LncRNA SNHG12 regulates the miR‐101‐3p/CUL4B axis to mediate the proliferation, migration and invasion of non‐small cell lung cancer

Abstract

Mounting evidence has shown that long noncoding RNAs (lncRNAs) play critical roles in carcinogenesis and tumor progression. SNHG12 has been identified in multiple types of malignant tumors. However, the role of SNHG12 in human non‐small cell lung cancer (NSCLC) is poorly characterized, and the relevant underlying mechanism remains unclear. The expression levels of SNHG12, miR‐101‐3p, and CUL4B in collected human NSCLC tumor tissues and NSCLC cell lines were tested via qRT‐PCR. Then, NSCLC cellular proliferation, migration and invasion were determined, followed by MTT, scratch and Transwell assays. Dual‐luciferase reporter assays and RNA pulldown assays were adopted to explore the target site. Moreover, western blotting was performed to detect the relevant protein expression concerning the CUL4B/PI3K/AKT pathway. This study clarified that SNHG12 knockdown significantly reduced proliferation, migration, invasion and EMT of NSCLC cells. Our data indicated that SNHG12 targeted and negatively regulated miR‐101‐3p, and this depletion reversed the inhibitory effect of si‐SNHG12 on NSCLC cells. Furthermore, CUL4B was confirmed as a functional target of miR‐101‐3p, and its knockdown resulted in a strong alleviation of the NSLCL cell phenotype, which was enhanced by the silencing of miR‐101‐3p. Mechanistically, we found that SNHG12 regulated miR‐101‐3p to modulate the PI3K/AKT pathway mediated by CUL4B.These observations suggested that lncRNA SNHG12‐mediated miR‐101‐3p downregulation regulated the malignant phenotype of NSCLC cells by targeting CUL4B through the PI3K/AKT pathway, which may present a path to novel therapeutic strategies for NSCLC therapy.

Abbreviations

3′UTR

3′ untranslated region

AKT

protein kinase B

ATCC

American Type Culture Collection

CRL4B

cullin4b‐RING‐based E3 ubiquitin ligases

CUL4B

cullin 4B

DMEM

Dulbecco's modified Eagle's medium

EMT

epithelial–mesenchymal transition

lncRNAs

long noncoding RNAs

NSCLC

non‐small cell lung cancer

PI3K

phosphatidylinositol 3‐kinase

PVDF

polyvinylidene difluoride

qRT‐PCR

quantitative real‐time PCR

SDS‐PAGE

sodium dodecyl sulfate‐polyacrylamide gel electrophoresis

SNHG12

small nucleolar RNA host gene 12

1. INTRODUCTION

Lung cancer is considered one of the most common malignant tumors, leading to the death of ~1.6 million people worldwide. ¹ Remarkably, non‐small cell lung cancer (NSCLC) accounts for 85% of lung cancer cases and is a primary cause of cancer‐associated death worldwide. Generally, diagnosis occurs in a large population of patients with NSCLC at an advanced stage due to the asymptomatic performance at an early stage. ² Major progress has been made in operational techniques and chemical therapy. However, the prognosis is unsatisfactory, with a low 5‐year survival rate. Thus, it is essential to disclose the underlying epigenetic mechanism involved in NSCLC for the development of an effective treatment strategy.

Long noncoding RNAs (lncRNAs), which were once considered “transcriptional noise,” have been confirmed to be functional. Recent studies have demonstrated that lncRNAs are linked to cellular development as well as other biological processes. ³ Notably, dysregulated lncRNAs are tightly correlated with the development and progression of distinct types of cancers. ⁴ For instance, Li et al. ⁴ reported that lncRNA BANCR enhanced the proliferative ability of melanoma by mediating the MAPK signaling pathway. Silencing of lncRNA HOTAIR could suppress the malignant phenotype of human glioma cells by modulating miR‐326. ⁵ Furthermore, the role of lncRNAs in NSCLC has been a research focus. It was reported that the expression of SNHG12 was increased in NSCLC. ⁶ However, the role of lncRNA SNHG12 in NSCLC has not been fully characterized.

