Skip to main content
International Journal of Molecular Sciences logoLink to International Journal of Molecular Sciences
. 2025 Feb 25;26(5):1984. doi: 10.3390/ijms26051984

Exploring the Prevalence of SMN1 Duplication and Deletion in Russia and Its Impact on Carrier Screening

Kristina Mikhalchuk 1,*, Aleksander Polyakov 1, Viktoria V Zabnenkova 1, Olga Ismagilova 1, Olga Shchagina 1
Editor: Alfredo Ciccodicola1
PMCID: PMC11900099  PMID: 40076610

Abstract

5q spinal muscular atrophy (5q SMA) is one of the most prevalent autosomal recessive disorders worldwide. In 5q SMA, cases of silent carriers have been reported, including SMN1 duplications, intragenic subtle variants, de novo variants, and mosaicism. This study included DNA samples from 3412 unexamined unrelated individuals with no known family history of 5q SMA. In addition, we studied 15 families in which the children had a confirmed diagnosis of 5q SMA caused by a homozygous deletion of exon 7 of SMN1. Each family included one parent who was a carrier of a heterozygous deletion of SMN1, while the other parent had two copies of SMN1. The copy number of SMN1 and SMN2 was detected by MLPA. Two previously reported genetic markers of SMN1 duplication, c.*3+80T>G and c.*211_*212del, were tested in 143 Russian residents with three copies of SMN1 and 15 parents with two copies of SMN1. The frequency of a heterozygous carrier of exon 7 deletion of SMN1 is 1 in 36 individuals (95% CI 33 to 39). The frequency of exon 7 duplication of SMN1 is 1 in 25 individuals (95% CI 20 to 30). Only three individuals of the studied SMN1 duplication carriers were detected to have genetic markers of SMN1 duplication. The study of SMN1 duplication genetic markers (c.*3+80T>G and c.*211_*212del) in Russian residents reveals only 1.9% of SMN1 duplication carriers.

Keywords: spinal muscular atrophy, silent carrier, genotype (2 + 0), carrier screening, 5q SMA, SMN1, duplication, deletion, markers, c.*3+80T>G, c.*211_*212del

1. Introduction

5q spinal muscular atrophy (5q SMA) is considered one of the most common autosomal recessive diseases worldwide. The prevalent pathogenic variant associated with 5q SMA is a deletion involving exon 7 of SMN1, which is present in 99% of the chromosomes of affected individuals and in a homozygous state accounts for 95–98% of 5q SMA cases [1]. The ability to determine the genetic cause of 5q SMA is critically important for patients, as only those with biallelic variants in SMN1 are eligible for genetic therapy. The accurate identification of pathogenic variants in patients with 5q SMA is also essential for genetic counseling in affected families. Currently, three FDA-approved treatment modalities for 5q SMA are available: (1) the gene therapy Onasemnogene abeparvovec (marketed as Zolgensma® (NOVARTIS PHARMA, AG (Basel, Switzerland)), which delivers a functional SMN1 to cells via an adeno-associated viral vector; (2) the antisense oligonucleotide (ASO) Nusinersen (marketed as Spinraza® BIOGEN NETHERLANDS, B.V. (Badhoevedorp, The Netherlands)), which increases levels of mRNA containing exon 7, produced by SMN2, by displacing splicing repressors hnRNPA1/A2 from their binding site; and (3) the small molecule splicing modifier SMN2 Risdiplam (marketed as Evrysdi® F. Hoffmann-La Roche, Ltd. (Basel, Switzerland)) [2,3].

Screening for exon 7 deletion of SMN1 as the underlying genetic cause of 5q SMA should be recommended to all couples during preconception counseling and as part of screening programs for potential carriers of 5q SMA. The estimated carrier frequency of 5q SMA ranges from 1 in 25 to 1 in 50 in different ethnic groups [4]. Due to the high carrier prevalence and severity of the disease, the American College of Medical Genetics and Genomics (ACMG) recommends pan ethnic screening for 5q SMA among all couples [5].

Most carriers of 5q SMA have a genotype characterized by one deletion of SMN1 on one chromosome and one functional copy of SMN1 on the other (genotype 1 + 0) (Figure 1). Identification of SMN1 copy number in population-based carrier screening allows the detection of most couples who are heterozygous carriers of SMN1 deletion before the birth of a child with 5q SMA. The efficiency of detection of heterozygous carriers by quantitative SMN1 copy number testing ranges from 70.5% to 95% in various ethnic groups [4,6]. Difficulties in accurately determining carrier status result from a number of complexities related to 5q SMA, including the presence of intragenic subtle variants in SMN1, the genotype in which two copies of SMN1 are present on the one chromosome with a deletion on the homologous chromosome, and the possibility of germline mosaicism, which may hinder the detection of carrier status in available genetic materials.

