Abstract
The pathogenesis of acute lung injury (ALI) is characterized by lung inflammation and lung oxidative stress. The study was conducted in order to investigate the effect toll‐like receptor 4 (TLR4) and nuclear factor‐kappa B (NF‐κB) exhibited on oxidative stress in ALI. After the rats had been assigned into different groups, arterial blood, white blood cell (WBC), lung permeability index (LPI), wet/dry (W/D) ratio, TLR4 and NF‐κB expression and superoxide dismutase (SOD), myeloperoxidase (MPO), malondialdehyde (MDA), glutathione (GSH), and reactive oxygen species (ROS) were examined. Afterward, the correlation between the levels of TLR4 and NF‐κB was determined. Decreased levels of PaO2, SOD, MPO, and GSH accompanied by increased levels of PaCO2, WBC number, LPI and W/D ratio, MDA and ROS, as well as TLR4 and NF‐κB expressions in the ALI, ALI + NF‐κB inhibitor, and ALI + phosphate buffer saline groups were found. Inhibition of NF‐κB resulted in increased PaO2 and decreased PaCO2 levels, WBC number, and LPI and W/D ratio. Decreased expression of NF‐κB increased SOD, GSH, and MPO, but decreased MDA and ROS. We also found that NF‐κB inhibition resulted in the improvement of ALI in rats. TLR4 and NF‐κB expressions were negatively correlated with levels of SOD, MPO, and GSH, and positively correlated with MDA and ROS levels. In summary, our findings provided evidence that inhibition of the TLR4/NF‐κB signaling pathway decreases oxidative stress, thereby improving ALI. As a result, NF‐κB signaling pathway has shown potential as a therapeutic target in ALI therapy.
Keywords: acute lung injury, lung tissue, NF‐κB signaling pathway, oxidative stress
1. INTRODUCTION
Acute lung injury (ALI) falls under the category of acute respiratory failure, while being characterized by bilateral pulmonary infiltrates and severe hypoxemia.1 Both ALI and acute respiratory distress syndrome (ARDS) are accompanied by the overwhelming pulmonary inflammation, with a high mortality rate worldwide.2 ALI is also considered to be a common oxidative stress‐related disease, which is partly due to the fact that ALI potentially results from a redox imbalance between a cascade of a variety of mediators and other outcomes, leading up to oxidative stress.3, 4 There are also a number of risk factors for the occurrence of ALI, including inflammation, infection, multiple transfusions, sepsis, smoke inhalation, pneumonia, acute pancreatitis, near‐drowning aspiration of gastric contents, and severe trauma.5 Currently, the only method of treatment for lung diseases is the use of lung protective ventilation with positive end‐expiratory pressure and low tidal volumes, as there is insufficiency in pharmacological therapies for preventing injury or promoting repair.6, 7 Although there have been a number of therapeutic interventions recognized over the past couple of years, the occurrence of ALI cases has increased from approximately 1.5 to 75 cases per a 100 000 population, while the mortality of patients diagnosed with ARDS has reached 40%.8, 9 Based on this information, urgency in in discovering newer and more accurate biomarkers is imminent in order to help provide a better diagnosis along with a positive prognosis of ALI. Recently, there have been a number of studies on the positive role of toll‐like receptor 4 (TLR4) and nuclear factor‐kappa B (NF‐κB) signaling pathway in ALI and other lung diseases.10, 11
Toll‐like receptors (TLRs) are a kind of trans‐membrane proteins and signal transduction molecules.12 TLR4 is a pattern recognition receptor, typically known to play a major role in generating an inflammatory response by way of distinguishing exogenous pathogen‐associated and endogenous damage‐associated molecular patterns.13 The effects of TLR4 and NF‐κB signaling pathway in several types of tissues have been highlighted in previous studies, including liver and pancreas tissues.14, 15 Moreover, the oxidative stress can also be alleviated when the TLR4 and NF‐κB pathway are blocked, in turn ameliorating the acute kidney failure and preeclampsia.16 NF‐κB, known commonly as an important transcriptional factor, is crucial to prevent a variety of disorders including immune and inflammatory diseases.17 An essential downstream component in the TLR4 signaling pathway has also been observed, making it a fundamental factor for the gene expression of inflammation mediums such as interleukin‐1β and tumor necrosis factor‐α.18 The aforementioned studies are highly indicative of potential relationship between TLR4 and NF‐κB signaling pathway. Due to the insufficient research conducted on the role NF‐κB/TLR4 signaling pathway in ALI, we intended to explore the effects of the NF‐κB/TLR4 signaling pathway on oxidative stress in lung tissue of rat models of ALI.
2. MATERIALS AND METHODS
2.1. Experimental animals and grouping
A total of 100 healthy Sprague‐Dawlay rats (250 ± 50 g) was obtained from our hospital. The rats were then randomly assigned into the ALI group, the ALI + NF‐κB inhibitor group, the ALI + phosphate buffer saline (PBS) group, and the control group. An ALI rat model would subsequently be established due to the administration of lipopolysaccharides (LPS) (Sigma‐Aldrich, San Diego, California, USA). The rats in the ALI group, the ALI + NF‐κB inhibitor group, and the ALI + PBS group were anesthetized along with a 2.5% pentobarbital sodium solution, followed by an intraperitoneal injection of LPS at the ratio of 1 mg/kg. Approximately 4 to 6 hours later, the rats present with hyperventilation, tachycardia, and were in an anxious state. Approximately 16 hours following the intraperitoneal injection, rats in the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups were intubated through trachea using vein‐detained needle. The successfully intubated were verified by using an ALC‐8 small animal respirator, with the ventilator parameters set as follows: breathing rate 40 times/min, duration of ventilation 4 hours, inspiratory expiratory ratio 1:2, positive end expiratory pressure 5 cm H2O, and tidal volume 30 mL/kg (adjusted based on weight); while the second round of treatment was performed, with LPS dropped into the right bronchial trachea of rats at ratio of 3 mg/kg. The rats in the ALI group would not receive any further treatment. Rats in the ALI + NF‐κB inhibitor group, however, were injected intraperitoneally with a 0.2 mL NF‐κB inhibitor (Pyrrolidinedithiocarbamic [PDTC] acid, Sigma‐Aldrich, San Diego, California, USA) at a ratio of 800 ng/kg. PBS was then intraperitoneally administered in the rats in the ALI + PBS group at the same time, with an equal volume to the PDTC injection. The rats in the control group would not receive any treatment. After 24 hours of treatment, the rats were sacrificed and the samples were collected for detection and analyses.
2.2. Measurement of PaO2 and PaCO2
A left ventricular puncture was made on each rat in order to obtain the arterial blood (5 mL) for the ensuing measurement of PaO2 and PaCO2 with the rats being subsequently sacrificed. A blood gas analyzer (Abbott Laboratories, Chicago, Illinois, USA) was then used in order to measure PaO2 and PaCO2 immediately in the arterial blood.