MicroRNAs (miRNAs) are a cohort of short noncoding endogenous RNAs that bind to the 3′ untranslated region (3′UTR) of specific mRNAs, leading to translational inhibition or mRNA degradation, which modulates human gene expression and suppresses protein synthesis. ⁷ , ⁸ It has been reported that there are more than 1500 human miRNAs in the miRbase database, exerting an important effect on the post‐transcriptional modification of gene expression and thus influencing multiple cellular processes in embryonic development and disease conditions. ⁹ , ¹⁰ Mounting evidence indicates that several miRNAs are involved in NSCLC tumorigenesis and comprise a regulatory network in the development and progression of NSCLC. ¹¹ In previous studies, we showed that miR‐101‐3p might be a promising target for the diagnosis and treatment of NSCLC. ¹² However, the precise mechanism of miR‐101‐3p in NSCLC is still unclear.

In this research, we demonstrated that the malignant phenotype of NSCLC cells, including proliferation, migration and invasion, was inhibited after silencing of lncRNA SNHG12. Mechanically, we found that SNHG12 regulated the miR‐101‐3p/CUL4B axis to mediate the PI3K/AKT pathway.

2. METHODS

2.1. Samples of NSCLC patients

Samples of NSCLC tumor tissues (n = 15) and matched paracarcinoma tissues were collected from the First Affiliated Hospital of Nanchang University. All excised tissues were immediately snap‐frozen and stored at −80°C until use. The experiment was approved by the ethics committee of the First Affiliated Hospital of Nanchang University, and the samples were acquired with the consent of the patients.

2.2. Cell culture

The NSCLC cell lines A549 and H1299 were purchased from the American Type Culture Collection (ATCC, United States). The cells were incubated in Dulbecco's modified Eagle medium (DMEM, Gibco, United States) containing 10% fetal bovine serum (FCS, Gibco, United States) as well as 1% penicillin/streptomycin (Gibco, United States) at 37°C in a humified atmosphere with 5% CO₂. Both cell lines were subpassaged for fewer than 6 months.

2.3. Plasmid construction and cell transfection

MiR‐101‐3p mimics and their inhibitors were purchased from GenePharma (Shanghai Gene Pharma Co., Ltd., China). Si‐SNHG12 and si‐CUL4B were purchased from RiboBio (Guangzhou RiboBio Co., Ltd., China). Transfection of the cells was conducted using Lipofectamine 2000 (Invitrogen, United States) in accordance with the manufacturer's recommendation.

2.4. RNA extraction and quantitative real‐time PCR

Total RNA was isolated from the cells by TRIzol (Invitrogen, United States). cDNA was obtained by reverse transcription with a Reverse Transcription Kit (TaKaRa), and real‐time PCR analysis was conducted with SYBR Green (TaKaRa). Then, the data obtained were normalized to U6 (for miRNAs) or GAPDH (for lncRNAs). Quantitative real‐time PCR (qRT‐PCR) assays were carried out using the ABI7500 system (Applied Biosystems). Subsequently, the changes in relative mRNA levels were determined by the 2^−ΔΔCt method. In this study, primers for qRT‐PCR are as follows:

SNHG12‐F: 5′‐TCTGGTGATCGAGGACTTCC‐3′;

SNHG12‐R: 5′‐ACCTCCTCAGTATCACACACT‐3′.

CUL4B‐F: 5′‐TGCTGCTCAGGAGGTCAGATC‐3′;

CUL4B‐R: 5′‐TGGAATCAAAGTCTTCTCTCTCGTT‐3′.

GAPDH‐F: 5′‐GTCAACGGATTTGGTCTGTATT‐3′;

GAPDH‐R: 5′‐AGTCTTCTGGGTGGCAGTGAT‐3′.

miR‐101‐3p‐F: 5′‐UACAGUACUGUGAUAACUGA A‐3′;

miR‐101‐3p‐R: 5′‐CAGUUAUCACAGUACUGUAUU‐3′.

