Skip to main content
NCBI home page
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2019 May 7;35(8):467–473. doi: 10.1002/kjm2.12085

MicroRNA‐26a‐5p inhibits breast cancer cell growth by suppressing RNF6 expression

Zi‐Ming Huang 1,✉, Heng‐Fa Ge 1, Chen‐Chen Yang 1, Yong Cai 1, Zhen Chen 1, Wen‐Ze Tian 2, Jia‐Li Tao 3,✉
PMCID: PMC11900708  PMID: 31063232

Abstract

MicroRNA‐26a‐5p (miR‐26a‐5p) has been reported to be involved in the tumorigenesis of several tumors, but its function in breast cancer is still unknown. In this study, miR‐26a‐5p was found significantly downregulated in both of the breast cancer tissues and cell lines, and low expression of miR‐26a‐5p predicted a poor prognosis for breast cancer patients. Overexpression of miR‐26a‐5p could significantly inhibit breast cancer cell growth. Further studies revealed that overexpression of miR‐26a‐5p downregulated the protein levels of Cyclin D1, CDK4, and CDK6, but upregulated the expression levels of p21, p27, and p53. In mechanism, miR‐26a‐5p targeted the 3′UTR of ring finger protein 6 (RNF6) mRNA and inhibited RNF6 expression in breast cancer cells. Moreover, overexpression of miR‐26a‐5p inhibited RNF6/ERα/Bcl‐xL axis in breast cancer cells. In contrast, inhibiting miR‐26a‐5p upregulated RNF6/ERα/Bcl‐xL axis. Further studies indicated that miR‐26a‐5p mediated RNF6/ERα/Bcl‐xL axis through regulating the stability of ERα protein. Collectively, downregulation of miR‐26a‐5p plays essential roles in breast cancer by mediating RNF6/ERα/Bcl‐xL axis, which might provide important implications for the therapeutics of breast cancer.

Keywords: Bcl‐xL, breast cancer, ERα, microRNA‐26a‐5p, RNF6

1. INTRODUCTION

Breast cancer is one of the most common malignant tumors in women.1 According to statistics, the incidence of breast cancer accounts for 7% to 10% of all malignant tumors in the body, and there are about 40 000 people died of breast cancer every year in China, which is next to uterine carcinoma.2 In addition, breast cancer is a malignant tumor usually occurring in the breast epithelial tissue.3 It is one of the most common malignant tumors that seriously affect women's physical and mental health and even endanger their lives.4 Although significant progress has been done in the therapy of breast cancer, some patients become resistant and some patients with late stages are still untreatable.5, 6 Therefore, to study the pathogenesis of breast cancer is urgent for breast cancer therapy.

MicroRNAs (miRNAs) are endogenous short‐chain RNAs with a length of about 22 nucleotides, which do not encode proteins.7 They can silence proteins' expression through complementary binding with the encoding proteins' mRNAs, as a result of which, they can regulate cell growth, differentiation, proliferation, apoptosis or metabolism.8 The occurrence and development of tumors are the results of uncontrolled cell proliferation and apoptosis.9 Therefore, the relationship between miRNAs and tumors is becoming a hotspot of current research.10 If the target gene of the miRNA is an oncogene, and the expression of miRNA is below normal level, it will lead to the increase of protein encoded by the oncogene and thus promotes the occurrence of tumors.11 In contrast, if the target gene of the miRNA is a tumor suppressor, and the expression of miRNA is higher than normal level, it will lead to the decrease of the tumor suppressor and also induces the occurrence of tumors.11 Because one miRNA can regulate the expression of many oncogenes or tumor suppressor genes, using miRNA as a therapeutic target may be more effective than using a single oncogene or tumor suppressor gene as a therapeutic target.12 Therefore, the discovery of the relationship between miRNAs and tumors provides a promising research direction for finding new biological therapeutic targets of breast cancer.13