2.3. White blood cell count in bronchoalveolar lavage fluid
Rats were subsequently anesthetized by means of an intraperitoneal injection of 3% pentobarbital sodium (30 mg/kg) (P3761, Sigma‐Aldrich Chemical Company, St. Louis, Missouri, USA). Following the removal of the eyeball and extraction of blood, the trachea was isolated, allowing for the ligation of the left bronchus. PBS (0.5 mL) at 4°C was then slowly injected into the trachea in three separate injections, with an interval in‐between the injections for the PBS in order to be retained. The suction was repeated three times. After the bronchoalveolar lavage fluid (BALF) had been recycled in an Eppendorf tube and centrifuged at a rate of 12 000 rpm at 4°C for a total of 10 minutes, the supernatant was collected and stored in a refrigerator at −80°C. The sediment was then resuspended along with a 1 mL PBS solution, while the cover glass was spread out with 10 μL suspension and stained using the Diff‐Quik kit (International Reagents Corp, Japan). Cell smears were then dried and immersed into the aforementioned Diff‐Quik fixative staining for 6 seconds, followed by removal of the excess liquid. The cell smears were then immersed into Diff‐Quik staining solution A for 15 seconds, followed by the removal of excess liquid. Afterward, cell smears were immersed in Diff‐Quik staining solution B for 10 seconds, again with excess liquid removed followed by a washing in ultra‐pure water for 15 seconds in order to remove excess dye liquor. Subsequently, the cell smears were dried in the air by orthostatic means. The total cell number, number of neutrophils, macrophages, lymphocytes, and eosinophils were counted under microscope.
2.4. Measurement of lung permeability index and wet/dry weight ratio
After the rats had been sacrificed, the lobar of rats and BALF were collected, with protein content in BALF determined by the usage of a Coomassie brilliant blue dye‐binding assay. The protein content in plasma was also determined using a biuret reagent measurements, while the lung permeability index (LPI) was calculated using the formula: LPI = protein content in BAIF/protein content in plasma. The weight of whole lung beginning from the bronchus was measured, with the blood on the lung surface blotted with filter paper. Next, the wet weight of lung was calculated. Afterward, samples were dried in order to regulate weight using a drying oven. The lung was then be weighed, with the dry weight data recorded, along with wet/dry (W/D) ratio taken as the ratio of dry weight to wet weight.
2.5. Hematoxylin and eosin staining
After the above procedure, the lung tissues were extracted from the sacrificed rats and were then stained using a hematoxylin and eosin (HE) staining for the histopathological morphological observation. The blood samples were washed using normal saline, fixed in 10% formalin, conventionally dehydrated, embedded, sliced, dewaxed, and stained with HE for 5 minutes. Following the previous process, the samples were washed with water in order to reobtain the former blue color. Afterward, the samples were washed using a gradient ethanol stained with eosin (Beijing Solarbio Science & Technology Co, Beijing, China) for 15 seconds and washed with the same gradient ethanol an additional two times. After cleaning with xylene, sealed, and observed under a light microscope, a semi‐quantitative scoring of ALI was applied according to the following four parameters: alveolar congestion, hemorrhage, leukocyte infiltration or aggregation of neutrophils in the air space or vessel wall, and thickening of the alveolar wall /hyaline membrane formation. The scores were presented as the following: 0 represented very mild ALI; 1 represented mild ALI; 2 represented moderate ALI; 3 represented severe ALI; and 4 represented extremely severe ALI. The sum of scores of the four indicators was regarded as a total score.
2.6. Immunohistochemistry
Immunohistochemistry (IHC) was then performed on the lung tissues. After the samples had been embedded in paraffin, approximately 7 μm sections were obtained. Next, TLR4, NF‐κB, and myeloperoxidase (MPO) immunohistochemical staining were performed using the Streptomycinperoxidel immunohistochemical technique. To begin, the sections were dewaxed with xylene, dehydrated with alcohol, and immersed in a 3% hydrogen peroxide in order to block the endogenous peroxidase, which would then be followed by antigen retrieval. Then, the sections were incubated along with primary antibodies at 37°C for 1 hour (rabbit anti‐mouse monoclonal antibody TLR4, 1:500, ab22048; NF‐κB, 1:200, ab16502; MPO, 1:500, ab105136). All of the antibodies were purchased from Abcam, Inc (Cambridge, UK). Following incubation with horseradish peroxidase (HRP)‐labeled secondary antibody (Zhongshan Goldenbridge Biotechnology Co Ltd, Beijing, China) at 37°C for 30 minutes, the sections were added in with a freshly prepared diaminobenzidine (Zhongshan Goldenbridge Biotechnology Co Ltd) for up to 2 minutes in order to color. The sections were then washed with PBS three times (each time for 2 minutes), re‐counterstained with HE for 1 minute, dehydrated, cleaned, and sealed along with the use of a neutral balsam. The sections would then be photographed and analyzed under an optical microscope.
2.7. Enzyme‐linked immunosorbent assay
Enzyme‐linked immunosorbent assay (ELISA) was performed according to the instructions provided by the ELISA kits (PeproTech, Rocky Hill, New Jersey, USA) in order to detect serum TLR4 and NF‐κB levels. The antibody was then diluted along with the coating buffer to 1 μg/ mL, added to the 96‐well plate (100 μL/well), and fixed at 4°C overnight. The coating buffer was aspirated, while the plate was washed a total of three times. Afterward, each well was added in with 150 μL sealing liquid in order to incubate at room temperature for 1 hour. Following the washing of the plate, 100 μL well‐diluted standard or serum samples were added for further incubation at room temperature for 2 hours, after which the blank control could be determined. Then, 100 μL HRP‐labeled avidin was added into each well for an additional incubation at room temperature for 1 hour. Afterward, the plate was washed, 3,3′,5,5′‐tetramethylbenzidine substrate solution was added into each well for reaction for 15 minutes at room temperature, followed by the reactions termination with the addition of 2M sulfuric acid (50 μL) to each well. The absorbance value was measured at the wavelength of 450 nm using the microplate reader. The concentration of TLR4 and NF‐κB (ng/mL) was determined based on the standard curve.
2.8. Reverse transcription quantitative polymerase chain reaction
The lung tissues were subsequently sliced and ground into fine powder using liquid nitrogen. The total RNA in the rat lung tissues was extracted using a Trizol instrument (Invitrogen, Waltham, Massachusetts, USA) in accordance with the instructions provided by the Trizol one‐step method. According to the instructions of the kits (MBI Fermentas, Ontario, Canada), RNA reverse transcription was performed using the aforementioned Trizol two‐step method. The reaction conditions from the two‐step method went as follows: 10 minutes at 70°C, ice bath for 2 minutes, 60 minutes at 42°C, and 10 minutes at 70°C. The cDNA produced by reverse transcription was temporarily stored in a −80°C refrigerator. The reverse transcription quantitative polymerase chain reaction (RT‐qPCR) reaction was then conducted according to the instructions of the kits (MBI Fermentas), with the primer sequences of the kits listed in Table 1.19 The reaction conditions were the following: pre‐denaturation for 30 seconds at 95°C, with a total of 40 cycles of denaturation for 10 seconds at 95°C, annealing for 20 seconds at 60°C, and extension for 10 seconds at 70°C. A quantitative PCR test (iQ5 model Bio‐Rad, Bio‐Rad Company, California, USA) was applied in order to examine, along with β‐actin being referred to as the internal reference. The relative quantitative method was selected for calculation of target gene mRNA expression. The 2−ΔΔCt was used in order to present the relative expression of target genes. Each experiment was repeated a total of three times.