U6‐F: 5′‐GCUUCGGCAGCACAUAUACUAAAAU‐3′;

U6‐R: 5′‐CGCUUCACGAAUUUGCGU GUCAU‐3′.

2.5. Western blotting

The collected cells were lysed after transfection for 48 h. Western blotting analysis was performed as previously described. ¹³ , ¹⁴ Briefly, whole cell lysates were normalized by OD600. Total proteins were isolated on sodium dodecyl sulfate‐polyacrylamide gels (SDS‐PAGE) and then transferred to polyvinylidene difluoride (PVDF) membranes (Millipore, United States). Next, the membranes were incubated with primary antibodies against Cullin 4B (SAB1406670, Sigma, CA, United States), p‐PI3K (ab182651, Abcam, MA, United States), PI3K (ab86714, Abcam, MA, United States), p‐AKT (ab38449, Abcam, MA, United States), AKT (ab8805, Abcam, MA, United States), E‐cadherin (ab40772, Abcam, MA, United States), N‐cadherin (ab245117, Abcam, MA, United States), and Vimentin (ab92547, Abcam, MA, United States), and then, the secondary antibody anti‐rabbit IgG‐horseradish peroxidase or anti‐mouse IgG‐HRP (HRP, 1:4000; Santa Cruz, United States) was added for incubation. GAPDH (HPA061280, Sigma, CA, United States) was used as an internal control. The signals were detected by enhanced chemiluminescence (Thermo Fisher). The gray values of bands were measured by QuantityOne software (Bio‐Rad), and the relative protein abundance was normalized to GAPDH expression.

2.6. MTT assay

The proliferation of the cells was determined by the MTT method. ¹⁵ Treated A549 and H1299 cells were seeded in 96‐well plates (1 × 10⁴ cells/well). Then, 10 μl of MTT solution was added to each well according to the manufacturer's instructions. The viability of cells was detected by measuring absorbance at 450 nm.

2.7. Scratch wound healing assay

The scratch assay was performed to identify cell migratory capacity. Briefly, treated cells were incubated in serum‐free medium for 24 h. The monolayer cells were scratched by a plastic tip in a straight line and washed with PBS to remove cell debris. The scratched cells were then cultured in serum‐free medium and returned to the incubator. The width of the scratch gap was observed and measured using an inverted microscope. Images were taken with a phase‐contrast microscope at 0 and 24 h after scratching.

2.8. Transwell assay

For cell invasion detection, a Transwell assay was adopted as described previously. ¹⁶ Treated A549 and H1299 cells were plated on the upper part of the Transwell chamber (precoated with Matrigel) in serum‐free DMEM, and DMEM plus 10% FBS was added to the lower part of the chamber as a chemoattractant. After incubation for 24 h at 37°C, cells in the upper part of the chamber were removed. Migrated cells in the lower part of the chamber were analyzed by crystal violet staining with an inverted microscope. The cell population was counted and calculated in five random visual fields of each chamber. Three independent assays were carried out.

2.9. RNA pulldown assay

The cells were transfected with biotinylated miR‐101‐3p (Guangzhou RiboBio Co., Ltd.). After 48 h of transfection, cell lysates were harvested and incubated with Dynabeads M‐280 Streptavidin (Invitrogen, CA, United States) for 3 h at 4°C. Next, the beads were washed three times with cold lysis buffer and once with high salt buffer (1% Triton X‐100, 0.1% SDS, 20 mM pH 8.0 Tris–HCl, 2 mM EDTA, 500 mM NaCl). Finally, the bound RNAs were extracted by TRIzol for qRT‐PCR.

2.10. Luciferase reporter assay

Cotransfection of the cells was conducted with the wild‐type or mutant SNHG12 construct or CUL4B gene (wild‐type or mutant) and miR‐101‐3p mimics or negative control vector. After transfection for 36 h, the cells were lysed with passive lysis buffer for 15 min. Next, the luciferase activity was detected by a dual‐luciferase reporter assay system (Promega, Madison, United States).