In this study, microRNA‐26a‐5p (miR‐26a‐5p) was found lowly expressed in breast cancer, and low expression of miR‐26a‐5p predicted a poor prognosis for breast cancer patients. MiR‐26a‐5p has been reported to be involved in the pathogenesis of several tumors. A recent paper reported that miR‐26a‐5p was a newly identified repressor of hepatoblastoma cell growth, and the decreased miR‐26a‐5p expression was correlated with the poor outcome of patients with hepatoblastoma.14 MiR‐26a‐5p targeted the 3′‐untranslated regions of LIN28B and AURKA, and markedly inhibited their expressions, along with suppressing hepatoblastoma cell growth and clonality.14 In acute myeloid leukemia (AML), miR‐26a‐5p was found downregulated by a miRNA expression assay, and peroxiredoxin III (PrxIII) was identified as a direct target of miR‐26a‐5p.15 In this study, miR‐26a‐5p targeted ring finger protein 6 (RNF6) mRNA and inhibited its gene expression in breast cancer cells. Overexpression of miR‐26a‐5p could markedly suppress breast cancer cell growth by inhibiting RNF6/ERα/Bcl‐xL axis. This study indicated that miR‐26a‐5p could be as a potential biomarker for breast cancer diagnosis or treatment in the future.

2. MATERIALS AND METHODS

2.1. Cells, tissues, and chemicals

Breast cancer cell lines (MCF‐7, T47D, MDA‐MB‐231, and MDA‐MB‐453) and a normal breast cell line MCF‐10A were purchased from American Type Culture Collection (Manassas, Virginia). All cells were maintained in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin. The primary breast cancer tissues and individual normal paracancerous tissues were collected from the Affiliated Huaian No. 1 People's Hospital of Nanjing Medical University. The collection and use of human tissues for this study were approved by the Institutional Review Board of the Affiliated Huaian No. 1 People's Hospital of Nanjing Medical University. Cycloheximide (CHX) was purchased from Sigma‐Aldrich (St. Louis, Missouri).

2.2. Quantitative real‐time polymerase chain reaction

To determine the miRNA levels of miR‐26a‐5p, the quantitative real‐time polymerase chain reaction (qRT‐PCR) was performed as described previously.16 Bulge‐loop miRNA qRT‐PCR Primer Sets specific for miR‐26a‐5p were designed by GenePharm Co., Ltd (Suzhou, China). Total RNA was extracted by using a MiRNeasy Mini Kit (QIAGEN, Hilden, Germany), and the miRNA bulge‐loop was reverse transcribed with the Quantscript RT Kit (QIAGEN, Hilden, Germany). The relative amount of miRNAs was normalized against U6 snRNA.

To determine the mRNA levels of RNF6, qRT‐PCR was performed using SYBR Green qPCR Master Mix (Clontech Laboratories, Inc.). The primers used were as follows: RNF6, forward 5′‐AGAAGATGGCAGCAAGAGCG‐3′ and reverse 5′‐TCAAGTCAGGCTGAGATGCTAGT‐3′; GAPDH, forward 5′‐GCACCGTCAAGGCTGAGAAC‐3′ and reverse 5′‐TGGTGAAGACGCCAGTGGA‐3′.

2.3. Cell growth and viability

Viable cells of breast cancer cells were measured by Cell Counting Kit‐8 (CCK‐8) assay according to the manufacturer's instruction (Bimake, Houston, Texas) as described previously.17

2.4. Immunoblotting

Immunoblotting was performed as described previously.18, 19 The primary antibodies against Cyclin D1, CDK4, CDK6, p21, p27, p53, Bcl‐xL, and GAPDH were purchased from Cell Signaling Technology (Danvers, Massachusetts). Anti‐RNF6 and anti‐ERα antibodies were purchased from Thermo Fisher Scientific Inc. (Waltham, Massachusetts). Anti‐mouse and anti‐rabbit immunoglobulin G (IgG) horseradish peroxidase conjugated antibodies were purchased from Beyotime Biotechnology (Nantong, China).

2.5. MiRNA construction and transfection

The miR‐26a‐5p mimic, inhibitor, and a negative control (miR‐NC) were synthesized from GenePharm Co., Ltd. (Suzhou, China). MCF7 and T47D cells were transfected with miR‐NC, miR‐26a‐5p mimic or inhibitor by Lipofectamine RNAiMAX Reagent (Invitrogen, Carlsbad, California) in Opti‐MEM medium (Invitrogen) according to the manufacturer's instruction as described previously.20

2.6. Luciferase assay

The binding sites of miR‐26a‐5p in RNF6 3′UTR were predicted by TargetScanHuman 7.2 (http://www.targetscan.org/vert_72/). The fragments containing predicted miR‐26a‐5p binding sites or the mutants were amplified and subcloned into pGL3 vector. Then, these plasmids along with miR‐NC or miR‐26a‐5p were transfected into MCF7 cells for 48 hours by using Lipofectamine 2000 (Invitrogen). Finally, these cells were harvested and prepared for luciferase assay using the Dual‐Luciferase Reporter Assay System (Promega, Madison, Wisconsin) according to the manufacturer's instruction.