Table 1.
Primer sequences for RT‐qPCR
| Target gene | Sequence |
|---|---|
| TLR4 | Forward: 5′‐AACTCTGGATGGGGTTTCCT‐3′ |
| Reverse: 5′‐ACAACCTCCCTTCTCAACC‐3′ | |
| NF‐κB | Forward: 5′‐GGGAAGGAACGCTGTCAGAG‐3′ |
| Reverse: 5′‐TAGCCTCAGGGTACTCCATCA‐3′ | |
| β‐actin | Forward: 5′‐GCATGGAGTCCTGTGGCAT‐3′ |
| Reverse: 5′‐CTAGAAGCATTTGCGGTGG‐3′ |
Abbreviations: NF‐κB, nuclear factor κB; RT‐qPCR, reveres transcription quantitative polymerase chain reaction; TLR4, toll‐like receptor 4.
2.9. Western blot analysis
Frozen lung tissues were placed in the homogenate tube in order to obtain the homogenate along with the addition of the lysates (Beyotime Biotechnology Co, Shanghai, China). The samples were then placed on ice for a total of 30 minutes and centrifuged for 10 minutes at a rate of 12 000 rpm at 4°C, after which those samples were collected and stored at −20°C. Subsequently, the bovine serum albumin protein standard (Beijing Solarbio Science & Technology Co, Beijing, China) along with gradient concentration was configured. The concentration of the protein was then measured using a bicinchoninic acid kits (Thermo Fisher Scientific, Waltham, Massachusetts, USA). After electrophoresis had been successfully performed on the extracted protein at 60 V, the protein was then placed in a separation gel electrophoresis at 120 V for 1 to 2 hours in a cold room at 4°C. Following electrophoresis, the protein was transferred onto the polyvinylidene fluoride (PVDF) membranes by way of the wet transfer method in a cold room at 4°C for 2 hours. The membranes were then removed and blocked along with a 5% skimmed milk‐TBST for incubation at room temperature for 1 to 2 hours. The membranes would then be incubated along with primary antibodies of TLR4 and NF‐κB (Cell Signaling Technology, Beverly, Massachusetts, USA) at 4°C overnight. Afterward, the membranes were washed by using the Tris‐buffered saline Tween‐20 (TBST) a total of three times (each time for 10 minutes), followed by incubation along with the anti‐mouse IgG (Abcam, Inc, Cambridge, UK) for 1 hour at room temperature. The PVDF membrane was then washed by TBST a total of three times (each time for 10 minutes). Chemiluminescence was then conducted, with an X‐ray being employed for the development of the images. The integrated optical density (OD) values of the bands were calculated and the relative expression of target protein was obtained by the ratio of the integral OD value of the target gene band to the corresponding internal reference β‐actin. The experiment was repeated three times.
2.10. Detection of superoxide dismutase, MPO, reduced glutathione hormone, malonaldehyde, and reactive oxygen species
The activity of superoxide dismutase (SOD) and MPO along with the content of malondialdehyde (MDA), glutathione (GSH), and reactive oxygen species (ROS) were detected using the different test kit (Nanjing Jiancheng Biological Engineering Institute, Jiangsu, China) in accordance with the instructions provided by the kits. The tissues would then be collected from the refrigerator and prepared into a homogenate state. Next, the tissues were centrifuged (1000g) for 20 minutes along with the collection of the supernatant. The temperature of the reagent in kit was equilibrated to room temperature prior to the experiment. Following the dilution and mixture of either the reagent or sample, the tissues involved with the plate were added in with the 100 μL sample diluent, standard sample, or samples in order to be measured. The sample was gently shaken, mixed, and covered for reaction at 37°C for 2 hours. Afterward, the liquid was removed while the sample was dried. With the addition of the solution A (100 μL) to each well, the sample was covered in order to test the reaction at 37°C for 60 minutes, after which, the liquid was removed and the plates were washed a total of three times and dried. Then, the substrate solution (90 μL) was added into each well in order. Enzyme‐labeled plate was then covered by Membrana Tectoria (ME) at 37°C for their development in the dark. The reaction would later be terminated followed by the addition of 50 μL termination solution. A microplate reader was then being employed in order to detect the OD value of each well at the wavelength of 450 nm immediately. The experiment was repeated a total of three times.
2.11. Statistical analysis
The SPSS 21.0 software (IBM Corp, Armonk, New York) was used for data analysis. Measurement data were presented as mean ± SD. Comparison among multiple groups was conducted by one‐way analysis of variance, while comparison between two groups was done using the LSD method. The Pearson correlation analysis was performed for relative analyses. P < .05 was regarded as a statistically significance value.
3. RESULTS
3.1. NF‐κB inhibitor decreases the level of PaCO2 and increases the level of PaO2
A blood gas analyzer was then employed for the measurement of PaO2 and PaCO2 levels with the results presented in Table 2. There was a decrease in the PaO2 levels in the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups (the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0129; the ALI + PBS group vs the control group, P < .0001), while PaCO2 increased (the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0310; the ALI + PBS group vs the control group, P < .0001) when compared with the control group. PaCO2 was lower (the ALI group vs the ALI + NF‐κB inhibitor group, P < .0001), while PaO2 was higher (the ALI group vs the ALI + NF‐κB inhibitor group, P = .0023) in the ALI + NF‐κB inhibitor group compared with the ALI group. There were no significant differences observed in the levels of PaO2 (the ALI group vs the ALI + PBS group, P = .9941) and PaCO2 (the ALI group vs the ALI + PBS group, P = .2857) between the ALI + PBS and ALI groups. The aforementioned findings would go onto suggest that the NF‐κB inhibition could lead to an increase in the levels of PaO2 and the decrease in the levels of PaCO2.
Table 2.
Comparison of PaO2 and PaCO2 in arterial blood of rats among the four groups (n = 5)
| Groups | PaO2/mm Hg | PaCO2/mm Hg |
|---|---|---|
| ALI | 65.10 ± 4.43# | 61.24 ± 3.09 |
| ALI + NF‐κB inhibitor | 78.48 ± 7.54*# | 42.69 ± 1.79*# |
| ALI + PBS | 63.19 ± 6.05# | 59.77 ± 4.83# |
| Control | 89.72 ± 8.61* | 40.06 ± 1.08* |
Abbreviations: ALI, acute lung injury; NF‐κB, nuclear factor κB; PaCO2, partial pressure of carbon dioxide; PaO2, arterial partial pressure of oxygen; PBS, phosphate buffer saline.
*, vs the ALI group; #, vs the control group.