2.11. Statistical analysis

The expression values are shown as the mean ± SD. Descriptive statistics were calculated and are shown in the figures. One‐way analysis of variance was performed for various group comparisons. Student's t test was employed for comparisons between two groups. The statistical data were analyzed using SPSS software. p < 0.05 was statistically significant.

3. RESULTS

3.1. SNHG12 silencing weakened the proliferation, migration, invasion and EMT of NSCLC cells

To investigate the role of lncRNA SNHG12 in human NSCLC tumors, we collected the tissues of NSCLC patients (n = 15) and then used qRT‐PCR to examine the expression level of SNHG12. The qRT‐PCR results showed that SNHG12 expression was elevated in the NSCLC tumor tissues compared with the matched paracarcinoma tissues (Figure 1A). To explore the function of SNHG12 in NSCLC cells, we transfected si‐NC or si‐SNHG12 into A549 and H1299 cells. SNHG12 expression was determined by qRT‐PCR assays, and the observations showed that SNHG12 displayed a significant reduction with si‐SNHG12 treatment (Figure 1B). Moreover, the proliferation, migration and invasion of NSCLC cells were observed by a series of functional assays in vitro. The MTT assay results indicated that the proliferative ability of A549 and H1299 cells was significantly decreased after SNHG12 knockdown (Figure 1C). Scratch assays showed that the transfection of si‐SNHG12 strongly inhibited the migratory capacity of A549 and H1299 cells (Figure 1D). The data collected from the Transwell assay revealed that the invasion of A549 and H1299 cells was strongly attenuated when SNHG12 was silenced (Figure 1E). Western blot results showed that knockdown of SNHG12 increased the expression of E‐cadherin and decreased the expression of N‐cadherin and Vimentin in A549 and H1299 cells (Figure 1F), indicating that knockdown of SNHG12 suppressed epithelial–mesenchymal transition (EMT) in NSCLC cells. Together, these results indicated that SNHG12 knockdown suppressed the malignant phenotype involving proliferation, migration, invasion and EMT of NSCLC cells.

FIGURE 1.

SNHG12 silencing suppressed the proliferation, migration, invasion and epithelial–mesenchymal transition (EMT) of non‐small cell lung cancer (NSCLC) cells. (A) SNHG12 expression in the NSCLC tumor tissues of patients (n = 15) was determined by quantitative real‐time PCR (qRT‐PCR). (B) A549 and H1299 cells were transfected with si‐SNHG12 or si‐NC. qRT‐PCR was performed to detect the mRNA levels of SNHG12. (C) The proliferative ability of NSCLC cells was determined by MTT assays, and relevant comparative analysis was performed. (D) The cell migratory capacity was assessed by scratch assays. (E) Cell invasion was assessed by Transwell assays, and the number of migrated cells was calculated. (F) The expression of E‐cadherin, N‐cadherin and vimentin was detected by western blots. *p < 0.05; **p < 0.01; ***p < 0.001

3.2. SNHG12 negatively regulated miR‐101‐3p

Growing evidence has demonstrated that lncRNAs exert their functional effects by binding to corresponding target genes, which have been shown to be oncogenes or tumor suppressor genes implicated in tumorigenesis. Thus, bioinformatics analysis showed that SNHG12 directly targeted miR‐101‐3p, as shown in Figure 2A. To validate the association of miR‐101‐3p and SNHG12, we performed a luciferase reporter assay using the wild‐type (WT) or mutant (MUT) SNHG12 target sequences. Dual‐luciferase reporter assays demonstrated that the luciferase activity was attenuated after cotransfection with miR‐101‐3p mimics and wild‐type SNHG12 3′UTR (Figure 2B). To explore the function of miR‐101‐3p in human NSCLC tumors, we used qRT‐PCR to examine the expression level of miR‐101‐3p in the NSCLC patients (n = 15). The results revealed that the expression level of miR‐101‐3p was downregulated in the NSCLC tumor tissues compared with the matched paracarcinoma tissues (Figure 2C). In addition, qRT‐PCR assays were performed to test miR‐101‐3p expression in the A549 and H1299 cells treated with si‐SNHG12 or si‐NC. As presented in Figure 2D, SNHG12 knockdown led to an obvious increase in miR‐101‐3p expression. Collectively, these observations indicated that SNHG12 negatively affected miR‐101‐3p expression in NSCLC cells.

