Microarc Oxidation Coatings Doped with a Low Proportion of Yttrium Enhance the Osseointegration of Titanium Implants through the BMP/Smad Pathway

Abstract

Adding metal ions is a promising strategy to enhance the biological performance of titanium implants. In this study, we aimed to explore the effects of yttrium on the osseointegration of titanium implants. First, a series of yttrium-doped titanium surfaces were fabricated via microarc oxidation (MAO) by incorporating yttrium acetate into the electrolyte, and then the surface characteristics of different substrates were evaluated. Subsequently, the cellular behaviors of different coatings were assessed, and the osteointegration effects were examined using a rat model. Finally, high-throughput sequencing was employed to elucidate the underlying mechanisms of the yttrium-doped MAO coatings. As the results indicated, the proportion of yttrium in the coatings increased as the concentration of yttrium acetate improved. Surface characterization revealed that the yttrium-doped MAO coatings exhibited a homogeneous porous morphology, with comparable roughness and wettability to those of the undoped MAO coating, while the morphology became inconsistent when the yttrium acetate concentration reached 30 mM. The in vitro assays demonstrated that the addition of yttrium notably improved the cell adhesion, spreading, proliferation, and osteogenic differentiation of MAO coatings when doped with a low proportion, accompanied by enhanced osseointegration according to the in vivo experiments. Further exploration revealed a significant enrichment of osseointegration-related signaling factors and the activation of BMP/Smad signaling in the effects of yttrium-doped titanium coatings, which was attributed to the excessive accumulation of phosphorylated Smad1/5/9 in the nucleus. In summary, our work demonstrates that the use of MAO coatings doped with a low proportion of yttrium can enhance the osseointegration of titanium implants, providing an efficient strategy to optimize titanium implant performance.

1. Introduction

Titanium implants have been widely used to replace missing teeth in clinical dentistry because of their excellent biocompatibility, and the osseointegration process has been established as the scientific basis of implantology.¹ Rapidly initiating the osseointegration process is highly important for the clinical application of titanium implants, and the surface properties of titanium implants play a vital role in this process.^2,3 To date, numerous studies have investigated the effects of surface modifications of titanium implants, and various metal ions, such as zinc (Zn), strontium (Sr), tantalum (Ta) and cerium (Ce) ions, have been demonstrated to improve osteoblast adhesion, enhance osteogenic effects, and modulate immunological responses,⁴⁻⁹ suggesting that the application of metal ions has potential in the context of titanium surface modification.

As a transition metal in the periodic table, yttrium (Y) is widely used in medical applications, such as in lasers and superconductors owing to its unique physical and chemical versatility.¹⁰ The +3 oxidation state is the most common oxidation state of yttrium, and a recent study expanded its application range by demonstrating that yttrium oxide (Y₂O₃) nanoparticles could improve the microhardness of titanium alloys after oxidation.¹¹ Moreover, the Y₂O₃ nanoparticles also present several biological features. For example, it has been demonstrated that adding Y₂O₃ nanoparticles to either polycaprolactone scaffolds or peptide gels can enhance the cellular behaviors of fibroblasts and exert angiogenic effects when the materials are applied in soft tissue engineering.^12,13 Zhang et al. prepared yttrium-doped titanium coatings via plasma electrolytic oxidation and reported that the coatings enhanced the adhesion, proliferation, and spreading of osteoblasts, accompanied by improved antibacterial activity.¹⁴ However, the osseointegration effects and molecular mechanisms of these coatings have not been investigated. The above studies suggest that yttrium is a candidate metal ion for the surface modification of titanium implants, but its application will require a mature fabrication technology and systematic research.

In recent years, several methods have been applied to introduce metal ions onto the surface of titanium implants, including plasma immersion ion implantation (PIII) and microarc oxidation (MAO). While PIII is limited by the need to precisely control coating structures, coatings generated via the MAO technique are characterized by a uniformly porous surface morphology.¹⁵ To date, titanium implants subjected to MAO have been applied in clinical dentistry with a long-term survival rate of more than 90%. Using arc discharge to trigger reactions on the anode, MAO can incorporate bioactive electrolyte components into the coating and form a film on the titanium surface. Moreover, several metal ion-doped coatings have been successfully added onto titanium surfaces by adjusting the electrolyte composition.¹⁶

In this study, we systematically explored the effects of yttrium on the osseointegration of titanium implants. A series of yttrium-doped titanium surfaces were fabricated via the MAO technique by adding different concentrations (0.375, 0.75, 1.5, 3.0, and 30 mM) of yttrium acetate to the electrolyte, and the surface properties of the different coatings were fully characterized. Then, the in vitro cellular behaviors of different titanium substrates were systematically investigated, as were the in vivo osseointegration effects. Furthermore, the molecular mechanisms underlying the physiological effects of the yttrium-doped MAO coatings were explored. Our research fully investigated the application concentration and osseointegration effects, as well as the potential mechanisms of yttrium ion in the modification of MAO-coated titanium implants, providing a feasible approach for surface modification of titanium implants.

2. Materials and Methods

2.1. Sample Preparation and Characterization

2.1.1. Sample Preparation

Titanium wafers (Φ14 mm × 1.5 mm, Φ26 mm × 1.5 mm, 2000 mesh) and screws (Φ1.2 mm × 8 mm) were manufactured from Ti-6Al-4 V, cleaned by sequential sonication with acetone, ethanol, and distilled water, and then dried under nitrogen. The electrolytes containing 0.1 M trisodium phosphate (Na₃PO₄·12H₂O, Aladdin, China) and 0.08 M sodium hydroxide (NaOH, Aladdin) were used as the control electrolyte (MAO-Y0). Yttrium acetate (C₆H₉O₆Y, Aladdin) with different concentrations (0.375, 0.75, 1.5, 3.0, and 30 mM) was added to the electrolytes for the preparation of yttrium-doped titanium samples (0.375 mM, MAO-Y1; 0.75 mM, MAO-Y2; 1.5 mM, MAO-Y3; 3.0 mM, MAO-Y4; 30 mM, MAO-Y5). For the MAO process, the procedure was set as constant voltage mode at 400 V for 10 min, following by a circulating flow of cold water to control the temperature at 25 °C. After that, the specimens were cleaned under ultrasonication for 30 s. As for the titanium screws, MAO-Y0, MAO-Y3, and MAO-Y4 were fabricated with the above procedure. All titanium samples were sterilized with 75% ethanol for 2 h before cell seeding.

