). EdU staining was performed to detect cellular DNA synthesis, and the DNA synthesis capacity of cells transfected with miR‐1321 mimic and miR‐7515 mimic was significantly reduced compared with the cells transfected with NC mimic (Figure 4B, p < 0.05). Flow cytometry showed that the apoptosis rate of miR‐1321/miR‐7515 mimic‐treated cells was increased, and more cells were arrested in the G2/M phase and fewer cells in the S phase (Figure 4C,D, p < 0.05). Wound healing and Transwell assays showed that the migration and invasion ability of cells overexpressing miR‐1321/miR‐7515 was downregulated (Figure 4E,F, both p < 0.05). WB analysis results showed that the protein expression of E‐cadherin was significantly higher, and vimentin was significantly lower in NSCLC cells transfected with miR‐1321 mimic or miR‐7515 mimic (Figure 4G, both p < 0.05). These observations implied that the upregulation of miR‐1321/miR‐7515 inhibited the proliferation, migration, and invasion of NSCLC cells and increased apoptosis.

FIGURE 4.

Ectopic expression of miR‐1321/miR‐7515 represses the proliferation and migration of NSCLC cells, while promotes apoptosis. (A) Cell proliferation measured by CCK‐8. (B) DNA synthesis activity in cells examined by EdU staining. (C,D) Cell apoptosis and cell cycle examined by flow cytometry. (E) Cell migration rate at 48 h determined by wound healing assay. (F) Cell invasion examined by Transwell assay. (G) EMT‐related protein expression in A549 and H1299 cells examined by WB. *p < 0.05, versus NC mimic group. The values in the figure are measurement data of three independent experiments, which are exhibited by mean ± SD. The comparison among multiple groups was carried out by one‐way (B,C,E,F) or two‐way ANOVA (A,D,G)

3.5. miR‐1321/miR‐7515 inhibits NSCLC cell malignant episodes by targeting CDC20

Next, rescue experiments were performed in A549 cells to verify that miR‐1321 and miR‐7515 can inhibit NSCLC cell growth by targeting CDC20. The efficiency of functional rescue treatment was verified (Figure 5A, p < 0.05). CCK‐8 and EdU analyses showed that the proliferation and DNA synthesis abilities of cells transfected with miR‐1321/miR‐7515 mimic + oe‐CDC20 transfection were increased compared with miR‐1321/miR‐7515 mimic + oe‐NC transfection (Figure 5B,C, p < 0.05). Flow cytometry showed that the apoptosis rate of cells in the miR‐1321/miR‐7515 + oe‐CDC20 mimic groups was decreased, and fewer cells were arrested in the G2/M phase and more cells in the S phase relative to cells in the miR‐1321/miR‐7515 mimic + oe‐NC group (Figure 5D,E, p < 0.05). Wound healing and Transwell assays showed that the migration and invasion ability of cells overexpressing miR‐1321/miR‐7515 and CDC20 was restored in comparison with cells overexpressing miR‐1321/miR‐7515 alone (Figure 5F,G) (all p < 0.05). WB analysis results showed that oe‐CDC20 also led to a decrease in E‐cadherin expression and an increase in vimentin expression in miR‐1321 mimic‐ or miR‐7515 mimic‐transfected cells (Figure 5H, p < 0.05). To summarize, miR‐1321 and miR‐7515 can inhibit NSCLC cell growth by targeting CDC20.

FIGURE 5.

miR‐1321 and miR‐7515 can inhibit NSCLC cell malignant biological behavior by targeting CDC20. (A) The protein expression of CDC20 after co‐transfection measured by WB. (B) Cell proliferation examined by CCK‐8. (C) DNA synthesis activity in cells examined by EdU staining. (D,E) Cell apoptosis and cell cycle examined by flow cytometry. (F) Cell migration rate at 48 h determined by wound healing assay. (G) Cell invasion examined by Transwell assay. (H) EMT‐related protein expression in A549 and H1299 cells examined by WB. *p < 0.05, versus miR‐1321 mimic + oe‐NC group; #p < 0.05, versus miR‐7515 mimic + oe‐NC group. The values in the figure are measurement data of three independent experiments, which are exhibited by mean ± SD. The comparison among multiple groups was carried out by one‐way (A,C,D,F,G) or two‐way ANOVA (B,E,H)

4. DISCUSSION

NSCLC, one of the major causes of cancer‐related fatality, constitutes 80% of all primary lung carcinomas. ²⁰ NSCLC causes great harm to the health and wellbeing of individuals, and the overall cure and survival rates are still low. ²¹ CDC20 is a reliable prognostic marker and a powerful therapeutic target in many cancers. ²² miRNAs play significant roles in NSCLC and are closely associated with the overall prognosis of NSCLC patients. ²³ In the present study, miR‐1321 and miR‐7515‐mediated CDC20 inhibition decreased EMT, proliferation, migration, and invasion and stimulated apoptosis and cell cycle arrest of NSCLC cells.