FIGURE 2.

SNHG12 negatively regulated miR‐101‐3p. (A) Schematic representation of SNHG12 as a direct target of miR‐101‐3p. (B) The regulatory association between SNHG12 and miR‐101‐3p was validated in a luciferase reporter assay. (C) MiR‐101‐3p expression in the non‐small cell lung cancer (NSCLC) tumor tissues of patients (n = 15) was examined via quantitative real‐time PCR (qRT‐PCR). (D) The expression of miR‐101‐3p was determined by qRT‐PCR. **p < 0.01; ***p < 0.001

3.3. SNHG12 mediated the proliferation, migration, invasion and EMT of NSCLC cells by regulating miR‐101‐3p

To ascertain the significance of miR‐101‐3p in NSCLC cells, we transfected A549 and H1299 cells with miR‐101‐3p mimic NC, miR‐101‐3p mimics, miR‐101‐3p inhibitor or its NC. Subsequently, qRT‐PCR assays were used to determine miR‐101‐3p expression. According to Figure 3A, miR‐101‐3p at the mRNA level was obviously increased or decreased in the A549 and H1299 cells after transfection with miR‐101‐3p mimics or miR‐101‐3p inhibitor. Furthermore, the MTT assay clarified that miR‐101‐3p mimics inhibited the proliferation of A549 and H1299 cells. Treatment with the miR‐101‐3p inhibitor contributed to the proliferation of A549 and H1299 cells, whereas this effect was remarkably reversed by cotransfection with si‐SNHG12 (Figure 3B). Consistent with this finding, miR‐101‐3p mimics inhibited the migration of A549 and H1299 cells, and silencing miR‐101‐3p enhanced the migration of A549 and H1299 cells, but treatment with si‐SNHG12 and miR‐101‐3p inhibitor displayed the opposite effect (Figure 3C). Additionally, Transwell assays showed an inhibitory effect on the invasive ability after transfection of miR‐101‐3p mimics but an enhanced invasive ability after transfection of the miR‐101‐3p inhibitor, whereas cotransfection with si‐SNHG12 and the miR‐101‐3p inhibitor significantly alleviated the invasion of NSCLC cells (Figure 3D). Next, we investigated the effect of SNHG12 and miR‐101‐3p on EMT in lung cancer. Western blotting results showed that miR‐101‐3p mimics increased the expression of E‐cadherin and decreased the expression of N‐cadherin and Vimentin, whereas knockdown of miR‐101‐3p had the opposite effect. However, this effect was remarkably reversed by cotransfection with si‐SNHG12 (Figure 3E). Combined with the aforementioned data, these findings suggested that silencing miR‐101‐3p enhanced the proliferation, migration, invasion and EMT of NSCLC cell lines and reversed the inhibitory effect caused by si‐SNHG12.

FIGURE 3.

SNHG12 mediated the proliferation, migration, invasion and epithelial–mesenchymal transition (EMT) of non‐small cell lung cancer (NSCLC) cells by regulating miR‐101‐3p. MiR‐101‐3p mimic NC, miR‐101‐3p mimics, miR‐101‐3p inhibitor, miR‐101‐3p inhibitor NC or si‐SNHG12+miR‐101‐3p inhibitor was transfected into A549 and H1299 cells. (A) Quantification of miR‐101‐3p at the mRNA expression level was performed by quantitative real‐time PCR (qRT‐PCR). (B–D) Proliferation (B), migration (C) and invasion (D) were determined by MTT, scratch and Transwell assays, respectively. (E) The expression of E‐cadherin, N‐cadherin and Vimentin was detected by western blotting. *p < 0.05; **p < 0.01