2.7. CHX chase assay

To evaluate whether miR‐26a‐5p regulated the stability of ERα protein, MCF7 cells were transfected with miR‐NC or miR‐26a‐5p mimic for 24 hours. Then, cells were incubated with 50 μg/mL CHX for a specific time period before being prepared for immunoblotting as described previously.21

2.8. Statistical analysis

The results were performed as mean values ± SD, and three independent experiments were performed for each assay. Analysis of variance and Bonferroni posttests were used for significance analysis in the studies. A P value <.05 was considered statistically significant in this study.

3. RESULTS

3.1. MiR‐26a‐5p is lowly expressed in breast cancer and predicts a positive index for the survival of breast cancer patients

To evaluate the expression levels of miR‐26a‐5p in breast cancer, 20 pairs of primary breast cancer tissues were collected for qRT‐PCR analysis. As shown in Figure 1A,B, miR‐26a‐5p was significantly downregulated in all breast cancer tissues compared with the normal paracancerous tissues. At the same time, a normal breast cell line and four breast cancer cell lines were collected, and the qRT‐PCR showed that miR‐26a‐5p was also lowly expressed in breast cancer cell lines (Figure 1C). Moreover, the Kaplan‐Meier plotter based on the breast cancer miRNA database indicated that breast cancer patients with high miR‐26a had a longer overall survival period than the patients with low miR‐26a expression (Figure 1D). These above indicated that miR‐26a‐5p was lowly expressed in breast cancer and predicted a positive index for the survival of breast cancer patients, which may be as a biomarker for breast cancer diagnosis.

Figure 1.

Figure 1

Open in a new tab

MiR‐26a‐5p is lowly expressed in breast cancer and predicts a positive index for the survival of breast cancer patients. A and B, Twenty pairs of fresh primary breast cancer tissues and individual normal paracancerous tissues were prepared for qRT‐PCR analysis to measure the expression level of miR‐26a‐5p. U6 was used as an internal control. C, Four breast cancer cell lines and a normal breast cell line were prepared for qRT‐PCR analysis to measure the expression level of miR‐26a‐5p. U6 was used as an internal control. D, the overall survival of breast cancer patients with high or low expression of miR‐26a were analyzed by Kaplan‐Meier plotter based on The Cancer Genome Atlas (TCGA) database (breast cancer miRNA, http://kmplot.com). * P < .05, ** P < .01. Abbreviation: qRT‐PCR, quantitative real‐time polymerase chain reaction

3.2. Overexpression of miR‐26a‐5p inhibits breast cancer cell growth

The downregulation of miR‐26a‐5p in breast cancer prompted us to investigate whether miR‐26a‐5p regulated breast cancer cell growth. Then, miR‐26a‐5p mimics were overexpressed in MCF7 and T47D cells (Figure 2A), and the CCK‐8 assay showed that overexpression of miR‐26a‐5p significantly reduced breast cancer cell growth in both of MCF7 and T47D cells (Figure 2B,C).

Figure 2.

Figure 2

Open in a new tab

Overexpression of miR‐26a‐5p inhibits breast cancer cell growth. A, MCF7 and T47D cells were transfected with miR‐NC or miR‐26a‐5p mimic, respectively. Twenty‐four hours later, cells were used for further experiments or prepared for qRT‐PCR to detect the expression level of miR‐26a‐5p. B and C, Above cells transfected with miR‐NC or miR‐26a‐5p mimic were cultured for indicated time, followed by CCK‐8 assay on MCF7 (B) or T47D (C) cells. D and E, miR‐NC and miR‐26a‐5p mimic were transfected into MCF7 or T47D cells for 72 hours, followed by immunoblotting against Cyclin D1, CDK4, CDK6 (D), p21, p27, and p53 (E). GAPDH was used as an internal control. * P < .05, ** P < .01. Abbreviation: qRT‐PCR, quantitative real‐time polymerase chain reaction

It is known that cell growth is controlled by cell cycle,22 so some cell cycle‐related proteins were then evaluated. As shown in Figure 2D,E, overexpression of miR‐26a‐5p obviously decreased the protein levels of Cyclin D1, CDK4, and CDK6, and increased the protein levels of p21, p27, and p53, which indicated that miR‐26a‐5p mediated cell growth by regulating cell cycle progression in breast cancer cells.