CDC20 is a well‐known oncoprotein that promotes the development and progression of human cancers. ²⁴ Bioinformatics analyses were performed previously to highlight the significance of CDC20 in the diagnosis and prognosis of NSCLC. ²⁵ , ²⁶ Moreover, CDC20 is oncogenic and frequently overexpressed in multiple malignant cancers, such as prostate cancer and breast cancer, with its high expression indicating a poor prognosis. ²⁷ , ²⁸ According to our findings, CDC20 expression was dramatically upregulated in NSCLC, and high CDC20 expression was considerably correlated with tumor size and TNM stage of NSCLC patients. Moreover, the TCGA database showed that patients with high CDC20 expression experienced shorter survival and poor prognosis. Consistent with this, emerging evidence has indicated that CDC20 is aberrantly upregulated in NSCLC and is associated with poor overall survival of NSCLC patients. ¹⁰ , ²⁹ Several studies have reported that decreased CDC20 expression exhibits a close relation with tumor inhibition in pancreatic cancer and osteosarcoma. ³⁰ , ³¹ Hence, we evaluated the effects of CDC20 on the biological behaviors of NSCLC cells by CDC20 knockdown in A549 and H1299 cells. We observed that siCDC20‐transfected NSCLC cells exhibited decreased EMT, proliferation, migration, and invasion, and increased apoptosis rate and proportion of cells in the G2/M phase, and reduced cells in the S phase. Similarly, a previous study has reported out that CDC20 knockdown helps decrease cell proliferation in NSCLC. ³² Downregulated CDC20 is intrinsically associated with inhibited cell proliferation and induced cell apoptosis in human lung cancer. ³³ To conclude, inhibition of CDC20 impeded EMT, proliferation, migration, and invasion, and supported the apoptosis of NSCLC cells.

It is well established that miRNAs are implicated in the regulation of NSCLC progression. ³⁴ A previous study reported that miRNAs target CDC20 and play an essential role in NSCLC. ³⁵ In the present study, the relation between miR‐1321/miR‐7515 and CDC20 was predicted, and we identified CDC20 as a common downstream target gene of miR‐1321 and miR‐7515. In addition, the abnormal downregulation of miR‐1321 and miR‐7515 in NSCLC cells were further observed. Consistently, it is evident that miR‐7515 expression is downregulated in lung cancer and recurrent epithelial ovarian cancer. ¹⁸ , ³⁶ Hence, we explored the effects of miR‐1321 and miR‐7515 expression changes on the biological phenomenon of NSCLC cells. According to our observations, NSCLC cells transfected with miR‐1321 mimic and miR‐7515 mimic showed suppressed EMT, proliferation, migration, and invasion, promoted apoptosis, and increased cell numbers in the G2/M phase and reduced cell numbers in the S phase. Hsa‐miR‐1321 was found to be significantly dysregulated in pediatric brain tumors (fold change 5.102661). ³⁷ Overexpression of miR‐7515 implies the blockade of proliferation, migration, and invasion, along with the notable downregulation of cell‐cycle‐associated proteins in lung cancer cells. ¹⁸ Nevertheless, the relationship between miR‐1321, miR‐7515, and CDC20 has not been reported, and the specific role of miR‐1321 and miR‐7515 in NSCLC remains unclear, which, on the other hand, highlights the novelty of the current study. The anaphase‐promoting complex (APC), a multi‐subunit ubiquitin ligase, accelerates mitotic and G1 progression and plays a role in maintaining genomic stability. ³⁸ Many APC substrates have been observed to be overexpressed in multiple cancer types such as CDC20, ³⁹ indicating the role of CDC20 in modulating cell cycle dysfunction and chromosome instability in cancer. Here, we found that miR‐1321 and miR‐7515 inhibitors in BEAS‐2B cells effectively promoted the risk of chromosome instability by enhancing CDC20 expression. Our functional rescue experiments further showed that overexpression of CDC20 could reverse the inhibitory effects of miR‐1321 and miR‐7515 overexpression on NSCLC cell EMT, proliferation, migration, and invasion, and impeded apoptosis and cell cycle arrest.

The current study supported that miR‐1321 and miR‐7515 suppressed NSCLC cell growth by targeting CDC20 (Figure 6). These results indicate their implications in a novel CDC20‐based therapy for NSCLC patients. Nevertheless, further in‐vivo and clinical studies are needed to clarify the involvement of miR‐1321 and miR‐7515 in NSCLC treatment.

FIGURE 6.

Molecular mechanism diagram. Both miR‐1321 and miR‐7515 can target CDC20, thus inhibiting the proliferation, migration, and invasion capacities of NSCLC cells

CONFLICT OF INTEREST

The authors declare no conflict of interest.

Hu H, Tou F‐F, Mao W‐M, Xu Y‐L, Jin H, Kuang Y‐K, et al. microRNA‐1321 and microRNA‐7515 contribute to the progression of non‐small cell lung cancer by targeting CDC20 . Kaohsiung J Med Sci. 2022;38:425–436. 10.1002/kjm2.12500

DATA AVAILABILITY STATEMENT

All the data generated or analyzed during this study are included in this published article.