3.4. MiR‐101‐3p showed a negative regulatory effect by targeting CUL4B

To further identify the molecules targeted by miR‐101‐3p, using the accessible database miRDB (http://www.mirdb.org), we found that miR‐101‐3p directly targeted the CUL4B 3′UTR (Figure 4A). Furthermore, a dual‐luciferase reporter assay showed that miR‐101‐3p dramatically reduced the luciferase activity of wild‐type (WT) CUL4B compared with the mutant (MUT) CUL4B in A549 and H1299 cells, as shown in Figure 4B. Furthermore, an RNA pulldown assay indicated that biotinylated miR‐101‐3p interacted with SNHG12 (Figure 4C). To explore the function of CUL4B in human NSCLC tumors, we collected the tissues of NSCLC patients (n = 15) and then used qRT‐PCR to detect CUL4B expression. qRT‐PCR data revealed that CUL4B expression was increased in the NSCLC tumor tissues compared with the matched paracarcinoma tissues (Figure 4D). Furthermore, the results collected from the qRT‐PCR and western blotting assays demonstrated that CULB4 expression at the mRNA and protein levels was significantly decreased by overexpression of miR‐101‐3p, whereas knockdown of miR‐101‐3p enhanced CUL4B expression (Figure 4E,F). Collectively, these results demonstrated that miR‐101‐3p directly downregulated CUL4B expression in A549 and H1299 cells by targeting the CUL4B 3′UTR.

FIGURE 4.

MiR‐101‐3p exerted negative regulatory effect by targeting CUL4B. (A) Schematic representation of the CUL4B 3′UTR as a direct target of miR‐101‐3p. (B) Luciferase activity of A549 and H1299 cells cotransfected with WT or MUT CUL4B 3′UTR reporter genes was determined by dual‐luciferase reporter assays. (C) Biotinylated miR‐101‐3p could interact with SNHG12 via RNA pulldown assays. (D) CUL4B expression in the non‐small cell lung cancer (NSCLC) tumor tissues (n = 15) of patients was detected by quantitative real‐time PCR (qRT‐PCR). (E, F) A549 and H1299 cells were transfected with miR‐101‐3p inhibitor or miR‐101‐3p mimics, and (E) quantification of CUL4B at mRNA expression levels was performed by qRT‐PCR. (F) Cullin 4B protein expression was tested by western blotting. Cullin 4B is the protein name of CUL4B. *p < 0.05; **p < 0.01; ***p < 0.001

3.5. CUL4B reversed the phenotype of NSCLC cells induced by miR‐101‐3p

To explore the role of CUL4B in NSCLC cells, we transfected A549 and H1299 cells with si‐NC and si‐CUL4B. qRT‐PCR assays revealed that the expression of CUL4B was significantly decreased after transfection with si‐CUL4B (Figure 5A). The MTT assay indicated that CUL4B knockdown suppressed the proliferation of A549 and H1299 cells. However, the proliferative ability of NSCLC cells was strongly downregulated after cotransfection with the miR‐101‐3p inhibitor and si‐CUL4B (Figure 5B). In addition, the results from the scratch assay showed that treatment with si‐CUL4B exerted an inhibitory effect on the migration of A549 and H1299 cells, while this response was significantly enhanced in response to cotransfection of si‐CUL4B and the miR‐101‐3p inhibitor (Figure 5C). Consistent with this finding, Transwell assays showed that the invasion of A549 and H1299 cells was dramatically suppressed when CUL4B was silenced, and treatment with the miR‐101‐3p inhibitor and si‐CUL4B increased the invasive ability of NSCLC cells (Figure 5D). Western blotting results showed that knockdown of CUL4B increased the expression of E‐cadherin and decreased the expression of N‐cadherin and Vimentin in A549 and H1299 cells. However, this effect was remarkably reversed by cotransfection with the miR‐101‐3p inhibitor (Figure 5E). The results indicated that CUL4B knockdown exhibited suppressive effects on the phenotypes of A549 and H1299 cells enhanced by the miR‐101‐3p inhibitor.

FIGURE 5.