Figure 1.

Figure 1

Genotype variants in individuals without 5q SMA. Non-carriers carry at least one copy of SMN1 on each chromosome (genotypes 1 + 1, 2 + 1, 2 + 2). The majority of carriers have only one copy of SMN1, with no SMN1 on the other chromosome (genotype 1 + 0). Silent carriers have two copies of SMN1 on one chromosome, while SMN1 is absent on the other chromosome (genotype 2 + 0), which is not identified by routine quantitative methods. Silent carriers may also have two copies of SMN1 on each of the chromosomes, but one of the copies may carry an intragenic subtle variant (genotypes 1 + 1V, 2 + 1V). In addition, quantitative carrier screening is unable to detect germline mosaicism by variants in SMN1.

To date, two genetic markers associated with SMN1 duplication have been reported in the literature: variants NM_000344.3:c.*3+80T>G (g.27134T>G) (rs143838139), located in intron 7, and c.*211_*212del (g.27706_27707delAT), located in exon 8 of SMN1 [4]. Original studies of genetic markers of SMN1 duplication focused on the Ashkenazi Jewish population, where a founder effect from a common ancestor was hypothesized for the allele associated with SMN1 duplication. In the Ashkenazi Jewish population, the carrier frequency of 5q SMA is estimated to be approximately 1 in 41 individuals. Detection by copy number analysis of SMN1 is estimated to be approximately 90%. Of the remaining 10%, about 8% are identified as silent carriers of an SMN1 deletion on one allele (genotype 2 + 0). Several founder haplotypes of SMN1 have been identified in Ashkenazi Jewish individuals, in particular one that accounts for approximately 50% of all SMN1 duplications (genotype 2 + 1) in this ethnic group. The sequencing of the SMN1 genomic region among these carriers revealed significant variants, including c.3*+80T>G and c.*211_*212del, as well as other single nucleotide polymorphisms (SNPs) characteristic of this haplotype. In comparison, the prevalence of the SMN1 duplication (genotype 2 + 1) is significantly higher in the African American population at 49% [4]. This increased frequency correlates with the large number of asymptomatic carriers of the SMN1 deletion (genotype 2 + 0), and they were found to have the same unique haplotype as Ashkenazi Jewish carriers.

The prevalence of SMN1 duplications in Russia has not yet been studied. In this study, we analyzed the frequency of SMN1 duplications in unexamined unrelated individuals in Russia with no known family history of 5q SMA. Additionally, we investigated the diagnostic value of using the SMN1 duplication genetic markers (c.*3+80T>G and c.*211_*212del) to identify silent SMN1 deletion carriers. Understanding these factors is crucial for improving genetic screening strategies for 5q SMA in the Russian population.

2. Results

This study presents a quantitative copy number analysis of exon 7 copy number of SMN1 among 3412 unexamined unrelated residents of Russia with no known family history of 5q SMA. The analysis included a total of 6824 chromosomes, and further details are presented in Table 1.

Table 1.

SMN1 genotypes in the Russian population.

Genotypes One SMN1 Copy Two SMN1
Copies
Three SMN1 Copies Four SMN1
Copies
n = 3412 (100%) 94 (2.8%)
p < 0.001
(95% CI 91 to 97)
3175 (93%)
(95% CI 3069 to 3281)
137 (4%)
p < 0.001
(95% CI 133 to 141)
6 (0.2%)
p < 0.001(95% CI 5 to 7)

In a cohort of 94 residents of Russia, a heterozygous deletion of exon 7 of SMN1 was identified, which resulted in an allelic frequency of 0.014 (Appendix B). This represents a carrier frequency of approximately 1 in 36 residents (95% CI 33 to 39).

In a study of Russian population genotypes, more than two copies of exon 7 of SMN1 were detected in 143 residents. Notably, three copies were detected in 137 participants. Obviously, this genotype indicates duplication of SMN1 on one homologous chromosome 5, which resulted in a frequency of 4% in the study cohort. Based on the principles of Hardy–Weinberg equilibrium, we expected to see five to six individuals homozygous for this duplication (Appendix B). In fact, six individuals carried four copies of exon 7 of SMN1, confirming their homozygous status for SMN1 duplication. Thus, the duplication of exon 7 of SMN1 was detected in 149 out of 6824 chromosomes, which resulted in an allele frequency of 0.022.

Based on the allelic frequency of SMN1 deletion and duplication among Russian residents, the frequency of silent carriers, characterized by the genotype 2 + 0 (in which one chromosome 5 carries deletion of SMN1 while the other chromosome carries duplication of SMN1), is 0.0006, or 1 in 1667 residents of Russia (Appendix B). Thus, the findings reveal that 99.9% of Russian residents who requested to be screened for 5q SMA with two copies of exon 7 of SMN1 determined by MLPA are in fact not silent carriers of SMN1 deletion as a result of the genotype 2 + 0.