2.1.2. Sample Characterization

The surface and cross-sectional morphology of titanium samples was examined using high-resolution scanning electron microscopy (SEM, JSM-7800F, JEOL, Japan). The elemental composition of the coatings was determined through energy dispersive spectroscopy (EDS, JSM-2300F, JEOL) and X-ray photoelectron spectroscopy (XPS, Axis Ultra, Kratos Analytical Ltd., UK). The crystalline phase of different samples was assessed by X-ray diffraction (XRD, D/Max 2500 PC, Rigaku, Japan). The surface roughness was measured by a step profilometer (Alpha-Step D-600, KLA corporation, USA). The wettability of different samples was evaluated by using a contact angle measuring instrument (DSA30, Kruss, Germany). Finally, the concentration of released yttrium ion was measured with inductively coupled plasma mass spectrometry (ICP-MS, Thermo Fisher Scientific, Rockford, IL, USA).

2.2. In Vitro Experiments

2.2.1. Cell Culture

Primary rat bone-marrow-derived mesenchymal stem cells (rBMSCs) were isolated from 10-week-old male Sprague–Dawley (SD) rats (Beijing Vital River Laboratory Animal Technology Co., Ltd., Beijing, China). After euthanasia via intraperitoneal injection of sodium pentobarbital at 250 mg/kg, the femurs and tibias were aseptically removed, and the bone marrow was flushed out using a syringe containing minimum essential medium alpha (α-MEM, Gibco, USA). The bone fragments were removed through filtering with a 70-μm cell strainer. The cells were collected after centrifugation at 1000 rpm for 5 min and cultured in α-MEM supplemented with 10% (v/v) fetal bovine serum (FBS, Gibco) and 1% (v/v) penicillin/streptomycin (Gibco) in a humidified atmosphere containing 5% CO₂ at 37 °C. The nonadherent cells were removed by changing the medium 72 h later, and the adherent cells were cultured further until reaching 80–90% confluence. The rBMSCs at passages three to five were used for the in vitro experiments.

2.2.2. Cell Adhesion

rBMSCs (5 × 10⁴ cells/well) were seeded onto different titanium samples in 24-well plates. After a 4 h incubation, the cells underwent three washes with PBS, followed by fixation in 4% paraformaldehyde for 15 min at room temperature. Subsequently, the nuclei were stained with 4′,6-diamidino-2-phenylindole (DAPI, Invitrogen, CA, USA). Confocal laser scanning microscopy (Nikon TiE-A1 plus, Tokyo, Japan) was employed to capture the images, and the cell attachment was quantified using ImageJ software (https://imagej.nih.gov/ij/).

2.2.3. Cell Morphology

rBMSCs (5 × 10⁴ cells per well) were seeded on different titanium samples in 24-well plates. For immunofluorescence assay, the cells were fixed with 4% paraformaldehyde for 15 min after incubating for 2 and 4 h. Alexa Fluor 488 phalloidin (Invitrogen) was used to stain the cytoskeleton for 1 h, and then DAPI (Invitrogen) was applied for the nuclei for 10 min. The samples were observed using confocal laser scanning microscopy (Nikon, TiE-A1 plus) and quantified using ImageJ software. For SEM analysis, the samples were rinsed three times with PBS after 4 h of incubation and then fixed with 2.5% glutaraldehyde for 15 min at room temperature and dehydrated with a graded ethanol series (10%, 20%, 30%, 50%, 70%, 80%, 90%, and 100%) for 15 min each. Finally, the cell morphology was observed by SEM (JSM-7800F, JEOL).

2.2.4. Cell Viability

A Cell Counting Kit-8 (CCK-8) assay was utilized to evaluate the cell viability. rBMSCs (2 × 10³ cells per well) were seeded on different titanium substrates in 24-well plates and cultured for 1, 3, and 5 days. The samples were collected to remove the culture media at the corresponding time points, rinsed with PBS, and incubated with 400 μL of fresh medium containing a 10% (v/v) CCK-8 solution (Biosharp, China) for 2 h in a new 24-well plate at 37 °C. Then, 100 μL of the solution from each well was transferred to a new 96-well plate, and the optical density (OD) of the medium was assessed using a microplate reader at a wavelength of 450 nm.

2.2.5. Osteogenic Differentiation

rBMSCs (5 × 10⁴ cells per well) were seeded on yttrium-doped titanium substrates in 24-well plates. After culturing for 24 h, the medium was replaced with osteogenic medium (OM), which is made up of α-MEM, 10% (v/v) FBS, 1% (v/v) penicillin/streptomycin, 10 mmol/L β-glycerophosphate (Sigma-Aldrich, USA), 0.2 mmol/L l-ascorbic acid (Sigma-Aldrich), and 100 nmol/L dexamethasone (Sigma-Aldrich) as previously described.¹⁷

2.2.6. Alkaline Phosphatase (ALP) Assay

Cells cultured in OM for 7 days were subjected to ALP staining and quantification. For ALP staining, the samples were washed three times with PBS and fixed with 95% ethanol for 15 min at room temperature and then conducted using a nitro-blue tetrazolium chloride (NBT)/5-bromo-4-chloro-3-indolyl phosphate toluidine (BCIP) staining kit (Beyotime, Shanghai, China). For the ALP quantification assay, the cells were treated with 1% Triton-X solution (Beyotime), and 200 μL of lysate was collected from each sample to measure ALP activity as the manufacturer instructed (Beyotime). Total protein content was determined using the bicinchoninic acid (BCA) method (Thermo Fisher Scientific) and used for normalization. OD values were measured at 520 and 562 nm using a microplate reader.

2.2.7. Alizarin Red S (ARS) Assay

Cells cultured in OM for 10 days were subjected to ARS staining and quantification. For ARS staining, the cells were fixed in 4% paraformaldehyde and then stained with 1% ARS (pH 4.2; Sigma-Aldrich) for 20 min at room temperature. For ARS quantitation, the stains were washed three times with ddH₂O, then dissolved in 100 mM cetylpyridinium chloride (Sigma-Aldrich) for 1 h, and measured at 570 nm using a microplate reader.