CUL4B reversed the phenotype of non‐small cell lung cancer (NSCLC) cells induced by miR‐101‐3p. (A) Quantification of CUL4B at the mRNA expression level via quantitative real‐time PCR (qRT‐PCR) in A549 and H1299 cells transfected with si‐NC or si‐CUL4B. (B‐D) NSCLC cells were transfected with si‐NC, si‐CUL4B, miR‐101‐3p inhibitor or miR‐101‐3p inhibitor+si‐CUL4B, and proliferation (B), migration (C) and invasion (D) were determined by MTT, scratch and Transwell assays, respectively. (E) The expression of E‐cadherin, N‐cadherin and Vimentin was detected by western blotting. *p < 0.05; **p < 0.01

3.6. SNHG12 regulated the CUL4B/PI3K/Akt pathway via miR‐101‐3p

To clearly explore the relevant protein expression implicated in the signaling pathway, we used a western blotting assay, and the results showed that CUL4B knockdown resulted in an apparent decrease in the phosphorylation levels of PI3K and AKT, while cotransfection with miR‐101‐3p inhibitors and si‐CUL4B restored the phosphorylation levels of PI3K and AKT (Figure 6A,B). Moreover, treatment with si‐SNHG12 significantly suppressed the CUL4B/PI3K/AKT pathway, while miR‐101‐3p inhibitors reversed this effect (Figure 6A,B). In addition, we found that overexpression of miR‐101‐3p decreased the expression of Cullin 4B and the phosphorylation levels of PI3K and AKT (Figure S6A). These observations showed that SNHG12 regulated the CUL4B/PI3K/AKT pathway by inhibiting miR‐101‐3p. Thus, SNHG12 regulated the CUL4B/PI3K/AKT pathway mediated by miR‐101‐3p to exhibit an important effect on NSCLC development and progression.

FIGURE 6.

SNHG12 regulated the CUL4B/PI3K/Akt pathway via miR‐101‐3p. (A, B) The protein levels of Cullin 4B, PI3K, and AKT and the phosphorylation of PI3K and AKT were detected via western blotting of A549 cells (A) and H1299 cells (B). Cullin 4B is the protein name of CUL4B. *p < 0.05; **p < 0.01

4. DISCUSSION

Lung cancer is one of the most prevalent malignancies worldwide. NSCLC is considered the most common type of lung cancer, accounting for 85% of all lung cancer cases. Additionally, this disease exhibits a 5‐year survival rate of 20%–30% post‐surgery. ¹⁷ Despite the technological advances in chemotherapy and radiotherapy, cancer metastases and recurrences are still the major obstacles. ¹⁸ Therefore, it is critical to investigate the underlying mechanism during tumorigenesis and tumor progression and develop potent therapeutic targets. Previous evidence demonstrated that the expression of SNHG12 in malignancy was significantly upregulated, ¹⁹ but the relevant molecular mechanism was not fully characterized. In our study, we revealed that SNHG12 targeted miR‐101‐3p and regulated proliferation, migration, invasion and EMT of NSCLC cells. Interestingly, miR‐101‐3p directly bound to CUL4B to regulate the malignant phenotype in NSCLC cells. We also demonstrated that SNHG12 regulated miR‐101‐3p to inhibit the CUL4B‐mediated PI3K/AKT signaling pathway in the development and progression of NSCLC cells.

The discovery of lncRNAs has emerged as a milestone in the molecular biology of human tumors, and lncRNAs are regarded as new regulators of various aspects of malignancies, such as epigenetics and transcriptomics. An increasing number of studies have shown that lncRNA dysregulation is implicated in the tumorigenesis of NSCLC. ²⁰ , ²¹ , ²² In previous reports, Wang et al. ²³ showed that lncRNA SNHG12 contributed to cell growth and proliferation in cells and could be a promising biomarker for the diagnosis of colorectal cancer, suggesting that SNHG12 may exert a regulatory function in cancer cells. SNHG12 has also been demonstrated to be a promotive agent mediating cell proliferation and migration in human osteosarcoma cells. ²⁴ According to a recent study, Wang et al. ²⁵ showed that SNHG12 was closely associated with NSCLC progression and was highly expressed in NSCLC tissues and related cell lines. Consistent with a previous study, our data revealed that the knockdown of SNHG12 significantly reduced the proliferative, migratory and invasive ability of NSCLC cells. It has been reported that SNHG12 promoted the proliferation and impaired apoptosis in glioma via downregulation of miR‐101‐3p. ²⁶ Similarly, we demonstrated that SNHG12 bound to miR‐101‐3p to negatively regulate miR‐101‐3p expression in A549 and H1299 cells. Additionally, the biological processes of NSCLC cells, including proliferation, migration, invasion and EMT, were consolidated by the miR‐101‐3p inhibitor, suggesting a link between SNHG12 and miR‐101‐3p involved in the carcinogenesis and development of NSCLC. Our findings identified SNHG12 as a candidate gene associated with aggressive phenotypes of NSCLC.