This study analyzed the presence of genetic markers of SMN1 duplication, c.*3+80T>G and c.*211_*212del, in a cohort of 158 Russian residents carrying SMN1 du-plication (population cohort and 15 parents of 5q SMA patients with two copies of SMN1), as well as in 209 unrelated Russian residents with one copy of SMN1. A control group not carrying SMN1 duplication was also examined for these markers. Among the 158 individuals with SMN1 duplication, two were identified to carry the genetic markers c.*3+80T>G and c.*211_*212del. Furthermore, one additional carrier of SMN1 duplication and these genetic markers was identified among the 15 investigated parents of 5q SMA patients. Notably, the genetic markers c.*3+80T>G and c.*211_*212del were absent in all samples within the control cohort consisting 209 individuals with one copy of SMN1. Thus, the identification of the genetic markers c.*3+80T>G and c.*211_*212del indicates that only 1.9% of carriers of SMN1 duplication are identifiable using these markers in the Russian population. Therefore, the detection of these genetic markers for the identification of silent carriers of 5q SMA due to genotype 2 + 0 is uninformative in Russia.

The issue of silent carrying is apparent for the partners of deletion carriers. When determining the necessity for further genetic tests, it is crucial to acknowledge the exceedingly low probability—approximately 0.1%—that an individual with two copies of SMN1 could have the genotype 2 + 0. In scenarios involving couples where one partner is a known carrier of a pathogenic variant in SMN1, while the other carries two copies of SMN1, it is possible to test for the genetic markers of SMN1 duplication as well as copy number analyses of SMN1 in the relatives of the partner carrying two copies of SMN1. Such a family analysis may provide insights regarding the cis or trans configuration of the existing two copies of SMN1, when SMN1 duplication markers are absent. For instance, the presence of three SMN1 copies in one parent of a consulted individual with two copies of SMN1, contrasted with one copy of SMN1 in the other parent, could indicate the possibility of silent carrier status in the offspring (Figure 2). Unfortunately, it is important to note that the absence of deletions and duplications in SMN1 among the parents does not eliminate the possibility of an individual carrying a genotype 2 + 0.

Figure 2.

Figure 2

Example of allele distribution with SMN1 in two families (a,b). In the first pedigree example (a), individuals requested carrier screening for a deletion in exon 7 of SMN1, individuals with two copies of SMN1 by MLPA (I.1, I.3, I.4, II.2) carry two copies of SMN1 on two alleles. In the second pedigree example (b), some individuals with two copies of SMN1 by MLPA (I.5, II.4) can carry two copies of SMN1 on the one allele (silent carriers of SMN1 deletion). Thus, when one partner is identified as a carrier of SMN1 deletion (II.3) and the other partner has two copies of SMN1 (II.4), it is recommended to determine the copy number of SMN1 in the parents of the partner with two copies of the SMN1. Individuals (I.2, I.6, I.7, I.8, II.1) carry one copy of SMN1 by MLPA. Chromosome 5 is schematically represented in blue, while the number of SMN1 copies, detected by MPLA, is schematically represented in orange. In this representation, one orange hexagon schematically represents one copy of SMN1, and two hexagons represent two copies of SMN1.

3. Discussion

Homo sapiens is the only species with two SMN paralogs in its genome: SMN1 and SMN2; all other species have only one SMN. In primates, only one SMN copy has been identified, indicating that the duplication of SMN and the surrounding genes of the SMN locus on chromosome 5q13.2 likely occurred during the evolutionary transition from primates to humans. Notably, while undergoing evolutionary changes, the nucleotide sequence of the duplicated SMN copy underwent important alterations, resulting in the formation of the SMN2 paralog. Studies show significant differences in the SMN locus among various ethnic groups. In particular, among African Americans, the frequency of carrying the genotype when both copies of SMN1 on one chromosome in a cis configuration is eight times greater than the frequency of SMN1 duplication observed in Caucasians. In contrast, Caucasians predominantly present a genotype with one copy of SMN1 and one copy of SMN2 [7].

Thus, in certain individuals who carry the deletion of exon 7 of SMN1, two copies of SMN1 may be localized on one chromosome in a cis configuration, resulting in a genotype 2 + 0. This configuration reduces the sensitivity of many carrier testing methodologies that measure only the number of copies. The mechanism of the origin of SMN1 duplication has not yet been thoroughly investigated; however, it may involve mechanisms similar to those that lead to the duplication of SMN2 on one chromosome: (1) gene conversion; (2) unequal crossing-over; and (3) a two-step process, which includes the intrachromosomal deletion of SMN2 followed by the duplication of the remaining SMN1 [8].