3.2. NF‐κB inhibitor decreases the white blood cell number
The BALF method was used in order to count the number of white blood cell (WBC), with the results being illustrated in Table 3. In comparison with the control group, the total number of cells, neutrophils, and macrophages were increased in the remaining three groups (the total number of cells: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0004; the ALI + PBS group vs the control group, P < .0001; the number of neutrophils: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0004; the ALI + PBS group vs the control group, P < .0001; the number of macrophages: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0131; the ALI + PBS group vs the control group, P < .0001), while the number of eosinophils had decreased (the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0053; the ALI + PBS group vs the control group, P < .0001). The total number of cells, neutrophils, eosinophils, and macrophages had decreased in the ALI + NF‐κB inhibitor group in comparison with those in the ALI group (the total number of cells: the ALI group vs the ALI + NF‐κB inhibitor group, P = .0341; the number of neutrophils: the ALI group vs the ALI + NF‐κB inhibitor group, P = .0006; the number of macrophages: the ALI group vs the ALI + NF‐κB inhibitor group, P = .0296; the number of eosinophils: the ALI group vs the ALI + NF‐κB inhibitor group, P = .0006), while there were no significant differences to be observed in the PBS group (the total number of cells: the ALI group vs the ALI + PBS group, P = . 8795; the number of neutrophils: the ALI group vs the ALI + PBS group, P = .9544; the number of macrophages: the ALI group vs the ALI + PBS group, P = .9978; the number of eosinophils: the ALI group vs the ALI + PBS group, P = .9953; all P > .05). There were no statistical differences detected in lymphocyte counts among all of the aforementioned groups (the ALI group vs the ALI + NF‐κB inhibitor group, P = .9982; the ALI group vs the ALI + PBS group, P = .9864; the ALI group vs the control group, P = .8842; the PBS group vs the ALI + NF‐κB inhibitor group, P = .9568; the ALI + NF‐κB inhibitor group vs the control group, P = .9423; the ALI + PBS group vs the control group, P = . 7149). During the onset of respiratory distress, an inflammatory reaction had presented itself, showing an increase in WBC count. The symptoms of the reaction were alleviated with the administration of PDTC.
Table 3.
White blood cell number in rat bronchoalveolar lavage fluid among the four groups (n = 5)
| Group | ALI | ALI + NF‐κB inhibitor | ALI + PBS | Control |
|---|---|---|---|---|
| Total number (× 105/mL) | 13.92# ± 0.48# | 12.68 ± 0.53*# | 14.22 ± 0.64# | 10.55 ± 0.85 |
| Neutrophils (× 105/mL) | 4.13 ± 0.52# | 2.85 ± 0.28*# | 4.26 ± 0.53# | 1.52 ± 0.09 |
| Macrophages (× 105/mL) | 7.68 ± 0.31# | 6.83 ± 0.44*# | 7.56 ± 0.36# | 6.05 ± 0.38 |
| White blood cells (× 105/mL) | 1.11 ± 0.42 | 1.08 ± 0.13 | 1.17 ± 0.31 | 0.98 ± 0.17 |
| Eosinophils (× 105/mL) | 0.28 ± 0.11 | 1.15 ± 0.42*# | 0.32 ± 0.09# | 1.83 ± 0.52 |
Abbreviations: ALI, acute lung injury; NF‐κB, nuclear factor κB; PBS, phosphate buffer saline.
*, vs the ALI group; #, vs the control group.
3.3. NF‐κB inhibitor reduces the LPI and W/D weight ratio
After the subjected rats had been sacrificed, the LPI and W/D weight ratio in BALF were determined with the use of a Coomassie brilliant blue dye‐binding assay, with the LPI and W/D weight ratio being shown in Table 4. In comparison with the control group, LPI and W/D weight ratio were evidently higher in the ALI, ALI + NF‐κB inhibitor, and PBS groups (LPI: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0432; the ALI + PBS group vs the control group, P = .0001; W/D: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0060; the ALI + PBS group vs the control group, P < .0001). All of the measuring indexes in the ALI + NF‐κB inhibitor group were evidently lower than those found in the ALI group (the ALI group vs the ALI + NF‐κB inhibitor group, P = .0206; the ALI group vs the ALI + NF‐κB inhibitor group, P = .0201). Again, there were no significant differences found between the ALI and ALI + PBS groups (LPI: the ALI group vs the ALI + PBS group, P = . 9865; W/D: the ALI group vs the ALI + PBS group, P = .0992). The aforementioned results highly indicated to us that the NF‐κB inhibitor could result in an overall decline between the LPI and W/D weight ratio.
Table 4.
LPI and W/D weight ratio of rats among the four groups (n = 5)
| Group | LPI | W/D weight ratio |
|---|---|---|
| ALI | 2.84 ± 0.33# | 7.18 ± 1.90# |
| ALI + NF‐κB inhibitors | 2.05 ± 0.36*# | 4.90 ± 0.66*# |
| ALI + PBS | 2.76 ± 0.47# | 7.27 ± 0.78# |
| Control | 1.35 ± 0.33* | 2.21 ± 0.22* |
Abbreviations: ALI, acute lung injury; LPI, lung permeability index; NF‐κB, nuclear factor κB; PBS, phosphate buffer saline; W/D, wet/dry.
*, vs the ALI group; #, vs the control group.
3.4. NF‐κB inhibitor improves ALI in rats
HE staining was performed in order to detect the histopathological findings of lung tissue in each group and the results are shown in Figure 1. The ALIs were scores in different groups as follows: the ALI group: 4.88 ± 0.59; the ALI + NF‐κB inhibitor group: 2.14 ± 0.37; the ALI + PBS group: 4.59 ± 0.44; and the control group: 0.75 ± 0.14. Following HE staining, the degree of lung injury was observed in the rats of the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups. The rats in the ALI group also presented with higher degrees of pulmonary interstitial, intra‐alveolar hemorrhage, and inflammatory cells. The alveolar collapse at the lung lesion had presented with an atelectasis effect along with widening of the alveolar septum. The degree of lung injury in the ALI + NF‐κB inhibitor group had also been observed to be slightly lower in the ALI group. A few pulmonary interstitial, intra‐alveolar hemorrhage, and inflammatory cells were observed. Partial alveolar collapse at lung lesion could be observed. The degree of lung injury in the ALI + PBS group was almost identical to that of the ALI group, being more pulmonary interstitial, alveolar, inflammatory cells, and alveolar collapse. All corresponding data went onto suggest that the NF‐κB inhibitor may have an alleviating effect on the ALI in lung tissues of rats.
Figure 1.

NF‐κB inhibitor improves ALI in rats. A, After the HE staining, different degrees of lung injury were observed in rats of the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups (×400). B, The lung injury score of rats in each group; data were all expressed by the average value ± SD, the result of which was verified by one‐way ANOVA; *, P < .05 vs the control group; #, P < .05 vs the ALI group; n = 5. Abbreviations: ALI, acute lung injury; ANOVA, analysis of variance; NF‐κB, nuclear factor κB; HE, hematoxylin‐eosin; PBS, phosphate buffer saline
3.5. The expression of TLR4, NF‐κB, and MPO is significantly increased in lung tissues of ALI rats
An IHC was performed with the motive of investigating the effects that the ALI + NF‐κB inhibitor had shown on the expression of TLR4, MPO, and NF‐κB. As shown in Figure 2, in comparison with the control group, the expression of TLR4 had increased in the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups (the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P < .0001; the ALI + PBS group vs the control group, P < .0001). However, there were no significant differences found in the expression of TLR4 among the ALI + PBS, ALI + NF‐κB inhibitor, and ALI groups (the ALI group vs the ALI + NF‐κB inhibitor group, P = . 8795; the ALI group vs the ALI + PBS group, P = .7920; the ALI group vs the ALI + PBS group, P = .9977). There was also an evident increase in the expression of NF‐κB and MPO in the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups when compared with the expressions detected in the control group (NF‐κB: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0009; the ALI + PBS group vs the control group, P < .0001; MPO: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0020; the ALI + PBS group vs the control group, P < .0001), while the same expression had decreased in the ALI + NF‐κB inhibitor group when compared with that in the ALI group (the ALI group vs the ALI + NF‐κB inhibitor group, P = .0004; the ALI group vs the ALI + NF‐κB inhibitor group, P = .0002). Again, there were no significant differences to be observed between the ALI + PBS and ALI groups of the expression of NF‐κB and MPO (the ALI group vs the ALI + PBS group, P = .9640; the ALI group vs the ALI + PBS group, P = .8992). These discoveries denoted the idea that there was an increased expression of TLR4, MPO, and NF‐κB found in the lung tissues of ALI rats.