2.3. In Vivo Experiments

2.3.1. Surgical Procedure

All animal experiments (including the in vivo experiment of this study using 10-week-old male Sprague-Dawley rats) were approved by the Committee for the Care and Use of Laboratory Animals at Fudan University (Shanghai, China, Approval number: 202202006S) and conformed to ARRIVE guidelines. 10-week-old male SD rats were obtained from Beijing Vital River Laboratory Animal Technology Co., Ltd., and then kept in a specific pathogen-free controlled environment with unrestricted access to food and water under a 12-h light/dark cycle and were randomly divided into 3 groups (n = 6/group). After intraperitoneal injection of 3% sodium pentobarbital (0.1 mL/100 g), the rats were positioned laterally to expose the right femoral epiphysis, with the surgical sites being shaved and disinfected. The implantation was performed along the femoral condyle using a low-speed electric drill mounted with a 1 mm Kirschner wire and then completed with a 1.8 mm round burst under cold saline irrigation. The Ti screws (MAO-Y0, MAO-Y3, and MAO-Y4) were implanted into the femoral epiphysis using a screwdriver with an insertion torque of 10 Ncm. The incisions were sutured with 5–0 absorbable sutures in layers, and penicillin at the dose of 20000 U/kg was intraperitoneally administrated for 3 days to prevent infection.

2.3.2. Hematoxylin and Eosin (H&E) Staining

Following micro-CT scanning, half of the samples were fixed in 4% formalin overnight and decalcified in 10% ethylenediaminetetraacetic acid (EDTA) for 4 weeks. The screws were carefully removed from the femurs, and the samples were dehydrated, cleared, waxed, embedded in paraffin, and then cut into 5 μm-thick sections. To evaluate osseointegration around the screws, these sections were deparaffinized, rehydrated, and stained with hematoxylin and eosin (H&E). Additionally, the main organs of the rats, including the heart, liver, and kidneys, were collected for H&E staining.

2.3.3. Van Gieson Staining

The remaining samples were used for Van Gieson staining. Briefly, the samples were fixed with paraformaldehyde, dehydrated with ethanol, and cleared with xylene. After being embedded in poly(methyl methacrylate), the blocks were sliced into 300 μm-thick sections along the longitudinal axis and the implantation center using a hard tissue slicer (EXAKT 300CP) and then ground into 10 μm-thick slices with a grinding system (EXAKT 400 CS). A Van Gieson solution (Macklin, Shanghai, China) was applied to stain the slices, and the images were captured using an optical microscope (Olympus). The bone-implant contact (BIC, the percentage of bone volume to the total volume of the VOI around the implant) was determined by using ImageJ software.

2.3.4. Micro-CT Scanning

Three weeks postsurgery, all the rats were euthanized under anesthesia with 4% paraformaldehyde cardiac perfusion for femur collection. Microcomputed tomography (micro-CT) scanning was performed using Scanco μCT-40 and Scanco vivaCT 40 scanners (Zurich, Switzerland). The femurs were imaged with an X-ray tube at a potential of 70 kVp with an integration time of 200 ms, and the volume of interest (VOI) was set to a 0.2 mm radius around the screws. Three-dimensional (3D) reconstruction was carried out after scanning, and the parameters, including trabecular bone volume fraction (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular separation (Tb.Sp), were measured.

2.3.5. In Vivo Concentration of Yttrium Ion

To evaluate the concentration of yttrium ions in vivo, blood samples were obtained from the animals in different groups before cardiac perfusion. The samples were centrifuged at 1000 rpm for 15 min after placing at room temperature for 1 h. The supernatant was collected to determine the concentration of free yttrium ion using ICP-MS.

2.4. Mechanism Research

2.4.1. RNA Sequencing

Titanium pieces (MAO-Y0 and MAO-Y3) with a diameter of 26 mm were placed in six-well plates, and rBMSCs were seeded at a density of 5 × 10⁵ cells per well. The RNA purification, reverse transcription, library construction, and sequencing were performed at Shanghai Majorbio Biopharm Biotechnology Co., Ltd. (China) according to the manufacturer’s instructions (Illumina, San Diego, CA, USA). To construct the transcriptome library, 1 μg of total RNA was utilized following the protocol of the TruSeqTM RNA sample preparation kit (Illumina). In brief, the isolation of mRNA (mRNA) was carried out using oligo (dT) beads according to the polyA selection method. Subsequently, the isolated mRNA then fragmented with fragmentation buffer. The synthesis of double-stranded cDNA was accomplished using a SuperScript double-stranded cDNA synthesis kit (Invitrogen) with random hexamer primers (Illumina). After synthesis, the cDNA underwent a series of treatments, including end repair, phosphorylation, and ’A’ base addition according to the guideline of Illumina’s library construction. Libraries were size-selected for cDNA target fragments of 300 bp on 2% Low Range Ultra Agarose, followed by PCR amplification using Phusion DNA polymerase (NEB) for 15 cycles. After quantification with a TBS380, the paired-end RNA-seq library was sequenced using an Illumina NovaSeq 6000 sequencer, generating reads with a length of 2 × 150 bp. The raw paired-end reads were trimmed and quality-controlled using fastp (https://github.com/OpenGene/fastp) with default settings. The clean reads were then separately aligned to the reference genome in orientation mode using HISAT2 (http://ccb.jhu.edu/software/hisat2/index.shtml). The mapped reads of each sample were assembled using StringTie (https://ccb.jhu.edu/software/stringtie/). To identify differentially expressed genes (DEGs) between MAO-Y0 and MAO-Y3, the expression level of each gene was calculated using the transcript per million read (TPM) method. RSEM (http://deweylab.biostat.wisc.edu/rsem/) was employed to quantify gene abundances. DEGs with |log2 (fold change)| ≥ 1 and P-adjust < 0.05 were regarded as significantly differentially expressed. Moreover, a Kyoto Encyclopedia of Genes and Genomes (KEGG, http://www.genome.jp/kegg/) functional enrichment analysis was conducted to identify the significantly enriched DEGs in GO terms and metabolic pathways at P-adjust < 0.05 compared with the whole-transcriptome background.