This study identifies the frequency of heterozygous carriers of the exon 7 deletion of SMN1 among Russian residents which is 1 in 36 individuals (95% CI 33 to 39). In comparison, the carrier frequency among other ethnic groups ranges from 1 in 25 to 1 in 50 [4]. Furthermore, the frequency of SMN1 duplication varies depending on ethnicity and exhibits variability across different populations (Table 2).

Table 2.

Frequency of rare genotypes of the SMN locus in population cohorts of various countries.

Ethnic Cohorts Number of Individuals with Three or More Copies of SMN1 in the Genotype Number of Individuals with One Copy of SMN1 Study
African Americans living in the Greater New York Metropolitan area 135 of 276 (49%) 5 of 276 (2%) [4]
Ashkenazi Jews living in the Greater New York Metropolitan area 99 of 692 (14%) 15 of 692 (2%) [4]
Asians living in the Greater New York Metropolitan area 24 of 248 (9.8%) 2 of 250 (0.8%) [4]
Hispanics living in the Greater New York Metropolitan area 42 of 262 (16%) 1 of 262 (0.4%) [4]
Caucasians living in the Greater New York Metropolitan area 31 of 458 (6.8%) 12 of 458 (2.6%) [4]
Residents of Russia 143 of 3412 (4.2%) 94 of 3412 (2.8%) The present study
Residents of Singapore 0 of 375 6 of 375 (1.6%) [9]

The frequency of carriers of SMN1 duplication among residents of Russia is lower than that observed in various ethnic cohorts in the United States (χ2 = 25.307, p < 0.001) and in Ashkenazi Jews in Israel (χ2 = 4.825, p = 0.029), but is higher than that in residents of Singapore (χ2 = 4.253, p = 0.04).

The literature documents a limited number of studies on the occurrence of the genetic markers of SMN1 duplication among various populations, as well as studies of families in which one parent of a patient with 5q SMA carries two copies of SMN1 in their genome (Table 3).

Table 3.

Screening for the presence/absence of variants c.*3+80T>G and c.*211_*212del. Ind. = individual/s; (homo) = homozygous state; (hetero) = heterozygous state.

Variants Parents of Patients with 5q SMA (n = 158) Normal Individuals (Population Cohort)
One SMN1 Copy Two SMN1 Copies Three SMN1 Copies One SMN1 Copy Two SMN1 Copies Three SMN1 Copies Four SMN1 Copies
Cohorts of Russia (the present study)
Total Ind. studied 30 3412
Ind. 15 15 0 94 * 3175 ** 137 6
c.*3+80T>G 0 1 0 0 No data 2 0
c.*211_*212del 0 1 0 0 No data 2 0
Cohorts of Spain [10]
Total Ind. studied 74 160
Ind. 41 32 1 No data 99 58 3
c.*3+80T>G 1 7 0 No data 0 11 0
c.*211_*212del 1 6 0 No data 0 11 0
Cohorts of Singapore [9]
Total Ind. studied 54 321
Ind. 45 9 No data 6 315 No data No data
c.*3+80T>G 0 3 No data 0 0 No data No data
c.*211_*212del 0 1 No data 0 0 No data No data
Ashkenazi Jews living in the Greater New York Metropolitan area [4]
Total Ind. studied No data 692
Ind. No data No data No data 15 315 (578) *** 99 0
c.*3+80T>G No data No data No data 0 0 No data 0
c.*211_*212del No data No data No data 0 0 No data 0
African Americans living in the Greater New York Metropolitan area [4]
Total Ind. studied No data 276
Ind. No data No data No data 5 136 111 24
c.*3+80T>G No data No data No data 1 2 (homo) 26 (hetero) 4 (homo) 86 (hetero) 23 (hetero)
c.*211_*212del No data No data No data 1 2 (homo) 26 (hetero) 4 (homo) 86 (hetero) 23 (hetero)
Asians living in the Greater New York Metropolitan area [4]
Total Ind. studied No data 248
Ind. No data No data No data 2 222 22 2
c.*3+80T>G No data No data No data 0 0 2 1
c.*211_*212del No data No data No data 0 0 2 1
Hispanics living in the Greater New York Metropolitan area [4]
Total Ind. studied No data 262
Ind. No data No data No data 1 219 40 2
c.*3+80T>G No data No data No data 0 1 (homo) 12 (hetero) 20 (hetero) 2 (hetero)
c.*211_*212del No data No data No data 0 1 (homo) 12 (hetero) 20 (hetero) 2 (hetero)
Caucasian s living in the Greater New York Metropolitan area [4]
Total Ind. studied No data 458
Ind. No data No data No data 12 415 27 4
c.*3+80T>G No data No data No data 0 2 4 2
c.*211_*212del No data No data No data 0 2 4 2

* A total of 209 individuals carrying one copy of SMN1 were studied: 94 individuals from the population cohort, 100 individuals from the control cohort, and 15 parents of patients with 5q SMA carrying one copy. None of the genetic markers of SMN1 duplication were detected in any of the individuals. ** In the population cohort with two copies of SMN1, the search for the genetic markers of SMN1 duplication, c.*3+80T>G and c.*211_*212del, was performed in only 215 individuals. None of the genetic markers of SMN1 duplication were detected in any of the individuals. *** Out of 578 individuals with two copies of SMN1, the search for genetic markers of SMN1 duplication, c.*3+80T>G and c.*211_*212del, was performed in 315 individuals.