Figure 2.

Increased expression of TLR4, NF‐κB, and MPO is found in lung tissues of ALI rats. A, The lung tissues examined by immunohistochemistry; B‐D, The expression scores of TLR4, NF‐κB, and MPO in each group; data were all expressed by the average value ± SD, the result of which was verified by one‐way ANOVA; *, P < .05 vs the control group; #, P < .05 vs the ALI group; n = 5. Abbreviations: ALI, acute lung injury; ANOVA, analysis of variance; MPO, myeloperoxidase; NF‐κB, nuclear factor κB; TLR4, toll‐like receptor 4
3.6. Highly expressed TLR4 and NF‐κB are found in ALI rats
As illustrated in Figure 3, the ELISA method was performed in order to detect the TLR4 and NF‐κB expressions. In comparison with the control group, the expressions of TLR4 and NF‐κB had significantly increased in the corresponding groups: ALI group, ALI + NF‐κB inhibitor group, and ALI + PBS group (the ALI group vs the control group, P = .0002; the ALI + NF‐κB inhibitor group vs the control group, P = 0003; the ALI + PBS group vs the control group, P = .0009). There were no notable differences when detecting the expression of TLR4 and NF‐κB among the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups (the ALI group vs the ALI + NF‐κB inhibitor group, P = .9829; the ALI group vs the ALI + PBS group, P = .8249; the ALI + NF‐κB inhibitor group vs the ALI + PBS group, P = .9588). In comparison with the control group, the expression of NF‐κB had become significantly increased in the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups (the ALI group vs the control group, P = .00014; the ALI + NF‐κB inhibitor group vs the control group, P = .0008; the ALI + PBS group vs the control group, P < .0001). The NF‐κB expression in the ALI + NF‐κB inhibitor group was also lower than the expression found in the ALI group (the ALI group vs the ALI + NF‐κB inhibitor group, P = .0021). However, there were again no differences to be detected in NF‐κB expression between the ALI + PBS group and the ALI group (the ALI group vs the ALI + PBS group, P = .9992).
Figure 3.

Highly expressed TLR4 and NF‐κB are found in serum of ALI rats. A, The expression of TLR4 in serum of rats in each group; B, The expression of NF‐κB in serum of rats in each group; *, P < .05 vs the control group; #, P < .05 vs the ALI group; n = 5; data were all expressed by the average value ± SD. Abbreviations: ALI, acute lung injury; MPO, myeloperoxidase; NF‐κB, nuclear factor κB; TLR4, toll‐like receptor 4
3.7. NF‐κB inhibitor suppresses the activation of TLR4/NF‐κB signaling pathway
The mRNA and protein expressions of TLR4 and NF‐κB had been detected by performing an RT‐qPCR and western blot analysis, with the results presented in Figure 4. The trends collectively of the mRNA and protein expression for TLR4 and NF‐κB in the cells of each group were found to be identical. In comparison with the control group, the mRNA, and protein expression of TLR4 (mRNA: the ALI group vs the control group, P = .0033; the ALI + NF‐κB inhibitor group vs the control group, P = .0021; the ALI + PBS group vs the control group, P = .0015; protein: the ALI group vs the control group, P = .0003; the ALI + NF‐κB inhibitor group vs the control group, P = .0004; the ALI + PBS group vs the control group, P = .0002) and NF‐κB (mRNA: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0472; the ALI + PBS group vs the control group, P < .0001; protein: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0472; the ALI + PBS group vs the control group, P < .0001), the mRNA and protein expressions were presented to be significantly higher in the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups. There were no differences detected in mRNA and protein expression of TLR4 among the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups (mRNA: the ALI group vs the ALI + NF‐κB inhibitor group, P = .9828; the ALI group vs the ALI + PBS group, P = .9061; the ALI + NF‐κB inhibitor group vs the ALI + PBS group, P = .9895; protein: the ALI group vs the ALI + NF‐κB inhibitor group, P = .9847; the ALI group vs the ALI + PBS group, P = .9847; the ALI + NF‐κB inhibitor group vs the ALI + PBS group, P = .8983). In comparison with the ALI group, the mRNA and protein expression of NF‐κB had seen their detection significantly decreased in the ALI + NF‐κB inhibitor group (mRNA: the ALI group vs the ALI + NF‐κB inhibitor group, P < .0001; protein: the ALI group vs the ALI + NF‐κB inhibitor group, P < .0001), while there were no significant differences observed between the ALI group and the ALI + PBS group (mRNA: the ALI group vs the ALI + PBS group, P = .3866; protein: the ALI group vs the ALI + PBS group, P = .7293). These results would further indicate that NF‐κB inhibitor has the capability of inhibiting the activation of the TRL4/NF‐κB signaling pathway.
Figure 4.

NF‐κB inhibitor suppresses the activation of TRL4/NF‐κB signaling pathway. A and B, The mRNA expression of TLR4 and NF‐κB in cells of rats in each group; C and D, The protein expression of TLR4 and NF‐κB in cells of rats in each group; E, The protein bands of TLR4, NF‐κB, and GAPDH in each group; *, P < .05 vs the ALI group; #, P < .05 vs the control group; n = 5; data were all expressed by the average value ± SD. Abbreviations: ALI, acute lung injury; MPO, myeloperoxidase; NF‐κB, nuclear factor κB; TLR4, toll‐like receptor 4; GAPDH, glyceraldehyde‐3‐phosphate dehydrogenase
3.8. NF‐κB inhibitor increases SOD and GSH and decreases MDA, MPO, and ROS
In order to investigate the effects NF‐κB inhibitor had on SOD, MPO, GSH, MDA, and ROS, the activity of SOD and MPO, and the content of MDA, GSH, and ROS were collectively detected. As shown in Figure 5, when comparing with the control group, the levels of SOD and GSH had been decreased (SOD: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0232; the ALI + PBS group vs the control group, P < .0001; GSH: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0135; the ALI + PBS group vs the control group, P < .0001), while the levels of MPO, MDA, and ROS had been increased among the ALI, ALI + NF‐κB inhibitor, and ALI + PBS groups (MPO: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0045; the ALI + PBS group vs the control group, P < .0001; MDA: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0191; the ALI + PBS group vs the control group, P < .0001; ROS: the ALI group vs the control group, P < .0001; the ALI + NF‐κB inhibitor group vs the control group, P = .0272; the ALI + PBS group vs the control group, P < .0001). In comparison with the ALI group, the levels of SOD and GSH were elevated (SOD: the ALI group vs the ALI + NF‐κB inhibitor group, P = .0318; GSH: the ALI group vs the ALI + NF‐κB inhibitor group, P = .0213), while the levels of MDA, MPO, and ROS expression had been reduced (MPO: the ALI group vs the ALI + NF‐κB inhibitor group, P = .0223; MDA: ALI group vs the ALI + NF‐κB inhibitor group, P = .0309; ROS: the ALI group vs the ALI + NF‐κB inhibitor group, P = .0297) in the ALI + NF‐κB inhibitor group. There were no significant variations detected among the levels of SOD, MPO, GSH, MDA, and ROS between the ALI and ALI + PBS groups (SOD: the ALI group vs the ALI + PBS group, P = .9823; GSH: the ALI group vs the ALI + PBS group, P = .9981; MPO: the ALI group vs the ALI + PBS group, P = .9442; MDA: the ALI group vs the ALI + PBS group, P = .9775; ROS: the ALI group vs the ALI + PBS group, P = .9931). The aforementioned data demonstrated to us that NF‐κB inhibitor had the ability to increase levels of SOD, MPO, and GSH, while effectively and simultaneously decreasing MDA and ROS.