CUL4B, as a scaffold protein, recruits CRL4B ubiquitin ligase units and displays overexpression in distinct types of cancers. Mi et al. ²⁷ reported that CUL4B was increased in NSCLC tissues and critically promoted NSCLC growth in vitro and in vivo. However, the functional relevance of miR‐101‐3p and CUL4B during NSCLC progression is still largely unknown. In this study, CUL4B knockdown resulted in notable suppression of NSCLC cell proliferation, migration, invasion and EMT promoted by a miR‐101‐3p inhibitor, coinciding with the release of a report commissioned by Wang et al. ²⁸ In addition, data from Zhang et al. ²⁹ revealed that CUL4B overexpression abolished the inhibition effects of miR‐101‐3p on NSCLC cells proliferation, migration and invasion. These findings also supported our results.

As previously described, some specific lncRNAs could mediate cellular proliferation and cell cycle progression by regulating the PI3K/AKT pathway. ³⁰ , ³¹ Additionally, the activation of AKT driven by PI3K plays a significant role in modulating the expression level of its target genes to participate in cell biological events, such as proliferation, apoptosis, and differentiation. ³² It has been reported that lncRNA ZEB1‐AS1 regulates prostate cancer progression by mediating PI3K/AKT/mTOR signaling through the miR‐342‐3p/CUL4B axis. ³³ Qi et al. reported that CUL4B promoted gastric cancer progression through the CUL4B‐miR‐125a‐HER2 oncoprotein axis, suggesting the involvement of the PI3K/AKT pathway in CUL4B‐induced HER2 upregulation in gastric cancer. ³⁴ In this study, we demonstrated that the silencing of CUL4B in A549 and H1299 cells substantially reduced the phosphorylation levels of PI3K and AKT, but a miR‐101‐3p inhibitor could reverse this response. Intriguingly, SNHG12 knockdown blocked the CUL4B/PI3K/AKT signaling cascade. Our data showed that SNHG12 regulated the CUL4B/PI3K/AKT pathway mediated by miR‐101‐3p to play a crucial role in the malignant phenotypes of NSCLC.

We demonstrated that SNHG12 regulated the miR‐101‐3p/CUL4B axis to mediate the PI3K/AKT pathway in NSCLC progression. Importantly, SNHG12 may serve as a promising therapeutic biomarker for the diagnosis and treatment of NSCLC.

CONFLICT OF INTEREST

The authors declare that there is no conflict of interest.

Supporting information

FIGURE S6 MiR‐101‐3p decreased the expression of CUL4B and the phosphorylation levels of PI3K and AKT.

(A) MiR‐101‐3p mimic NC and miR‐101‐3p mimics were transfected into A549 and H1299 cells. The protein levels of Cullin 4B, PI3K, and AKT and the phosphorylation of PI3K and AKT were detected via western blotting of A549 cells and H1299 cells. Cullin 4B is the protein name of CUL4B. *p < 0.05; **p < 0.01; ***p < 0.001

Xie F‐W, Liu J‐C. LncRNA SNHG12 regulates the miR‐101‐3p/CUL4B axis to mediate the proliferation, migration and invasion of non‐small cell lung cancer. Kaohsiung J Med Sci. 2021;37:664–674. 10.1002/kjm2.12389