3.3. MiR‐26a‐5p targets RNF6 and inhibits its expression in breast cancer cells

Subsequent studies showed that miR‐26a‐5p was predicted to bind to the 3′UTR of RNF6 mRNA by TargetScanHuman 7.2 database (Figure 3A). It has been reported that RNF6 was a negative index for the survival of breast cancer patients, and promoted breast cancer cell growth.23 To confirm this prediction, luciferase assay was performed, and the results showed that miR‐26a‐5p markedly downregulated wild‐type RNF6 3′UTR‐driven luciferase activity, but had no significant effect on mutated RNF6 3′UTR, which further indicated that miR‐26a‐5p targeted RNF6 (Figure 3B). To further evaluate whether miR‐26a‐5p inhibited RNF6 expression, qRT‐PCR, and immunoblotting were performed. The results indicated that overexpression of miR‐26a‐5p significantly suppressed both of the mRNA and protein levels of RNF6 in breast cancer cells (Figure 3C,D).

Figure 3.

Figure 3

Open in a new tab

MiR‐26a‐5p targets RNF6 and inhibits its expression in breast cancer cells. A, the binding sites of miR‐26a in RNF6 3′UTR was predicted by TargetScanHuman 7.2 (http://www.targetscan.org/vert_72/). B, miR‐NC or miR‐26a‐5p, along with wild‐type (WT) or mutant (Mut.) RNF6 3′UTR were co‐transfected into MCF7 cells for 48 hours, followed by luciferase assay. C and D, MCF7 and T47D cells were transfected with miR‐NC or miR‐26a‐5p mimic for 72 hours, followed by qRT‐PCR (C) or immunoblotting (D) to detect the expression level of RNF6. GAPDH was used as an internal control. N.s. means non‐sense, ** P < .01. Abbreviation: qRT‐PCR, quantitative real‐time polymerase chain reaction

3.4. MiR‐26a‐5p inhibits RNF6/ERα axis in breast cancer cells

It has been reported that RNF6 upregulated ERα expression, and promoted breast cancer cell growth.23 Then, we evaluated whether miR‐26a‐5p inhibited RNF6/ERα axis in breast cancer cells. As shown in Figure 4A, overexpression of miR‐26a‐5p obviously inhibited the expression levels of RNF6 and ERα in breast cancer cells, along with the downregulation of anti‐apoptotic protein Bcl‐xL. In contrast, inhibiting miR‐26a‐5p significantly upregulated the expression levels of RNF6, ERα, and Bcl‐xL (Figure 4B). Because RNF6 was reported to stabilize ERα protein in breast cancer cells, then we detected whether miR‐26a‐5p affected the stability of ERα protein. As shown in Figure 4C,D, overexpression of miR‐26a‐5p shortened the half‐life of ERα protein, which suggested that miR‐26a‐5p decreased the stability of ERα protein. These results suggested that miR‐26a‐5p inhibited RNF6/ERα axis in breast cancer cells.

Figure 4.

Figure 4

Open in a new tab

MiR‐26a‐5p inhibits RNF6/ERα axis in breast cancer cells. A, MCF7 and T47D cells were transfected with miR‐NC or miR‐26a‐5p mimic for 72 hours, followed by immunoblotting against RNF6, ERα, Bcl‐xL, and GAPDH. B, MCF7 and T47D cells were transfected with miR‐NC or miR‐26a‐5p inhibitor for 72 hours, followed by immunoblotting against RNF6, ERα, Bcl‐xL, and GAPDH. C, MCF7 cells were transfected with miR‐NC or miR‐26a‐5p mimic for 24 hours, followed by CHX chase assay. Immunoblotting analysis was then performed against ERα, RNF6, and GAPDH. D, Statistically analysis of figure C. Abbreviation: CHX, cycloheximide