Figure 5.

NF‐κB inhibitor increases SOD, MPO, and GSH, and decreases MDA and ROS. A and B, The activities of SOD and MPO in each group; C, D and E, The levels of MDA, ROS, and GSH in each group; *, P < .05 vs the ALI group; #, P < .05 vs the control group; n = 5. Abbreviations: ALI, acute lung injury; GSH, glutathione; MDA, malondialdehyde; MPO, myeloperoxidase; NF‐κB, nuclear factor κB; ROS, reactive oxygen species; SOD, superoxide dismutase
3.9. TLR4 and NF‐κB are negatively correlated with levels of SOD, MPO, and GSH and positively correlated with levels of MDA and ROS
Finally, the Pearson correlation analysis was performed for relative analyses. As seen in Table 5, the expression of TLR4 had been negatively correlated with levels of SOD, MPO, and GSH, with the correlation coefficients (r) being −.717, −.501, and −.654 (TLR4 vs SOD, P = .0004; TLR4 vs MPO, P = .0246; TLR4 vs GSH, P = .0018), while contrarily there was a positive correlation among the levels of MDA and ROS, with these correlation coefficients (r) being .654 and .732 (TLR4 vs MDA, P = .0018; TLR4 vs ROS, P = .0002). The expression of NF‐κB had been negatively correlated with levels of SOD, MPO, and GSH, while the correlation coefficients (r) were −.824, −.472, and −.823 (NF‐κB vs SOD, P < .0001; NF‐κB vs MPO, P = .0355; NF‐κB vs GSH, P < .0001), however, they had been positively correlated with levels of MDA and ROS, with the correlation coefficients (r) being .873 and .779 (NF‐κB vs MDA, P < .0001; NF‐κB vs ROS, P < .0001). The aforementioned findings led us to believe that TLR4 and NF‐κB had been negatively correlated among the levels of SOD, MPO, and GSH and positively correlated with the levels of MDA and ROS.
Table 5.
Correlation analysis of TLR4 and NF‐κB level and oxidative stress
| Oxidative stress index | TLR4 | NF‐κB | ||
|---|---|---|---|---|
| r | P | r | P | |
| SOD | −.717 | .0004 | −.824 | <.0001 |
| MPO | −.501 | .0246 | −.4723 | .0355 |
| MDA | .654 | .0018 | .873 | <.0001 |
| ROS | .732 | .0002 | .779 | <.0001 |
| GSH | −.654 | .0018 | −.823 | <.0001 |
Abbreviations: GSH, glutathione; MDA, malondialdehyde; MPO, myeloperoxidase; NF‐κB, nuclear factor κB; ROS, reactive oxygen species; SOD, superoxide dismutase; TLR4, toll‐like receptor 4.
4. DISCUSSION
The pathogenesis of ALI is commonly known to be closely associated with oxidative stress injury and inflammation.2 Previous studies have been conducted on the crucial role played by a variety of signaling pathways in improving the treatment of ALI.8, 20 Therefore, we conducted this study in order to examine the role the TLR4/NF‐κB signaling pathway played in ALI and the findings from the present evidence revealed that the inhibition of NF‐κB/TLR4 signaling pathway could improve ALI by decreasing the oxidative stress in lung tissue of rat models.
Based on the results obtained in our study, the ALI group presented with lower levels of PaO2, while the PaCO2, numbers of total cellular score, WBC number, LPI, and the W/D weight ratio had evidently increased when comparing them with the control group. According to previous reports, the recruitment of leukocytes and neutrophil‐mediated lung injury has been reported to play essential roles in the development of ARDS.21 ARDS, primarily known to be the severe complication of ALI, had been characterized by the accumulation of protein‐rich fluid inside the alveoli, occurring as a result of an increased pulmonary capillary permeability.22 An increase in the W/D ratio and LPI are two important mechanisms that lead directly to an increase in ARDS inflammation.23 PaO2 has been reported to be used to express the degree of hypoxemia and severity, while PaCO2 has been considered to be a surrogate for alveolar carbon dioxide.24 The aforementioned variables, including an increased LPI, number of total cellular score, neutrophil count, and macrophage some of which are pathological and physiological findings in ALI patients, all consistent with the previously researched studies.25, 26 Another discovery from our study revealed that when comparing with the ALI group, the ALI + NF‐κB inhibitors group had presented with increased levels of PaO2, and decreased PaCO2, number of total cellular score, neutrophil and macrophage counts, LPI, and the W/D weight ratio of lung. These findings were highly indicative of the effect of the NF‐κB inhibition in the alleviation of ALI. A previous study also found that the suppression of the NF‐κB activation showed a protective effect in ALI, potentially reducing the production of pro‐inflammatory cytokines in lung tissues.27
A key finding from our study presented us with the evidence of the TLR4 and NF‐κB mRNA and protein expressions being lower vs the control group. However, when compared with the ALI group, the TLR4 and NF‐κB mRNA and their protein expressions were lower in the ALI + NF‐κB inhibitor group. TLRs have been reported to have the ability to detect the molecular patterns of viruses, bacteria at the plasma membrane, and the lower expressions of TLR4 that are present in the bronchial epithelial cells and amniotic epithelial cells, while being highly expressed during an inflammatory cell response to viral infections.28 Previous reports have gone on to suggest that the increased levels of TLR4 can be correlated along with the exacerbation of ALI caused by viral infections and acid damage models.29 Wang et al also did well to demonstrate the expression of NF‐κB significantly increasing in the ALI mice.23 Another study had also reported that the activation of NF‐κB in ARDS would lead to the increase in the number of inflammatory cytokines, including certain adhesion molecules, such as CD11b/CD18 and ICAM1‐in ARDS.30 NF‐κB inhibitors, which are known to regulate the NF‐κB activation stabilized by protease inhibitors, could also induce apoptosis in the human leukemia cells.31 A previous study has done well to demonstrate that the NF‐κB inhibitor can suppress colon cancer cell invasion through the inhibition of NF‐κB.32 Furthermore, our study demonstrated thoroughly that the NF‐κB inhibitor suppressed the expressions of TLR4 and NF‐κB in the serum. TLR4 abrogation along with the inhibition of the NF‐κB signaling pathways has shown potential in hindering the LPS‐induced inflammation.33 Most importantly, is the inhibition of inflammatory response and oxidative stress along with the suppression of TLR4‐mediated NF‐κB activation could potentially result in LPS‐induced ALI.34 All together, we came to a conclusion that inhibiting of the NF‐κB/TLR4 signaling pathway could alleviate ALI.