The genetic markers c.*3+80T>G and c.*211_*212del present on chromosomes with two copies of SMN1 in cis configuration are detected with varying frequencies among different ethnic groups: 11 of 61 residents in Spain carrying 3–4 copies of SMN1, 113 of 135 African Americans, 3 of 24 Asians, 22 of 42 Hispanics, and 6 of 31 Caucasians (x2 = 37.2, p < 0.001). In contrast, these genetic markers were detected in only two of 143 residents of Russia carrying 3–4 copies of SMN1. Furthermore, in studies involving parent groups carrying two copies of SMN1 who have children with a homozygous deletion of SMN1, the genetic markers c.*3+80T>G and c.*211_*212del were also detected significantly less frequently among residents of Russia compared to those from Spain and Singapore [4,9,10].

In individuals carrying one copy of SMN1 from various ethnic cohorts, a haplotype of these two SNPs was detected in one African American [4]. The presence of these genetic markers on a chromosome without SMN1 duplication reduces their value as diagnostic markers. Specifically, the use the genetic markers c.*3+80T>G and c.*211_*212del as a marker of SMN1 duplication could result in both false-negative results— in cases of SMN1 duplication and absence of the genetic markers —and false-positive results.

The genetic markers c.*3+80T>G and c.*211_*212del are more commonly observed within the haplotype. However, alleles with SMN1 duplication that carry only the c.*3+80T>G variant have been identified in individuals from Singapore and Spain [9,10]. Notably, the c.*3+80T>G variant is preferred as a molecular marker for detecting SMN1 duplication than c.*211_*212del. The low frequency of marker SNPs on chromosomes with SMN1 duplication among cohorts of Asian and Caucasian cohorts in the United States, as well as residents of Singapore and Russia, can be attributed to the fact that new mutational changes at the SMN locus may also contribute to the occurrence of SMN1 duplication.

This study had a notable limitation concerning the geographical representation of residents of Russia. The majority of participants were concentrated in Moscow, the Moscow region, and surrounding areas, indicating that these regions are overrepresented, which may affect the generalizability of the findings. It is important to note that the central regions of Russia have a higher population density than more distant regions.

4. Materials and Methods

4.1. The Cohort of the Present Study

This study included DNA samples from 3412 unexamined unrelated individuals (bank of the DNA diagnostic laboratory of the Research Center for Medical Genetics) with no known family history of 5q SMA residing in 39 regions of Russia. Individuals requested carrier screening for recessive disorders for preconception prevention for birth planning at the Research Center for Medical Genetics between 2011 and 2023. A limitation of this study was the lack of equal sampling of residents of all regions, so the majority of participants were from Moscow, the Moscow Region, and neighboring regions.

This study also included DNA samples from 15 families with patients carrying a homozygous deletion of exon 7 of SMN1. These patients were referred for diagnosis of 5q SMA to the Research Center for Medical Genetics. Each family included one parent who was a carrier of a heterozygous deletion of exon 7 of SMN1, while the other parent had two copies of exon 7 of SMN1.

Additional DNA samples with one copy of exon 7 of SMN1 from 100 parents of probands with 5q SMA from the bank of the DNA diagnostic laboratory were used as a control cohort with no SMN1 duplication (Figure 3).

Figure 3.

Figure 3

Molecular screening design of a cohort of 3412 unrelated Russian individuals and 15 families and 100 unrelated carriers of exon 7 deletion of SMN1.

Informed consent for molecular testing was obtained from all probands or their legal representatives. This study received ethical approval from the ethical committee of the Research Center for Medical Genetics, Moscow (approval number 11/1; date of approval: 23 November 2021). This study was conducted in accordance with the Declaration of Helsinki.

4.2. DNA Extraction

DNA was extracted from peripheral blood leukocytes using the Wizard® Genomic DNA Purification Kit (Promega, Madison, WI, USA), adhering to the manufacturer’s protocol. The quality of the isolated DNA was assessed using agarose gel electrophoresis and spectrophotometric detection. The biological parental relatedness of parents with two copies of SMN1 of patients with homozygous deletion of SMN1 was validated using the AmpFlSTR Identifiler Direct PCR Amplification Kit (Applied Biosystems, LLC, Waltham, MA, USA) according to the manufacturer’s instructions.