4. DISCUSSION

Like in hepatoblastoma,14 AML15 and multiple myeloma,24 in this study, miR‐26a‐5p was also found downregulated in breast cancer, and low expression of miR‐26a‐5p predicted a negative index for the overall survival of breast cancer patients (Figure 1). Overexpression of miR‐26a‐5p markedly inhibited breast cancer cell growth, and decreased the expression levels of cell cycle‐associated proteins (Figure 2), which suggested that miR‐26a‐5p was a potential biomarker for breast cancer. Interestingly, a recent paper reported that the long non‐coding RNA SNHG6 (small nucleolar RNA host gene 6) served as an endogenous sponge by directly binding to miR‐26a‐5p and downregulated miR‐26a‐5p expression in breast cancer,25 which indicated that miR‐26a‐5p was important for breast cancer.

RNF6, a RING‐domain E3 ubiquitin ligase, has been reported as a potential tumor promoter in several tumors. In hepatocellular carcinoma (HCC), knockdown of RNF6 notably inhibited the metastatic abilities of HCC in vivo and in vitro, and suppressed the epithelial‐mesenchymal transition and radioresistance in HCC.26 In AML cells, RNF6 was overexpressed, and knockdown of RNF6 inhibited AML cell proliferation and delayed tumor growth in xenografts.27 And saponins from Paris forrestii (Takht.) H. Li displayed potent anti‐AML activity by suppressing the RNF6/AKT/mTOR pathway.28 In colorectal cancer, RNF6 was reported to mediate the ubiquitination and degradation of TLE3, and activated the Wnt/β‐catenin pathway.29 RNF6 was also found to increase the phosphorylation of STAT3 via promoting SHP‐1 ubiquitination and degradation in colorectal cancer.30 In breast cancer, there existed an RNF6/ERα/Bcl‐xL axis that promoted cell proliferation and survival, and targeting the RNF6/ERα/Bcl‐xL axis provided a potential therapeutic option for the treatment of breast cancer.23 In specific, RNF6 promoted breast cancer cell proliferation by stabilizing ERα, and overexpression of ERα led to increased Bcl‐xL.23 These above indicated that RNF6 could be as a target for breast cancer therapy, and in this study, we found that miR‐26a‐5p targeted RNF6 mRNA, and inhibited its expression (Figure 3). Thus, miR‐26a‐5p displayed its anti‐tumor activity by inhibiting RNF6 expression and suppressing RNF6/ERα/Bcl‐xL axis in breast cancer cells (Figure 4), which provided a novel strategy for breast cancer therapy.

However, several questions are still unanswered in this study. In the present study, we just detected the expression levels of miR‐26a‐5p in breast cancer tissues, but whether it was correlated with the clinical characteristics of breast cancer patients (eg, gender, age, cancer malignancy, and distant neoplasm metastasis) was still unanswered. Second, we found that miR‐26a‐5p downregulated ERα protein by inhibiting the mRNA level of RNF6, but how RNF6 decreased the stability of ERα protein was still unclear. Importantly, there are different targets of miR‐26a‐5p as reported above, but how they work together is unknown. Therefore, in our future work, we will focus on these questions for the further studies.

5. CONCLUSION

In conclusion, our present study demonstrated that miR‐26a‐5p exerted its anti‐tumor activity by inhibiting RNF6/ERα/Bcl‐xL axis in breast cancer cells. This study suggested that miR‐26a‐5p could be as a potential target for breast cancer treatment in the future.

CONFLICT OF INTEREST

All authors declare no conflict of interest.

ACKNOWLEDGMENT

The authors thanked Dr. Jerry Xu for his discussion on this project.

Huang Z‐M, Ge H‐F, Yang C‐C, et al. MicroRNA‐26a‐5p inhibits breast cancer cell growth by suppressing RNF6 expression. Kaohsiung J Med Sci. 2019;35:467–473. 10.1002/kjm2.12085

Funding information General Project of Science and Technology Development Fund of Nanjing Medical University, Grant/Award Number: 2013NJMU225

Contributor Information

Zi‐Ming Huang, Email: ziming_huang2018@hotmail.com.

Jia‐Li Tao, Email: jiali_tao2018@163.com.