Additionally, NF‐κB inhibitor was suggested to increase levels of SOD, MPO, and GSH, and decrease expression of MDA and ROS. ROS etiology is known to stem from multiple conditions, those of which include inflammatory cells, carcinogenic chemicals, their metabolites, and the electron transport chain found in the mitochondria.35 In these inflammatory cells, ROS may cause multiple mutations and generate either mutant stem cells or cancer stem cells, leading to carcinogenesis.36 Different malignant cells of different cancer, for example, hepatoma cells, express heterogeneity in oxidative stress, directly correlated with the SOD level, and due to the sensitivity of cancer cells to oxidative stress, modulation of SOD has been used as a mechanism to kill cancer cells.37 In addition, we found that the expressions of TLR4 and NF‐κB were negatively correlated along with the levels of SOD, MPO, and GSH, while positively correlating with levels of MDA and ROS. Anti‐inflammatory activity was also reported to be linked to antioxidative activity in that ROS enhances the inflammation through the activation of NF‐κB transcription factors, with the ROS and redox pathways also found to potentially modulate the NF‐κB signaling pathway.38, 39 The repression of TLR4 and NF‐κB p65 could effectively suppress oxidative stress via suppression of MPO and MDA contents. Therefore, the upregulation of the SOD and GSH activities could thoroughly relieve ALI.40 Based on the aforementioned results, we came to the conclusion that the inhibition of NF‐κB/TLR4 signaling pathway could suppress oxidative stress, and in doing so, alleviate ALI.
5. CONCLUSION
Taken together, the inhibition of TLR4/NF‐κB signaling pathway was found to suppress the oxidative stress, and as a result, ALI could be alleviated, proving its potential as a new course of treatment of ALI. However, as there are multiple factors that could potentially affect the NF‐κB signaling pathway, further studies will be necessary in order to confirm the effect of TLR4/NF‐κB signaling pathway on ALI, as well as on ARDS.
CONFLICT OF INTEREST
The authors have no conflict of interest to report.
ACKNOWLEDGMENTS
We would like to give our sincere appreciate to the reviewers for their helpful comments.
Zhang Z‐M, Wang Y‐C, Chen L, Li Z. Protective effects of the suppressed NF‐κB/TLR4 signaling pathway on oxidative stress of lung tissue in rat with acute lung injury. Kaohsiung J Med Sci. 2019;35:265–276. 10.1002/kjm2.12065
REFERENCES
- 1. Wang W, Scharfstein D, Wang C, Daniels M, Needham D, Brower R, et al. Estimating the causal effect of low tidal volume ventilation on survival in patients with acute lung injury. J R Stat Soc Ser C Appl Stat. 2011;60:475–496. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Lv H, Yu Z, Zheng Y, Wang L, Qin X, Cheng G, et al. Isovitexin exerts anti‐inflammatory and anti‐oxidant activities on lipopolysaccharide‐induced acute lung injury by inhibiting MAPK and NF‐kappaB and activating HO‐1/Nrf2 pathways. Int J Biol Sci. 2016;12:72–86. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3. Yu J, Wang Y, Li Z, Dong S, Wang D, Gong L, et al. Effect of Heme Oxygenase‐1 on Mitofusin‐1 protein in LPS‐induced ALI/ARDS in rats. Sci Rep. 2016;6:36530. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Sunil VR, Vayas KN, Cervelli JA, Malaviya R, Hall L, Massa CB, et al. Pentoxifylline attenuates nitrogen mustard‐induced acute lung injury, oxidative stress and inflammation. Exp Mol Pathol. 2014;97:89–98. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5. Dushianthan A, Grocott MP, Postle AD, Cusack R. Acute respiratory distress syndrome and acute lung injury. Postgrad Med J. 2011;87:612–622. [DOI] [PubMed] [Google Scholar]
- 6. Ionescu L, Byrne RN, van Haaften T, Vadivel A, Alphonse RS, Rey‐Parra GJ, et al. Stem cell conditioned medium improves acute lung injury in mice: in vivo evidence for stem cell paracrine action. Am J Physiol Lung Cell Mol Physiol. 2012;303:L967–L977. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Koulouras V, Papathanakos G, Papathanasiou A, Nakos G. Efficacy of prone position in acute respiratory distress syndrome patients: A pathophysiology‐based review. World J Crit Care Med. 2016;5:121–136. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Wang G, Han D, Zhang Y, Xie X, Wu Y, Li S, et al. A novel hypothesis: Up‐regulation of HO‐1 by activation of PPARgamma inhibits HMGB1‐RAGE signaling pathway and ameliorates the development of ALI/ARDS. J Thorac Dis. 2013;5:706–710. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Cho YJ, Moon JY, Shin ES, Kim JH, Jung H, Park SY, et al. Clinical practice guideline of acute respiratory distress syndrome. Tuberc Respir Dis. 2016;79:214–233. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10. Tseng TL, Chen MF, Tsai MJ, Hsu YH, Chen CP, Lee TJ. Oroxylin‐A rescues LPS‐induced acute lung injury via regulation of NF‐kappaB signaling pathway in rodents. PLoS One. 2012;7:e47403. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Wu Y, Liu Y, Huang H, Zhu Y, Zhang Y, Lu F, et al. Dexmedetomidine inhibits inflammatory reaction in lung tissues of septic rats by suppressing TLR4/NF‐kappaB pathway. Mediators Inflamm. 2013;2013:562154. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12. Ni H, Jin W, Zhu T, Wang J, Yuan B, Jiang J, et al. Curcumin modulates TLR4/NF‐kappaB inflammatory signaling pathway following traumatic spinal cord injury in rats. J Spinal Cord Med. 2015;38:199–206. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Wu J, Li L, Sun Y, Huang S, Tang J, Yu P, et al. Altered molecular expression of the TLR4/NF‐kappaB signaling pathway in mammary tissue of Chinese Holstein cattle with mastitis. PLoS One. 2015;10:e0118458. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Wang PP, Xie DY, Liang XJ, Peng L, Zhang GL, Ye YN, et al. HGF and direct mesenchymal stem cells contact synergize to inhibit hepatic stellate cells activation through TLR4/NF‐kB pathway. PLoS One. 2012;7:e43408. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Zhou L, Qi L, Jiang L, Zhou P, Ma J, Xu X, et al. Antitumor activity of gemcitabine can be potentiated in pancreatic cancer through modulation of TLR4/NF‐kappaB signaling by 6‐shogaol. AAPS J. 2014;16:246–257. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16. Wang L, Liu XH, Chen H, Chen ZY, Weng XD, Qiu T, et al. Picroside II protects rat kidney against ischemia/reperfusion‐induced oxidative stress and inflammation by the TLR4/NF‐kappaB pathway. Exp Ther Med. 2015;9:1253–1258. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Xie C, Liu D, Chen Q, Yang C, Wang B, Wu H. Soluble B7‐H3 promotes the invasion and metastasis of pancreatic carcinoma cells through the TLR4/NF‐kappaB pathway. Sci Rep. 2016;6:27528. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18. Wang Z, Zuo G, Shi XY, Zhang J, Fang Q, Chen G. Progesterone administration modulates cortical TLR4/NF‐kappaB signaling pathway after subarachnoid hemorrhage in male rats. Mediators Inflamm. 2011;2011:848309. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Wang CP, Li JL, Zhang LZ, Zhang XC, Yu S, Liang XM, et al. Isoquercetin protects cortical neurons from oxygen‐glucose deprivation‐reperfusion induced injury via suppression of TLR4‐NF‐small ka, CyrillicB signal pathway. Neurochem Int. 2013;63:741–749. [DOI] [PubMed] [Google Scholar]
- 20. Li Y, Zeng Z, Cao Y, Liu Y, Ping F, Liang M, et al. Angiotensin‐converting enzyme 2 prevents lipopolysaccharide‐induced rat acute lung injury via suppressing the ERK1/2 and NF‐kappaB signaling pathways. Sci Rep. 2016;6:27911. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Lang S, Li L, Wang X, Sun J, Xue X, Xiao Y, et al. CXCL10/IP‐10 neutralization can ameliorate lipopolysaccharide‐induced acute respiratory distress syndrome in rats. PLoS One. 2017;12:e0169100. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Umbrello M, Formenti P, Bolgiaghi L, Chiumello D. Current concepts of ARDS: A narrative review. Int J Mol Sci. 2016;18. pii: E64. 10.3390/ijms18010064. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Wang H, Xu L, Zhao J, Wang D, Guo R, Wang J, et al. Regulatory mechanism of pyrrolidine dithiocarbamate is mediated by nuclear factor‐kappaB and inhibits neutrophil accumulation in ARDS mice. Exp Ther Med. 2014;8:614–622. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Guo YX, Wang ZN, Li YT, Pan L, Yang LF, Hu Y, et al. High‐frequency oscillatory ventilation is an effective treatment for severe pediatric acute respiratory distress syndrome with refractory hypoxemia. Ther Clin Risk Manag. 2016;12:1563–1571. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25. de Azevedo‐Quintanilha IG, Vieira‐de‐Abreu A, Ferreira AC, Nascimento DO, Siqueira AM, Campbell RA, et al. Integrin αDβ2 (CD11d/CD18) mediates experimental malaria‐associated acute respiratory distress syndrome (MA‐ARDS). Malar J. 2016;15:393. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Everhart MB, Han W, Sherrill TP, Arutiunov M, Polosukhin VV, Burke JR, et al. Duration and intensity of NF‐kappaB activity determine the severity of endotoxin‐induced acute lung injury. J Immunol. 2006;176:4995–5005. [DOI] [PubMed] [Google Scholar]
- 27. Wang J, Liu YT, Xiao L, Zhu L, Wang Q, Yan T. Anti‐inflammatory effects of apigenin in lipopolysaccharide‐induced inflammatory in acute lung injury by suppressing COX‐2 and NF‐kB pathway. Inflammation. 2014;37:2085–2090. [DOI] [PubMed] [Google Scholar]
- 28. Totura AL, Whitmore A, Agnihothram S, Schafer A, Katze MG, Heise MT, et al. Toll‐like receptor 3 signaling via TRIF contributes to a protective innate immune response to severe acute respiratory syndrome coronavirus infection. MBio. 2015;6:e00638–e00615. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29. Imai Y, Kuba K, Neely GG, Yaghubian‐Malhami R, Perkmann T, van Loo G, et al. Identification of oxidative stress and Toll‐like receptor 4 signaling as a key pathway of acute lung injury. Cell. 2008;133:235–249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30. Wang H, Zhao J, Xue G, Wang J, Wu J, Wang D, et al. Regulatory effect of cytokine‐induced neutrophil chemoattractant, epithelial neutrophil‐activating peptide 78 and pyrrolidine dithiocarbamate on pulmonary neutrophil aggregation mediated by nuclear factor‐kappaB in lipopolysaccharide‐induced acute respiratory distress syndrome mice. Exp Ther Med. 2016;12:1785–1794. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31. Zhou M, Gu L, Zhu N, Woods WG, Findley HW. Transfection of a dominant‐negative mutant NF‐kB inhibitor (IkBm) represses p53‐dependent apoptosis in acute lymphoblastic leukemia cells: Interaction of IkBm and p53. Oncogene. 2003;22:8137–8144. [DOI] [PubMed] [Google Scholar]
- 32. Tong W, Wang Q, Sun D, Suo J. Curcumin suppresses colon cancer cell invasion via AMPK‐induced inhibition of NF‐kappaB, uPA activator and MMP9. Oncol Lett. 2016;12:4139–4146. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 33. Lai JL, Liu YH, Liu C, Qi MP, Liu RN, Zhu XF, et al. Indirubin inhibits LPS‐induced inflammation via TLR4 abrogation mediated by the NF‐kB and MAPK signaling pathways. Inflammation. 2017;40:1–12. [DOI] [PubMed] [Google Scholar]
- 34. Zhang X, Sun CY, Zhang YB, Guo HZ, Feng XX, Peng SZ, et al. Kegan Liyan oral liquid ameliorates lipopolysaccharide‐induced acute lung injury through inhibition of TLR4‐mediated NF‐kappaB signaling pathway and MMP‐9 expression. J Ethnopharmacol. 2016;186:91–102. [DOI] [PubMed] [Google Scholar]
- 35. Murata M, Thanan R, Ma N, Kawanishi S. Role of nitrative and oxidative DNA damage in inflammation‐related carcinogenesis. J Biomed Biotechnol. 2012;2012:623019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36. Kawanishi S, Ohnishi S, Ma N, Hiraku Y, Oikawa S, Murata M. Nitrative and oxidative DNA damage in infection‐related carcinogenesis in relation to cancer stem cells. Genes Environ. 2016;38:26. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 37. Shi DY, Xie FZ, Zhai C, Stern JS, Liu Y, Liu SL. The role of cellular oxidative stress in regulating glycolysis energy metabolism in hepatoma cells. Mol Cancer. 2009;8:32. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 38. Tanaka S, Nishiumi S, Nishida M, Mizushina Y, Kobayashi K, Masuda A, et al. Vitamin K3 attenuates lipopolysaccharide‐induced acute lung injury through inhibition of nuclear factor‐kappaB activation. Clin Exp Immunol. 2010;160:283–292. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 39. Rahman I, Biswas SK, Kirkham PA. Regulation of inflammation and redox signaling by dietary polyphenols. Biochem Pharmacol. 2006;72:1439–1452. [DOI] [PubMed] [Google Scholar]
- 40. Xu LQ, Yu XT, Gui SH, Xie JH, Wang XF, Su ZQ, et al. Protective effects of Li‐Fei‐Xiao‐Yan prescription on lipopolysaccharide‐induced acute lung injury via inhibition of oxidative stress and the TLR4/NF‐kappaB pathway. Evid Based Complement Alternat Med. 2017;2017:1791789. [DOI] [PMC free article] [PubMed] [Google Scholar]