2.4.2. Quantitative Real-Time PCR (qRT-PCR)

To verify the results of RNA sequencing, the titanium pieces (MAO-Y0, MAO-Y3, and MAO-Y4) were seeded with rBMSCs. Total cellular RNA was extracted using TRIzol reagent (Invitrogen) after culturing with osteogenic media for 4 days and then synthesized for first-strand cDNA with a Reverse Transcription System (Takara Bio). Then, the gene transcripts were quantified using a Power SYBR Green PCR Master Mix (Roche, Basel, Switzerland) and detected with a 7500 Real-Time PCR Detection System (Applied Bioscience, Foster City, CA, USA). The thermal settings were: 95 °C for 10 min, followed by 40 cycles of 95 °C for 15 s and 60 °C for 1 min. The primers (Sangon Biotech Co., Ltd., Shanghai, China) used are listed in Table 1, and the relative expression was normalized with Gapdh using the 2^–ΔΔCt method.

Table 1. Primers Used for Real-Time PCR.

Gene	Forward primer (5′-3′)	Reverse primer (5′-3′)
Alp	CGGCCATCCTATATGGTAACGG	CAGGAGGCATACGCCATCACA
Ocn	GGGCAGTAAGGTGGTGAATA	CCTGGAAGCCAATGTGGT
Col1a1	TGGATGGCTGCACGAGT	TTGGGATGGAGGGAGTTTA
Noggin	CCAGCACTATCTACACATCCGCCCA	GCGTCTCGTTCAGATCCTTCTCCTT
Bmp2	GGACTGCGGTCTCCTAAAG	CAGCCTCAACTCAAACTCG
Runx2	TCTGACCGCCTCAGTGATTT	TGCCTCGGGGTCTGTAATCTG
β-Actin	ATCCGCAAAGACCTGTACGC	TCTTCATTGTGCTGGGTGCC

2.4.3. Western Blotting (WB)

The titanium pieces (MAO-Y0, MAO-Y3, and MAO-Y4) were washed with frozen PBS after osteogenic induction for 4 days and lysed with radioimmunoprecipitation assay (RIPA) buffer containing 1% protease inhibitor cocktail (Roche) to extract total protein. The protein concentration was measured using the BCA protein assay after centrifugating at 12,000 rpm for 30 min at 4 °C. To investigate the activation of the BMP/Smad pathway, nuclear and cytoplasmic proteins were separately extracted after 4 days of osteoinduction using NE-PER Nuclear and Cytoplasmic Extraction Reagents (Thermo Fisher Scientific) according to the manufacturer’s instructions. The protein (25 μg) from each sample was subjected to 10% SDS-PAGE and then transferred to a polyvinylidene fluoride membrane (Millipore, Billerica, MA) after electrophoresis. The primary antibodies against Col1a1, BMP2, p-Smad1/5/9, and Smad1 (Cell Signaling Technology, Beverly, MA) were diluted at 1:1000 and incubated overnight at 4 °C. Histone H3 was used as an internal control for the nuclear protein, and GAPDH was used for the cytoplasmic and total proteins. Then, the horseradish peroxidase-conjugated antirabbit secondary antibodies were incubated at room temperature for 1 h. Finally, the membranes were visualized using a SuperSignal West Pico Plus ECL Kit (Thermo Fisher Scientific), and the intensity of the band was quantified using ImageJ software.

2.4.4. Immunofluorescent Assay

Paraffin sections obtained from the MAO-Y0, MAO-Y3, and MAO-Y4 groups were used for immunofluorescence staining. The primary antibodies against rabbit anticollagen I and BMP2 were incubated in blocking buffer overnight, followed by fluorescently labeled secondary antibodies and DAPI counterstaining for nuclear visualization. For the immunofluorescent assay of cellular samples, cells seeded on Ti pieces (MAO-Y0, MAO-Y3, and MAO-Y4) were cultured in OM for 4 days, washed three times with PBS, and fixed with 4% paraformaldehyde for 15 min. The cells were then perforated with 0.2% (v/v) Triton X-100 (Beyotime) for 10 min and blocked with 5% (v/v) BSA (Sigma-Aldrich) for 30 min. The primary antibody against p-Smad1/5/9 (13820T, Cell Signaling Technology) was incubated overnight at 4 °C at a dilution of 1:200. Goat antirabbit IgG Alexa Fluor 594 (A11012, Thermo Fisher Scientific) was used as the secondary antibody for 1 h at room temperature, and the nuclei were stained with DAPI for 10 min. After mounting, the samples were observed with confocal laser scanning microscopy (Nikon).

2.5. Statistical Analysis

The statistical analysis was performed with Prism 9 (GraphPad Software, San Diego, CA, USA). All the data are expressed as the mean ± standard deviation (SD). One-way analysis of variance followed by the Bonferroni post hoc test or two-way ANOVA followed by the Tukey post hoc test was utilized. Differences with a p-value < 0.05 were considered statistically significant.

3. Results

3.1. Characterization of Yttrium-Doped MAO Coatings for Titanium Surfaces

To determine the surface properties of yttrium-doped MAO coatings on titanium substrates, scanning electron microscopy (SEM) was conducted. As shown in the SEM images, a crater-shaped morphology was observed on the surface of the yttrium-doped MAO coatings, with an average pore diameter of approximately 2.5 μm, whereas the pores of the MAO-Y5 coating were smaller, accompanied by microcracks (Figure 1A). The element compositions of the different surfaces were further evaluated via energy dispersive spectroscopy (EDS) analysis, and four elements, titanium (Ti), oxygen (O), phosphorus (P), and yttrium (Y), were detected; a higher weight percentage (wt %) of Y was detected with increasing yttrium acetate concentration in the electrolyte (Figures 1B and 1C, Figure S1). Moreover, X-ray photoelectron spectroscopy (XPS) results confirmed a synchronous increase in the Y 3d peak, with Y 3d_3/2 and Y 3d_5/2 of Y₂O₃ appearing at 157.6 and 155.6 eV, respectively (Figure 1D), which is consistent with the XPS results reported in a previous study.¹⁴ The X-ray diffraction (XRD) results demonstrated that the coatings of all of the samples were mainly composed of rutile and anatase, with only a very small difference in the phase composition with yttrium doping (Figure 1E).

Figure 1.

Microstructural characteristics of yttrium-doped MAO coatings on titanium surfaces. (A) Representative scanning electron microscopy (SEM) images of different samples. Upper scale bar: 100 μm; lower scale bar: 5 μm. (B, C) Representative scanning electron microscopy (SEM) images and the weight percentage (wt %) of yttrium on different titanium substrates. Scale bar: 20 μm. (D) High-resolution X-ray photoelectron spectroscopy (XPS) spectra of the Y 3d peak on different samples. (E) X-ray diffraction (XRD) analysis of different samples. Results are shown as means ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 analyzed by one-way ANOVA followed by the Bonferroni post hoc test.

Then, the cross-sectional morphology of the yttrium-doped MAO samples was evaluated. The SEM images revealed a denser coating after yttrium doping; the thickness of the coating was 17.08 ± 1.573 μm for the MAO-Y0 samples and decreased to approximately 11–12 μm for most of the yttrium-doped samples, whereas the coating was uneven for the MAO-Y5 samples (Figures 2A and 2B). The composition and concentration of electrolytes play a role in the growth rate and density of MAO films, and the thickness of the film generated by the MAO technique has been reported to range from 5 to 20 μm in most studies.^14,18 We further assessed surface roughness by using a step profilometer, and the variation in average height tended to be greater in the yttrium-doped samples than in the MAO-Y0 samples (Figures 2C and 2D). Then, the wettability of the different samples was measured, and the water contact angle decreased to approximately 30° upon yttrium doping but increased to 64.5° at the maximum yttrium concentration (MAO-Y5) (Figure 2E). Finally, the concentration of Y³⁺ released from the yttrium-doped MAO coatings was analyzed via inductively coupled plasma mass spectrometry (ICP-MS), and the results indicated rapid Y³⁺ accumulation 1 day after immersion, with values reaching a plateau phase on day 7 (Figure 2F). Overall, the above results confirmed the successful construction of yttrium-doped titanium surfaces via the MAO technique, and the coatings exhibited a homogeneous morphology when the concentration of yttrium acetate was less than 3 mM.

Figure 2.

Surface properties of yttrium-doped MAO coatings on titanium surfaces. (A) SEM images showing the cross-sectional morphology of different samples. Scale bar: 20 μm. (B) Quantitative analysis of the coating thickness. (C) Representative surface scanning assessed by a step profilometer. (D) Quantitative analysis of the surface roughness average (Sa). (E) Representative images of water contact angles on different titanium surfaces. (F) The inductively coupled plasma mass spectrometry (ICP-MS) analysis of the released yttrium ion after incubation with PBS for 1, 7, 14, and 28 days. Results are shown as means ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 analyzed by one-way ANOVA followed by the Bonferroni post hoc test.

3.2. The in Vitro Effects of Different Titanium Coatings

To evaluate the cellular behaviors of different coatings, rBMSCs were cultured on the surfaces of different titanium substrates. As shown in Figures 3A and 3B, the number of attached cells was apparently greater on the MAO-Y2, MAO-Y3, and MAO-Y4 substrates than on the MAO-Y0 substrate after incubation for 4 h, while no remarkable difference was observed between the MAO-Y1 and MAO-Y0 substrates, and fewer attached cells were observed on the MAO-Y5 substrate. Cell morphology was also evaluated. As shown by fluorescence staining of the cytoskeleton, a spindle-shaped cell morphology was observed on the MAO-Y2, MAO-Y3, and MAO-Y4 substrates, and shriveled cells were observed on the MAO-Y5 substrate after 2 h of incubation (Figure S2), with a more remarkable difference observed when the incubation time was prolonged to 4 h (Figures 3C and 3D). Cell morphology plays a role in the lineage differentiation of MSCs. Peng et al. showed that star-shaped MSCs tended to differentiate into cells of the osteoblast lineage via the surface patterning technique, whereas circular MSCs tended to undergo adipogenic differentiation.¹⁹ In addition, a more stretched cell morphology with pseudopodium-like structures anchored on the surface pores was observed on the MAO surfaces after a 4 h incubation when yttrium was doped to a concentration of 3 mM (MAO-Y4) (Figure 3E). The crater-like MAO surface provided a favorable morphology for cell adhesion and spreading.

Figure 3.

In vitro cell behaviors of yttrium-doped MAO coatings on titanium surfaces. (A, B) Representative images and the counted number of attached rBMSCs with different samples. Scale bar: 50 μm. (C) Representative fluorescent images of cell morphology after incubating for 4 h. Green: F-actin; Blue: DAPI. Scale bar: 50 μm. (D) Quantification of the fluorescent areas per DAPI in panel C. (E) Representative SEM images of cell morphology after incubating for 4 h. Scale bar: 10 μm. Results are shown as means ± SD (n = 3). *p < 0.05, ***p < 0.001 analyzed by one-way ANOVA followed by the Bonferroni post hoc test.

Next, the viability of the cells cultured on yttrium-doped titanium surfaces was evaluated. Compared with those of the cells on the MAO-Y0 substrate, the cell proliferation rates of the rBMSCs cultured on the MAO-Y1, MAO-Y2, MAO-Y3, and MAO-Y4 substrates were significantly greater from day 1 to day 7, with the exception of the cells on the MAO-Y1 substrate on day 1; in contrast, the MAO-Y5 substrate had a negligible effect on cell viability at days 3 and 5 (Figure 4A). Finally, the osteogenic differentiation of rBMSCs on yttrium-doped MAO substrates was investigated via alkaline phosphatase (ALP) and alizarin red S (ARS) assays. Some blue staining and sporadic red tubercles were observed on the MAO-Y0 substrate after osseoinduction for 7 and 14 days, and the blue staining covered a large area on the MAO-Y3 and MAO-Y4 substrates, with more red tubercles formed 14 days later (Figure 4B), especially with the MAO-Y4 coating. Quantification of the ALP and ARS results revealed patterns similar to those observed via staining, in which the ALP concentration was 1.01 ± 0.028 mM for MAO-Y4 and 0.484 ± 0.031 mM for MAO-Y0, and the OD value detected in MAO-Y4 groups is 3.5 times greater than that of the MAO-Y0 group (Figures 4C and 4D). According to the above results, the titanium surface subjected to MAO had positive effects on cell proliferation and osteogenic induction, and these effects were improved after yttrium doping, with an optimal concentration of 3 mM. Finally, the accumulated yttrium release was analyzed, and a very low concentration of 0.0442 mM was detected even with the MAO-Y5 titanium sample (Figure 2F), which is much lower than the inhibitory concentration.²⁰ Taken together, these data show that the titanium surfaces with MAO coatings showed good biocompatibility and performed better when they were doped with a low proportion of yttrium.

Figure 4.

Cell proliferation and osteogenic differentiation of yttrium-doped MAO coatings on titanium surfaces. (A) The cell viability of rBMSCs measured by CCK-8. (B) Representative images of ALP staining at day 7 and ARS staining at day 14 of rBMSCs incubated on different titanium substrates. (C, D) ALP activity at day 7 and ARS quantification at day 14. Results are shown as means ± SD (n = 3). *p < 0.05, **p < 0.01, ***p < 0.001 analyzed by one-way ANOVA followed by the Bonferroni post hoc test.

3.3. The in Vivo Effects of Different Coatings

On the basis of the above in vitro results, the MAO-Y3 and MAO-Y4 substrates demonstrated the best effects on cellular behaviors. Therefore, to further investigate in vivo osseointegration effects, titanium screws prepared by adding 1.5 mM (MAO-Y3) and 3.0 mM (MAO-Y4) yttrium acetate in the electrolyte were implanted into the femurs of 10-week-old Sprague–Dawley (SD) rats, and MAO-Y0 was used as a control (Figure 5A). Hematoxylin–eosin (H&E) staining revealed more osteoid tissues around the yttrium-doped screws than around the MAO-Y0 screws, with thicker bone tissue in the MAO-Y4 group (Figure 5B). Van Gieson staining was further conducted to analyze bone formation around the screw threads. As shown in the images, more bone tissues were observed in the MAO-Y3 and MAO-Y4 groups, with 65.93% and 86.23% bone-to-implant contact (BIC), respectively (Figures 5C and 5D). Moreover, micro-CT scanning was used to obtain 3D reconstruction images of the different implants. The bone layers formed around the MAO-Y4 screws were the thickest (Figure 5E), and quantitative analysis of the new bone volume (BV/TV), trabecular thickness (Tb.Th), trabecular number (Tb.N), and trabecular separation (Tb.Sp) in the region of interest around the implants yielded results similar to those obtained via 3D reconstruction imaging (Figure 5F, Figure S3A). Moreover, H&E staining of the main organs, including the liver, kidney and spleen, was subsequently conducted to evaluate the safety of these implants for in vivo application, and the images revealed a normal histological morphology, with no inflammatory infiltration or tissue damage for all the experimental groups (Figure S3B). We further detected the residual yttrium content in the serum, and average concentrations of 0.05 μg/L (0.56 pM) and 0.056 μg/L (0.63 pM) yttrium ions were detected in mice implanted with MAO-Y3 screws and MAO-Y4 screws, with notable differences detected among the three groups (Figure 5G). As Liu et al. reported, rats exposed to 12 mM YCl₃ exhibited significant pathological changes, and the residual Y³⁺ content was far lower than 12 mM,²⁰ suggesting that titanium implants coated with a low proportion of yttrium are safe for application in vivo.

Figure 5.

In vivoosseointegration of yttrium-doped MAO coatings on titanium screws. (A) Surgical procedure for implanting titanium screws in the femurs of SD rats. (B) Representative H&E images showing the bone formation around the threads of titanium screws after 3 weeks. (C) Representative Van Gieson staining images of new bone formation around the implants. (D) Quantification of BIC measured by Van Gieson staining. (E) Representative 3D-reconstructed images from micro-CT analysis of different experimental groups. (F) Quantitative statistics of BV/TV in the ROI around the implants assessed by micro-CT. (G) The accumulated concentration of yttrium ion in the blood of different animal groups. Results are shown as means ± SD (n = 6). *p < 0.05, **p < 0.01, ***p < 0.001 analyzed by one-way ANOVA followed by the Bonferroni post hoc test.

3.4. Yttrium-Doped Titanium Surfaces Regulate Osteogenesis-Related Genes

To reveal the molecular mechanism of yttrium, high-throughput sequencing was performed with an MAO-Y4 titanium substrate on the basis of the above in vitro and in vivo results, and MAO-Y0 was used as a control. A total of 30,560 differentially expressed genes (DEGs) were detected. Principal component analysis (PCA) confirmed the existence of different transcriptome profiles between the MAO-Y0 and MAO-Y4 groups (Figure S4A), with 423 up-regulated DEGs and 212 down-regulated DEGs detected when the fold change threshold was set as 1.5 (Figure S4B). Gene Ontology (GO) enrichment analysis revealed the top 15 terms with significant differences (Figure 6A), and the DEGs were enriched mainly in “inflammatory response”, “cell adhesion”, “cell migration”, “extracellular matrix organization”, “angiogenesis”, “osteoblast differentiation”, “ossification”, “bone mineralization”, etc. As a series of highly ordered biological processes, the events leading to osseointegration include coagulum formation, granulation tissue development, provisional tissue formation, woven bone formation, and finally lamellar bone formation,²¹ and the enriched GO terms demonstrated efficient initiation of osseointegration after yttrium doping of MAO coatings on titanium implants.

Figure 6.

Yttrium-doped titanium surfaces regulate osteogenesis-related genes. (A) The top 15 GO terms of differentially expressed genes (DEGs) with rBMSCs cultured on yttrium-doped and undoped MAO titanium surfaces 4 days under osteogenic induction, the bubble size is proportional to the number of enriched genes, and the X axis represents rich factor. (B) Heatmap analysis displaying the expression levels of 18 osteogenesis-related DEGs. (C) Relative mRNA expression of Runx2, Alp, Col1a1, and Osx on MAO-Y3 and MAO-Y4 groups and the control (MAO-Y0) group. (D) Representative immunofluorescent staining images against Col1a1 (green) and Bglap (red) in rat femur sections with titanium implants. Results are shown as means ± SD (n = 4). *p < 0.05, **p < 0.01, ***p < 0.001 analyzed by one-way ANOVA followed by the Bonferroni post hoc test.

Moreover, heatmap analysis revealed the expression profile of osteogenesis-related genes, in which the expression of osteogenic genes, including collagen type 1 alpha 1 (Col1a1), bone gamma-carboxyglutamate protein (Bglap), bone morphogenetic protein 3 (Bmp3), and wingless-type 10b (Wnt10b), and transcripts of bone matrix components aggrecan (Acan) and dental matrix protein 1 (Dmp1), was upregulated, whereas that of matrix metalloproteinase 13 (Mmp13), an osteoclast differentiation marker, was downregulated (Figure 6B). Several signaling pathways, including the TGFβ/BMP, WNT, Notch, and Hedgehog pathways, are known to play critical roles in the regulation of osteogenic differentiation.²²⁻²⁴ qRT–PCR analysis confirmed the increased expression of Runt-related transcription factor 2 (Runx2), alkaline phosphatase (Alp), Col1a1, and Osterix (Osx) in the cells on the MAO-Y3 and MAO-Y4 substrates after osteoinduction for 4 days (Figure 6C). In addition, the in vivo expression of osteogenic markers was further investigated. As indicated by immunofluorescence staining of bone tissues, much stronger fluorescence was observed after Col1a1 and Bglap staining of samples exposed to MAO-Y3 and MAO-Y4 titanium screws than samples exposed to MAO-Y0 screws (Figure 6D). Bglap, which has been recognized as a marker of bone maturation, is the most abundant noncollagen protein in bone tissues.²⁵ The above data indicated a continuous regulation of the osteogenic process with low proportion yttrium-doped MAO coatings.

3.5. BMP/Smad Signaling Is Involved in the Effects of Yttrium-Doped Titanium Coatings

Among the signaling pathways that regulate osteoblastic differentiation and bone formation, the BMP pathway is recognized as a key endogenous modulator. It has been demonstrated that BMPs and their inhibitors play a crucial role in regulating MSC differentiation on microstructured titanium surfaces.²⁶ Zhang et al. reported that Y-doped titanium coatings significantly enhance osteogenic differentiation of osteoprecursor cells in vitro, with an associated increase in BMP2 protein levels.¹⁴ In our study, Western blot analysis revealed a dose-dependent increase in BMP2 on the MAO-Y3 and MAO-Y4 surfaces, along with an upregulation of Col1a1 expression (Figures 7A and 7B). Moreover, qRT-PCR analysis confirmed a decreased level of expression of Noggin on MAO-Y3 and MAO-Y4 titanium surfaces (Figure 7C). Since BMP2 primarily promotes osteogenic differentiation through the Smad-dependent pathway, we further examined Smad protein expression. Our results showed increased levels of phosphorylated Smad1/5/9 in the nucleus, with minimal detection in the cytoplasm; the ratio of phosphorylated Smad1/5/9 to Smad1 showed similar trends (Figures 7D and 7E). This nuclear accumulation of phosphorylated Smad1/5/9 was further confirmed by immunofluorescence staining in cells cultured on MAO-Y3 and MAO-Y4 surfaces compared with the MAO-Y0 group (Figure 7F). Overall, these results indicate that BMP/Smad signaling is involved in the effects of yttrium-doped titanium coatings, likely due to enhanced nuclear transport of phosphorylated Smad1/5/9.

Figure 7.

BMP/Smad signaling is involved in the effects of yttrium-doped titanium coatings. rBMSCs were incubated on MAO-Y3, MAO-Y4, and the control (MAO-Y0) substrates, with osteogenic induction for 4 days. (A) Western blot analysis of BMP2 and Col1a1 expression levels in total protein extracts from rBMSCs. (B) Quantitative analysis of BMP2 expression levels from panel A. (C) Relative mRNA expression of Noggin. (D) Western blot analysis of Smad1/5/9 protein phosphorylation in cytoplasmic and nuclear fractions of rBMSCs, with Histone-H3 as a nuclear reference, GAPDH as a cytoplasmic reference, and Smad1 levels representing nonphosphorylated Smad reference levels. (E) Quantitative analysis of Smad1/5/9 phosphorylation levels from panel D. (F) Representative immunofluorescent staining images against phosphorylated Smad1/5/9 (red) of rBMSCs on different titanium surfaces. Upper scale bar: 50 μm, lower scale bar: 10 μm. Results are shown as means ± SD (n = 4). *p < 0.05, **p < 0.01, ***p < 0.001 analyzed by one-way ANOVA followed by the Bonferroni post hoc test (B, C) and two-way ANOVA followed by the Tukey post hoc test (E).

4. Discussion

Yttrium is widely used in medical applications, while few studies investigated its effects in the surface modification of titanium implants. To the best of our knowledge, this study is the first in vivo exploration of yttrium-doped titanium implants generated using the MAO technique, and the introduction of a low proportion of yttrium promoted osseointegration, indicating its potential application in the surface modification of titanium implants.

Surface topography is a key property of an intraosseous implant. Various factors, such as the electrolyte composition, current density, voltage, duty cycle, and reaction time, play important roles in the formation of the coating during the MAO process.² Here, a homogeneous morphology was observed on the surface of the yttrium-doped MAO coatings, which turned out to be inconsistent with the MAO-Y5 titanium surface. The phenomenon might be attributed to the very high concentration of yttrium acetate, which introduced too many anions into the electrolyte. Propelled by high voltage, these anions bombarded the titanium surface and then melted and deposited in the coating during the MAO process.²⁷ In this case, some microcracks could be observed on the MAO-Y5 titanium substrate, and the cross-sectional images also exhibited an uneven morphology with the MAO-Y5 substrate. Abbas et al. illustrated the effects of electrical parameters on MAO coatings on titanium surfaces, in which a thickness of approximately 10 μm was obtained with a voltage of 300 V after 10 min of MAO.¹⁸ Here, the coating thickness remained consistent with that reported in previous studies, but both the surface and cross-sectional images confirmed a damaged MAO tomography when the concentration of yttrium acetate reached 30 mM (MAO-Y5), indicating an application range of yttrium acetate in the fabrication of yttrium-doped titanium implants with the MAO technique.