REFERENCES

  • 1. Chen JG, Chen HZ, Zhu J, Yang YL, Zhang YH, Huang PX, et al. Cancer survival in patients from a hospital‐based cancer registry, China. J Cancer. 2018;9:851–860. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2. Li K, Anderson G, Viallon V, Arveux P, Kvaskoff M, Fournier A, et al. Risk prediction for estrogen receptor‐specific breast cancers in two large prospective cohorts. Breast Cancer Res. 2018;20:147. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 3. Nassar A, Sussman ZM, Lawson D, Cohen C. Inference of the basal epithelial phenotype in breast carcinoma from differential marker expression, using tissue microarrays in triple negative breast cancer and women younger than 35. Breast J. 2012;18:399–405. [DOI] [PubMed] [Google Scholar]
  • 4. Bueno JN, Haddad CAS, Rizzi S, Giron PS, Facina G, Nazario ACP. Evaluation of body image, quality of life, tactile sensitivity and pain in women with breast cancer submitted to surgical intervention. Rev Assoc Med Bras (1992). 2018;64:530–536. [DOI] [PubMed] [Google Scholar]
  • 5. Pei L, Kong Y, Shao C, Yue X, Wang Z, Zhang N. Heme oxygenase‐1 induction mediates chemoresistance of breast cancer cells to pharmorubicin by promoting autophagy via PI3K/Akt pathway. J Cell Mol Med. 2018;22:5311–5321. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 6. Akrami M, Arasteh P, Eghbali T, Shahraki HR, Tahmasebi S, Zangouri V, et al. Introducing novel and comprehensive models for predicting recurrence in breast cancer using the group LASSO approach: Are estimates of early and late recurrence different? World J Surg Oncol. 2018;16:185. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 7. Xie T, Huang M, Wang Y, Wang L, Chen C, Chu X. MicroRNAs as regulators, biomarkers and therapeutic targets in the drug resistance of colorectal cancer. Cell Physiol Biochem. 2016;40:62–76. [DOI] [PubMed] [Google Scholar]
  • 8. Li Z, Lin C, Zhao L, Zhou L, Pan X, Quan J, et al. Oncogene miR‐187‐5p is associated with cellular proliferation, migration, invasion, apoptosis and an increased risk of recurrence in bladder cancer. Biomed Pharmacother. 2018;105:461–469. [DOI] [PubMed] [Google Scholar]
  • 9. Ciesla W. Can melatonin regulate the expression of prohormone convertase 1 and 2 genes via monomeric and dimeric forms of RZR/ROR nuclear receptor, and can melatonin influence the processes of embryogenesis or carcinogenesis by disturbing the proportion of cAMP and cGMP concentrations? Theoretic model of controlled apoptosis. Med Hypotheses. 2001;56:181–193. [DOI] [PubMed] [Google Scholar]
  • 10. Klinge CM. Non‐coding RNAs in breast cancer: Intracellular and intercellular communication. Noncoding RNA. 2018;4:E40. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 11. Mardani R, Jafari Najaf Abadi MH, Motieian M, Taghizadeh‐Boroujeni S, Bayat A, Farsinezhad A, et al. MicroRNA in leukemia: Tumor suppressors and oncogenes with prognostic potential. J Cell Physiol. 2019;234:8465–8486. [DOI] [PubMed] [Google Scholar]
  • 12. Biswas S. MicroRNAs as therapeutic agents: The future of the battle against cancer. Curr Top Med Chem. 2018;18:2544–2554. [DOI] [PubMed] [Google Scholar]
  • 13. Yang C, Tabatabaei SN, Ruan X, Hardy P. The dual regulatory role of MiR‐181a in breast cancer. Cell Physiol Biochem. 2017;44:843–856. [DOI] [PubMed] [Google Scholar]
  • 14. Zhang Y, Zhao Y, Wu J, Liangpunsakul S, Niu J, Wang L. MicroRNA‐26‐5p functions as a new inhibitor of hepatoblastoma by repressing lin‐28 homolog B and aurora kinase a expression. Hepatol Commun. 2018;2:861–871. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15. Jiang W, Min J, Sui X, Qian Y, Liu Y, Liu Z, et al. MicroRNA‐26a‐5p and microRNA‐23b‐3p up‐regulate peroxiredoxin III in acute myeloid leukemia. Leuk Lymphoma. 2015;56:460–471. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16. Gammell P, Barron N, Kumar N, Clynes M. Initial identification of low temperature and culture stage induction of miRNA expression in suspension CHO‐K1 cells. J Biotechnol. 2007;130:213–218. [DOI] [PubMed] [Google Scholar]