4.3. MLPA

The copy number of exons 7 and 8 of SMN1 and SMN2 was detected by multiplex ligation-dependent probe amplification (MLPA): a probe system (DIALAT Ltd., Moscow, Russia) designed in the DNA diagnostic laboratory of the Research Center for Medical Genetics from 2011 to 2021 [11]. In 2021, the copy number of exons 7 and 8 of SMN1 and SMN2 was analyzed using the SALSA MLPA Probemix P060 SMA Carrier Kit (MRC Holland, Amsterdam, The Netherlands), according to the manufacturer’s instructions. Reaction products were analyzed via fragment analysis on an ABI Prism 3500 (Applied Biosystems, Foster City, CA, USA). For accurate quantitative analysis, the MLPA data were processed using the Coffalyser v.8 software provided by the manufacturer of MLPA (MRC Holland, Amsterdam, The Netherlands).

For detection of genetic markers of SMN1 duplication, (c.*3+80T>G and c.*211_*212del) (Table 4) a diagnostic laboratory-designed system of probes for MLPA were added to the DNA diagnostic laboratory practice (DIALAT Ltd., Moscow, Russia). The lengths of the amplified fragments range from 104 to 114 base pairs (b.p.) (Figure 3).

Table 4.

Probes for the detection of genetic markers of SMN1 duplication (c.*3+80T>G and c.*211_*212del). FT, FG, FN, FDEL—forward probe, R—reverse probe.

Probe Designation Probe Sequence, 5′-3′ Length
MSMNC*3+80 (FT) GTTCGTACGTGAATCGCGGTACGTTGGTTTGTGGAAAACAAATGTTTTTGAACAT 55
MSMNC*3+80 (FG) GTTCGTACGTGAATCGCGGTACGGTTTGTGGAAAACAAATGTTTTTGAACAG 52
MSMNC*3+80 (R) TTAAAAAGTTCAGATGTTAAAAAGTTGAAAGGTTAATGATGCGATCCGATGCCTTCATG 59
MRS200800214 (FN) GTTCGTACGTGAATCGCGGTACCCAAATGCAATGTGAAATATTTTACTGGACTCTA 56
MRS200800214 (FDEL) GTTCGTACGTGAATCGCGGTACCAAATGCAATGTGAAATATTTTACTGGACTC 53
MRS200800214 (R) TTTTGAAAAACCATCTGTAAAAGACTGGGGATGCGATCCGATGCCTTCATG 51

All DNA samples of the population cohort (n = 3412) in which the number of SMN1 copies were higher than 1 (n = 237), 30 parents of probands with 5q SMA carrying one and two copies of exon 7 of SMN1, and also 100 carriers of heterozygous deletion of exon 7 of SMN1 of the control cohort were analyzed by performing of allele-specific ligation followed by visualization of the reaction results on a polyacrylamide gel using the probes described above to detect genetic markers of SMN1 duplication (Figure 4). A comprehensive experimental workflow diagram is provided in Appendix A (Figure A1).

Figure 4.

Figure 4

Analysis of genetic markers of SMN1 duplication (c.*3+80T>G and c.*211_*212del). The figure shows fragments of electropherograms analyzing DNA samples (#DNA 1669, 1502, 206, 605, 1303, 1754) of Russian residents with three copies of SMN1. The presence of two genetic markers of SMN1 duplication was detected in two Russian residents (track 2 and track 4), in other samples these markers were not detected. In the last track (8), there was a negative control for the reaction. The lengths of the amplified fragments range from 104 to 114 base pairs (b.p.) (Table 4).

8 µL of ligation reaction mix contains genomic DNA and probe mix solution: MSMNC*3+80 FT, MSMNC*3+80 FG, MSMNC*3+80 R (labeled the 5′ end of the ssDNA), MRS200800214 FN, MRS200800214 FDEL, MRS200800214 R (labeled the 5′ end of the ssDNA), 1 u.a. Pfu ligase (Stratagene, La Jolla, CA, USA), and buffer (20 mM Tris-HCl (pH 7.5), 20 mM KCl, 10 mM MgCl2, 0.1% Igepal, 0.01 mM rATP, 1 mM DTT). The program for ligation is as follows: cycle 1 (5 min)—98 °C, cycle 2 (60 min)—60 °C. 20 µL of PCR reaction mix contains the whole volume of ligation reaction product, 2 mM dNTP, mix of universal primers 1 pm of each primer (Table 5) (DIALAT Ltd., Moscow, Russia), 1 u.a. Taq polymerase (DNA-technology, Moscow, Russia). The program for amplification is as follows: (1) initial denaturation (240 s)—95 °C, (2) denaturation (3 s)—94 °C, (3) primer annealing (3 s)—66 °C, (4) elongation (3 s)—72 °C, 34 cycles (2–4), (5) final elongation (420 s)—72 °C, (6) storage—12 °C.

Table 5.

Sequence of universal primers for the PCR step. F—forward primer, R—reverse primer.

Primer Designation Primer Sequence, 5′-3′
UniF (F) GAGGAACCAGTACCCCGACATC
UniR (R) GCCCAACATTCTATGATAGCACC

4.4. Statistical Methods

Standard methods of statistical analysis using Statistica 10.0 software package were used to process the results obtained during the study. Data comparing multiple groups with a single characteristic were statistically analyzed using contingency table analysis with the Chi-squared test. Since the chi-square values and p-values are equal and indicate the presence or absence of statistical significance, both values are not consistently reported throughout the text of the article.

5. Conclusions

The ACMG recommends pan-ethnic screening for 5q SMA in all couples due to the high carrier frequency and the severity of the disease. Among various ethnic groups, the carrier frequency of SMN1 deletion ranges from 1 in 25 to 1 in 50. In this study, the carrier frequency of SMN1 exon 7 deletion in heterozygous Russian residents is 1 in 36 (95% CI 33 to 39). Additionally, the frequency of SMN1 exon 7 duplication in Russian residents is estimated to be 1 in 25 (95% CI 20 to 30). The probability of an individual with two copies of SMN1 carrying genotype 2 + 0 is extremely low, at 0.1%. Thus, analyzing the copy number of SMN1 enables reliable determination of carrier status for exon 7 deletion in Russian residents with a confidence level of 99.9%. Furthermore, it has been shown that the test of the genetic markers of SMN1 duplication, c.*3+80T>G and c.*211_*212del, provides limited informative value in Russia.

Appendix A

Figure A1.

Figure A1

A comprehensive experimental workflow diagram.

Appendix B

Calculations for Hardy–Weinberg equilibrium testing are provided in detail.

p2 + 2 p q + q2 = 1 (A1)

In our study, there were 6824 chromosomes, of which 94 chromosomes had a deletion of SMN1.

q = 94 ÷ 6824 = 0.014 (A2)

Thus, the allele frequency of the deletion of exon 7 of SMN1 was 0.014.

p + q = 1 → p = 1 − q (A3)
2 p q = 2 × 0.014 × (1 − 0.014) = 0.028 = 28/1000 = 1/36 (A4)

This represents a carrier frequency of approximately 1 in 36 residents.

The probability of encountering chromosomes with SMN1 duplication in a homozygous state was calculated in our study.

137 chromosomes SMN1 duplication/6824 chromosomes = 0.02 (A5)
2 p q = 2 × 0.02 × 0.02 = 0.0008 = 1/1250 = 5.5 (A6)

Thus, we expected to see 5–6 individuals homozygous for this duplication. In fact, 6 individuals carried 4 copies of exon 7 of SMN1, confirming their homozygous status for SMN1 duplication.

q = 149 chromosomes SMN1 duplication/6824 chromosomes = 0.022 (A7)

Thus, the duplication of exon 7 of SMN1 was detected in 149 out of 6824 chromosomes, which resulted in an allele frequency of 0.022.

p + q = 1 → p = 1 − q (A8)
2 p q = 2 × 0.022 × (1 − 0.022) = 0.043 = 43/1000 = 1/23 (A9)

This represents a frequency of SMN1 duplication of approximately 1 in 23 residents.

The probability of encountering the genotype 2 + 0 (in which one chromosome 5 carries deletion of SMN1 while the other chromosome carries duplication of SMN1) among Russian residents was calculated in our study.

2 p q = 2 × 0.014 × 0.022 = 0.00056 = 1/1667 (A10)

Thus, the frequency of silent carriers is 0.0006, or 1 in 1667 residents of Russia.

Minor deviations from expected frequencies in population genetics studies can arise from several factors, including small population size, non-random mating, natural selection and pathogenic variants, inbreeding, genotyping errors, and the genetic heterogeneity of cohorts [12].

Author Contributions

Conceptualization, K.M. and O.S.; Data curation, K.M., V.V.Z. and O.I.; Formal analysis, K.M., A.P., O.I. and O.S.; Investigation, K.M., V.V.Z. and O.I.; Methodology, K.M., A.P., V.V.Z., O.I. and O.S.; Project administration, A.P. and O.S.; Resources, A.P. and V.V.Z.; Software, A.P., V.V.Z. and O.I.; Supervision, A.P. and O.S.; Validation, K.M., V.V.Z., O.I. and O.S.; Visualization, K.M.; Writing—original draft, K.M.; Writing—review and editing, A.P. and O.S. All authors have read and agreed to the published version of the manuscript.

Institutional Review Board Statement

This study received ethical approval from the ethical committee of the Research Center for Medical Genetics, Moscow (approval number 11/1; date of approval: 23 November 2021). This study was conducted in accordance with the Declaration of Helsinki.

Informed Consent Statement

Informed consent for molecular testing was obtained from all probands or their legal representatives.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.

Conflicts of Interest

The authors declare no conflicts of interest.

Funding Statement

This research received no external funding.

Footnotes

Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

References

  • 1.Wirth B. An update of the mutation spectrum of the survival motor neuron gene (SMN1) in autosomal recessive spinal muscular atrophy (SMA) Hum. Mutat. 2000;15:228–237. doi: 10.1002/(SICI)1098-1004(200003)15:3&#x0003c;228::AID-HUMU3&#x0003e;3.0.CO;2-9. [DOI] [PubMed] [Google Scholar]
  • 2.Hensel N., Kubinski S., Claus P. The need for SMN-independent treatments of spinal muscular atrophy (SMA) to complement SMN-enhancing drugs. Front. Neurol. 2020;11:45. doi: 10.3389/fneur.2020.00045. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3.Lopez-Cortes A., Echeverria-Garces G., Ramos-Medina M.J. Molecular pathogenesis and new therapeutic dimensions for spinal muscular atrophy. Biology. 2022;11:894. doi: 10.3390/biology11060894. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Luo M., Liu L., Peter I., Zhu J., Scott S.A., Zhao G., Eversley C., Kornreich R., Desnick R.J., Edelmann L. An Ashkenazi Jewish SMN1 haplotype specific to duplication alleles improves pan-ethnic carrier screening for spinal muscular atrophy. Genet. Med. 2014;16:149–156. doi: 10.1038/gim.2013.84. [DOI] [PubMed] [Google Scholar]
  • 5.Gregg A.R., Aarabi M., Klugman S., Leach N.T., Bashford M.T., Goldwaser T., Chen E., Sparks T.N., Reddi H.V., Rajkovic A., et al. ACMG Professional Practice and Guidelines Committee. Screening for autosomal recessive and X-linked conditions during pregnancy and preconception: A practice resource of the American College of Medical Genetics and Genomics (ACMG) Genet. Med. 2021;23:1793–1806. doi: 10.1038/s41436-021-01203-z. Erratum in Genet. Med. 2021, 23, 2015. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6.Sugarman E.A., Nagan N., Zhu H., Akmaev V.R., Zhou Z., Rohlfs E.M., Flynn K., Hendrickson B.C., Scholl T., Sirko-Osadsa D.A., et al. Pan-ethnic carrier screening and prenatal diagnosis for spinal muscular atrophy: Clinical laboratory analysis of >72,400 specimens. Eur. J. Hum. Genet. 2012;20:27–32. doi: 10.1038/ejhg.2011.134. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7.Groen E.J.N., Talbot K., Gillingwater T.H. Advances in therapy for spinal muscular atrophy: Promises and challenges. Nat. Rev. Neurol. 2018;14:214–224. doi: 10.1038/nrneurol.2018.4. [DOI] [PubMed] [Google Scholar]
  • 8.Cusin V., Clermont O., Gérard B., Chantereau D., Elion J. Prevalence of SMN1 deletion and duplication in carrier and normal populations: Implication for genetic counselling. J. Med. Genet. 2003;40:e39. doi: 10.1136/jmg.40.4.e39. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.San Lai P., Chia G., Tan G., Liu C.P., Low P.S., Tay S. P719: SMN1 deletion and silent carrier screening for spinal muscular atrophy. Genet. Med. Open. 2024;2:101623. doi: 10.1016/j.gimo.2024.101623. [DOI] [Google Scholar]
  • 10.Alías L., Bernal S., Calucho M., Martínez E., March F., Gallano P., Fuentes-Prior P., Abuli A., Serra-Juhe C., Tizzano E.F. Utility of two SMN1 variants to improve spinal muscular atrophy carrier diagnosis and genetic counselling. Eur. J. Hum. Genet. 2018;26:1554–1557. doi: 10.1038/s41431-018-0193-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11.Zabnenkova V.V., Shchagina O.A., Polyakov A.V. Carrier screen of spinal muscular atrophy using a new medical technology «Quantitative detection methods of copy number analysis of SMA locus genes». Med. Genet. 2016;15:18–23. (In Russian) [Google Scholar]
  • 12.Graffelman J., Moreno V. The mid p-value in exact tests for Hardy-Weinberg equilibrium. Stat. Appl. Genet. Mol. Biol. 2013;12:433–448. doi: 10.1515/sagmb-2012-0039. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

The original contributions presented in this study are included in the article. Further inquiries can be directed to the corresponding author.


Articles from International Journal of Molecular Sciences are provided here courtesy of Multidisciplinary Digital Publishing Institute (MDPI)

RESOURCES