In line with damaged morphology, poor cellular performance was observed on the MAO-Y5 titanium substrate, including fewer attached cells and withered cell morphology, while more attached cells were observed on MAO-Y2, MAO-Y3, and MAO-Y4 titanium substrates, with an unfolding cell morphology. It is widely proved that early cell attachment and spreading play a critical role in the initiation of the osseointegration process. The underperformance of the MAO-Y5 titanium surface might be attributed to the damaged morphology rather than cytotoxicity caused by the high yttrium concentration. Liu et al. systematically evaluated the cytotoxicity of yttrium and reported a decreased cell proliferation rate when the concentration of yttrium chloride (YCl₃) reached 0.3 mM.²⁰ Here, the accumulated concentration of yttrium ions was 0.0442 mM with the MAO-Y5 titanium sample, which was only 15% of the inhibitory concentration. Moreover, better cellular behaviors were observed on yttrium-doped titanium surfaces with low proportion, in which both MAO-Y3 and MAO-Y4 substrates were distinguished with enhanced osteogenic differentiation and osseointegration effects as well as an improved expression of key signaling molecules, such as Runx2, Col1a1, and Osx. So far, a few studies reported yttrium-mediated modification in the promotion of bone regeneration. The nanofibrous scaffolds made of 3% yttrium-stabilized zirconia exhibited favorable osteogenic differentiation of human mesenchymal stromal cells.²⁸

As one of the most important extracellular signaling molecules, BMP2 could induce osteoblast differentiation and promote bone formation, and titanium implants loaded with BMP2 showed enhanced osseointegration.^29,30 Here, the expression of BMP2 was remarkably up-regulated on MAO-Y3 and MAO-Y4 titanium substrates, accompanied by a nuclear accumulation of phosphorylated Smad1/5/9. Upon BMP receptor activation, receptor-Smads (Smad1/5/9) are phosphorylated and form a complex with common-Smad (Smad4), which then transfer to the nucleus to regulate the expression of BMP target genes, such as Runx2 and Osx, and activate the expression of several effector molecules of osteogenesis, such as Alp, Bglap, and Col1a1.³¹⁻³⁴ Moreover, Noggin, a BMP antagonist, binds to BMPs and blocks their interaction with cell surface receptors, thereby preventing BMP signaling.^35,36 Inhibiting Noggin expression has been shown to activate BMPs and promote MSC osteogenic differentiation, while increased Noggin expression can induce adipogenic differentiation and is elevated in the serum of obese individuals.³⁷⁻⁴⁰ In our study, transcriptome sequencing data revealed a marked downregulation of Noggin in MSCs cultured on the MAO-Y4 titanium surface, suggesting the doped yttrium may suppress Noggin transcription, thereby enhancing BMP-mediated osteogenesis. Further studies are required to elucidate the specific mechanisms involved. Moreover, a previous study conducted by Zhang et al. showed an outstanding biocompatibility and antibacterial capacity of yttrium-doped titanium oxidate coating, in which the expression of BMP2 was also upregulated.¹⁴ Both Zhang’s and our studies confirmed the efficiency of yttrium to improve the cellular behaviors of titanium surfaces and the activation of BMP2 signaling, while Zhang et al. have investigated the antibacterial property, and we further extended the in vivo application and underlined the molecular mechanism.

5. Conclusions

In summary, we developed a series of yttrium-modified titanium coatings using the MAO method by incorporating different concentrations of yttrium acetate into the electrolyte. Surface characterization demonstrated that the addition of yttrium at low concentration significantly enhanced the surface properties of the MAO coating, resulting in a uniform, crater-like morphology as well as consistent roughness, hydrophilicity, and film density across different groups. Moreover, MAO coatings doped with a low proportion of yttrium improved the effects of the MAO coating on cellular behaviors and osteointegration, and the titanium substrate exhibited the best performance when the concentration of yttrium acetate reached 3 mM, which could be attributed to a significant enrichment of osteogenesis-related GO terms and a remarkable upregulation of osteogenic genes. Finally, the BMP/Smad signaling pathway was activated in the presence of the yttrium-doped MAO coating, as evidenced by the accumulation of phosphorylated Smad1/5/9 in the nucleus. Overall, our study demonstrated that incorporating a low proportion of yttrium via the MAO technique is a promising strategy to optimize the performance of titanium implants.

Data Availability Statement

The raw reads of RNA sequencing have been deposited into the NCBI Sequence Read Archive (SRA) database (Accession number: PRJNA1049627).

Supporting Information Available

The Supporting Information is available free of charge at https://pubs.acs.org/doi/10.1021/acsbiomaterials.4c02461.

• Figure S1: The weight percentage (wt %) of titanium (Ti), oxygen (O), and phosphorus (P) on different titanium substrates. Figure S2: Representative fluorescent images of cell morphology after incubating for 2 h. Figure S3: In vivo behaviors of yttrium-doped MAO coatings on titanium screws. Figure S4: The mRNA expression profile on Yttrium-doped titanium surfaces (PDF)

Author Contributions

^# C.Y.Z and C.H.Q contributed equally. C.Y.Z and C.H.Q are cofirst authors. Conceptualization: X.H.C and S.C; Methodology: C.Y.Z and G.Y; Investigation: C.Y.Z, G.Y, and Y.Y.Z; Visualization: C.H.Q and B.B.K; Supervision: C.H.Q and X.H.C; Wrote the original draft: C.H.Q and S.C; Writing (review and editing): X.H.C and S.C.

This study was financially supported by the National Key Clinical Program on Orthodontics (GJLCZDZK-2023–01), the Shanghai Top Priority Research Center Program (2023ZZ02009), the Outstanding Young Medical Talent Project of Shanghai Municipal Health Commission (2022YQ046), the Outstanding Young Talent Project of Shanghai Stomatological Hospital (SSH-2022-KJCX-C02), and the Foundation of Shanghai Stomatological Hospital (SSH-2022–09).

The authors declare no competing financial interest.