  • 17. Xu X, Wang J, Han K, Li S, Xu F, Yang Y. Antimalarial drug mefloquine inhibits nuclear factor kappa B signaling and induces apoptosis in colorectal cancer cells. Cancer Sci. 2018;109:1220–1229. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18. Han K, Xu X, Xu Z, Chen G, Zeng Y, Zhang Z, et al. SC06, a novel small molecule compound, displays preclinical activity against multiple myeloma by disrupting the mTOR signaling pathway. Sci Rep. 2015;5:12809. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19. Han K, Xu X, Chen G, Zeng Y, Zhu J, Du X, et al. Identification of a promising PI3K inhibitor for the treatment of multiple myeloma through the structural optimization. J Hematol Oncol. 2014;7:9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20. Zhang L, Zhang F, He DK, Fan XM, Shen J. MicroRNA‐21 is upregulated during intestinal barrier dysfunction induced by ischemia reperfusion. Kaohsiung J Med Sci. 2018;34:556–563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21. Chen G, Xu X, Tong J, Han K, Zhang Z, Tang J, et al. Ubiquitination of the transcription factor c‐MAF is mediated by multiple lysine residues. Int J Biochem Cell Biol. 2014;57:157–166. [DOI] [PubMed] [Google Scholar]
  • 22. Xu X, Zhang J, Han K, Zhang Z, Chen G, Mao X, et al. Natural pesticide dihydrorotenone arrests human plasma cancer cells at the G0/G1 phase of the cell cycle. J Biochem Mol Toxicol. 2014;28:232–238. [DOI] [PubMed] [Google Scholar]
  • 23. Zeng Y, Xu X, Wang S, Zhang Z, Liu Y, Han K, et al. Ring finger protein 6 promotes breast cancer cell proliferation by stabilizing estrogen receptor alpha. Oncotarget. 2017;8:20103–20112. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 24. Xu YY, Song YQ, Huang ZM, Zhang HB, Chen M. MicroRNA‐26a inhibits multiple myeloma cell growth by suppressing cyclin‐dependent kinase 6 expression. Kaohsiung J Med Sci. 2019. 10.1002/kjm2.12057. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 25. Lv P, Qiu X, Gu Y, Yang X, Xu X, Yang Y. Long non‐coding RNA SNHG6 enhances cell proliferation, migration and invasion by regulating miR‐26a‐5p/MAPK6 in breast cancer. Biomed Pharmacother. 2019;110:294–301. [DOI] [PubMed] [Google Scholar]
  • 26. Cai J, Xiong Q, Jiang X, Zhou S, Liu T. RNF6 facilitates metastasis and radioresistance in hepatocellular carcinoma through ubiquitination of FoxA1. Exp Cell Res. 2019;374:152–161. [DOI] [PubMed] [Google Scholar]
  • 27. Xu X, Han K, Tang X, Zeng Y, Lin X, Zhao Y, et al. The ring finger protein RNF6 induces leukemia cell proliferation as a direct target of pre‐B‐cell leukemia Homeobox 1. J Biol Chem. 2016;291:9617–9628. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 28. Lu Q, He Y, Wang Y, Gao L, Zheng Y, Zhang Z, et al. Saponins from Paris forrestii (Takht.) H. Li display potent activity against acute myeloid leukemia by suppressing the RNF6/AKT/mTOR signaling pathway. Front Pharmacol. 2018;9:673. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 29. Liu L, Zhang Y, Wong CC, Zhang J, Dong Y, Li X, et al. RNF6 promotes colorectal cancer by activating the Wnt/beta‐catenin pathway via ubiquitination of TLE3. Cancer Res. 2018;78:1958–1971. [DOI] [PubMed] [Google Scholar]
  • 30. Liang Q, Ma D, Zhu X, Wang Z, Sun TT, Shen C, et al. RING‐finger protein 6 amplification activates JAK/STAT3 pathway by modifying SHP‐1 ubiquitylation and associates with poor outcome in colorectal cancer. Clin Cancer Res. 2018;24:1473–1485. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES