Abstract
Chemokine‐like factor (CKLF)‐like, MAL and related proteins for vesicle trafficking and membrane link (MARVEL) transmembrane domain‐containing family proteins (CMTMs) have significant roles in the immune system, in male reproduction, as well as in tumorigenesis. Previous studies have shown that CMTM family member 7 (CMTM7) was broadly expressed in various normal tissues, but not in lung, gastric, esophageal, pancreas, and cervix cancers. To explore its relationship with liver cancer, we examined the expression of CMTM7 in liver cancers and its correlation with clinical and pathological conditions. We found that CMTM7 expression was markedly reduced in liver cancer tissues, and negatively correlated with TNM staging and tumor metastasis. In vitro studies showed that enforced expression of CMTM7 inhibited the cell growth and migration of liver cancer cells. Further analysis revealed that CMTM7 suppressed AKT signaling and induced cell cycle arrest at the G0/G1 phase in the liver cancer cells, likely as the consequent of decreased levels of cyclin D1, cyclin‐dependent kinase 4 (CDK4), and CDK6, and increased p27 expression. Thus, CMTM7 functions as a tumor suppressor in liver cancer through suppressing cell cycle progression.
Keywords: cell cycle, cell growth, CMTM7, liver cancer, migration
1. INTRODUCTION
Liver cancer is the sixth most common malignancy and the third most frequent cause of cancer mortality worldwide.1 Over the last three decades, the incidence of patients with liver cancer patients has risen from 1.6 to 4.6 per 100 000 individuals throughout the world.2 Molecular‐targeted therapies may provide an effective means of liver cancer treatment. Therefore, exploring the mechanisms of liver cancer initiation and development will be likely to provide valuable insights with respect to liver cancer treatment.
The chemokine‐like factor (CKLF)‐like, MAL and related proteins for vesicle trafficking and membrane link (MARVEL) transmembrane domain‐containing family (CMTM) comprises nine members, including CKLF and CMTM1 to CMTM8. It is a family of proteins that connects classical chemokines with the transmembrane‐4 superfamily. Previous studies have demonstrated that the CMTM family is closely associated with immune diseases, hematological diseases and cardiovascular diseases. CMTM family member 7 (CMTM7) is crucial for B‐cell antigen receptors (BCR)‐induced adaptor protein B cell linker (BLNK) interaction, and is also important for the activation of downstream signaling pathways to extracellular signal‐regulated kinase (ERK) and c‐Jun N‐terminal kinase.3 CMTM7 is specifically involved in BCR expression and the survival of B‐1a cells, which are considered to be the major source of natural antibodies in normal unimmunized mice.4 Recently, a growing number of studies have demonstrated that the CMTM family serves important roles in the different stages of tumor progression.5, 6, 7, 8, 9 CMTM7 is broadly expressed in normal tissues and epithelial cell lines, but is frequently silenced or downregulated in certain cancer cell lines and primary tumor tissues. Liu et al. discovered that CMTM7 was frequently silenced by promoter methylation in several types of human carcinoma.5 The loss of CMTM7 in non‐small cell lung cancer (NSCLC) served to sustain aberrant epidermal growth factor receptor (EGFR)‐mediated oncogenic signaling.5 Furthermore, knockdown of CMTM7 induced EGFR‐AKT signaling and increased the tumorigenicity of human NSCLC cells by reducing Rab5 activation.10
In this study, the expression, function, and mechanism of CMTM7 in liver cancer was investigated. CMTM7 was found to be markedly downregulated in liver cancer primary tumor tissues and cell lines. Overexpression of CMTM7 inhibited the cell growth and migration of liver cancer cells by suppressing EGFR/AKT signaling. Taken together, these results demonstrated that CMTM7 acts as a novel tumor suppressor in liver cancer, and that it may therefore be a putative target for liver cancer therapy in clinic.
2. METHODS
2.1. Cell lines and tumor tissues
Experiments were performed using one immortalized but non‐transformed hepatocyte (QSG‐7701), three hepatocellular carcinoma (HCC) cell lines (Hep3B/ SK‐HEP‐1/ Huh7) and a hepatoblastoma cell line HepG2, which was originally considered to be an HCC cell line.11 Hep3B, SK‐HEP‐1, and QSG‐7701 were purchased from the Cell Bank of the Shanghai Institutes for Biological Sciences (Shanghai, China). HepG2 and Huh7 cell lines were obtained from the Suzhou Institute of Systems Medicine (Suzhou, China). All the cells were cultured in Dulbecco's high‐glucose modified Eagle's medium (DMEM) (HyClone; now a brand of GE Healthcare, Chicago, Illinois) containing 10% fetal bovine serum (Gibco, Thermo Fisher Scientific, Inc., Waltham, Massachusetts), 100 μg/mL of penicillin, and 100 units/mL of streptomycin (Beyotime Institute of Biotechnology, Guangdong, China) in 5% CO2 at 37°C. Primary tumor tissues and paired nontumor tissue samples were obtained from Huashan Hospital (Shanghai, China). All patients were treatment‐naïve prior to surgery. Written informed consent has been obtained from each subject, and that the study methodologies have been approved by the ethics committee of the First Affiliated Hospital of Soochow University. Information associated with the patients, and their disease characteristics are shown in Table 1.
Table 1.
Fifty‐two pairs of liver cancer patients and disease characteristics
| CMTM7 IHC score | P a | R | ||
|---|---|---|---|---|
| 0–7 | 8‐12 | |||
| Cases | 30 | 22 | … | … |
| Gender | … | … | 0.483 | … |
| Male | 22 | 17 | … | … |
| Female | 8 | 5 | … | … |
| Mean age (years) | 55.6 ± 8.22 | 53.5 ± 6.44 | 0.389 | … |
| Liver cirrhosis | … | … | 0.552 | … |
| Yes | 21 | 16 | … | … |
| No | 9 | 6 | … | … |
| HBsAg | … | … | 0.746 | … |
| (+) | 23 | 16 | … | … |
| (−) | 7 | 6 | … | … |
| Vascular invasion | … | … | 0.088b | … |
| Yes | 15 | 5 | … | … |
| No | 15 | 17 | … | … |
| Mestastasis | … | … | 0.0618c | … |
| Yes | 8 | 1 | … | … |
| No | 22 | 21 | … | … |
| TNM stage | … | … | 0.001112b | −0.771 |
| (AJCC/TNM)d | … | … | … | … |
| I‐II | 7 | 16 | … | … |
| III‐IV | 23 | 6 | … | … |
P‐value was calculated by using the χ2 analysis based on CMTM7 score and characteristics of patients in each group.
P‐value was calculated by using the χ2 with Yates correction.
P‐value was calculated by the Fisher exact test.
AJCC cancer staging manual. 8th ed. New York: Springer. 2017.
2.2. Quantitative reverse transcription polymerase chain reaction
The culture medium was removed, and the cells were immediately washed with ice‐cold PBS. Subsequently, 1 mL TRIzol reagent (Thermo Fisher Scientific, Inc.) was added, and total cellular RNA was extracted using the acid guanidinium thiocyanate‐phenol‐chloroform method. Total RNA (1 μg) was used as a template for a Moloney murine leukemia virus reverse transcriptase reaction, which was performed according to the manufacturer's protocol (cat. no. RR047A; Takara Biotechnology Co., Ltd., Dalian, China). Real‐time quantitative reactions were set up in triplicate in a 96‐well plate, and each reaction contained 1 μL of cDNA and the SYBR Green PCR Master mix (Thermo Fisher Scientific, Inc., Waltham, MA, USA), to which gene‐specific forward and reverse PCR primers were added. Melting curves were analyzed to verify the specificity of the quantitative reverse transcription polymerase chain reaction (RT‐qPCR) reaction and to ensure the absence of any primer dimer formation. The following primers were used: CMTM7 sense: 5′‐ TGGTCACCATTTGCGACTTG‐3′, antisense: 5′‐ AGAGGAAGGTGGCCATGAAA ‐3′; and GAPDH sense: 5′‐ GCACCGTCAGGCTGAGAAC‐3′, antisense: 5′‐AT GGTGGTGAAGACGCCAGT‐3′. The thermocycling conditions were as follows: Initial denaturation at 94°C for 3 minutes, followed by 40 cycles of each 5 seconds at 94°C and 30 seconds at 60°C. Samples were run in triplicate. All samples were normalized against GAPDH using the 2‐ΔΔCT method.12
2.3. Protein extraction and western blot analysis
Following culture, the cells were immediately placed on ice and washed with ice‐cold PBS. Total protein extracts were prepared using an appropriate amount of RIPA lysis buffer (Beyotime Institute of Biotechnology) containing 1X protease inhibitor mixture (Roche Diagnostics, Basel, Switzerland) and 1X phenylmethyl sulfonyl fluoride. The protein concentrations were determined using a BCA protein assay (cat. no. 0032‐100G; Ameresco, Inc., Framingham, Massachusetts). The protein samples were fractionated using SDS‐PAGE (7%‐12% gels) and transferred by electroblotting onto polyvinylidene difluoride membranes (Beyotime Institute of Biotechnology). The membranes were blocked with 5% non‐fat dry milk in Tris‐buffered saline/Tween‐20 for 1 hour. Proteins of interest were detected using specific antibodies. The following antibodies were used for immunoblotting (IB): Anti‐CMTM7 (purchased from Absin, Shanghai, China), anti‐phosphorylated (p)‐AKT, anti‐AKT, anti‐p‐ERK, anti‐ERK, anti‐cyclin D1, anti‐cyclin‐dependent kinase 4 (anti‐CDK4), anti‐CDK6, anti‐p‐EGFR, anti‐EGFR and anti‐α‐Tubulin, which were purchased from Santa Cruz, Biotechnology, Inc., Dallas, Texas. Anti‐E‐cadherin and anti‐N‐cadherin antibodies were purchased from Cell Signaling Technology, Inc. (Danvers, Massachusetts). Blots were scanned using the Bio‐Rad ChemiDoc Imaging system (Bio‐Rad ChemiDoc MP; Bio‐Rad Laboratories, Inc., Hercules, Carolina). Proteins were quantitatively analyzed using Image J software.
2.4. Immunohistochemistry
Preparation of formalin‐fixed and paraffin‐embedded tumor tissues, and the sectioning of tissues, were performed for immunohistochemistry analyses as previously described.12 Images were captured using a Nikon Eclipse inverted microscope. The fraction of the immunostained cells was recorded, and the staining intensity (SI) was subsequently categorized as follows: 0, negative; 1, weak; 2, moderate; and 3, strong. The percentage of positively stained cells (PP) was defined as follows: 0, <5%; 1, 5% to 25%; 2, 26% to 50%; 3, 51% to 75%; and 4, >75%. Five high‐power fields (×100 magnification) were randomly selected in each section, and no fewer than 1000 tumor cells were observed. The final score of each section was calculated by multiplying the staining intensity number with the percentage of positively stained cells number. Total scores of 0 to 7 were considered to be low immunohistochemical (IHC) score, whereas scores of 8 to 12 were considered to be high IHC score.
2.5. Immunofluorescence staining
Immunofluorescence staining was performed using cultured cells. Following fixation and permeabilization, the cells were incubated with primary antibodies at 4°C overnight, followed by the appropriate Alexa Fluor 488‐conjuated secondary antibodies. The cells were visualized using confocal microscopy (Leica Microsystems GmbH, Mannheim, Germany).
2.6. Plasmid construction and gene transfection
The human CMTM7 gene was generated and cloned into a pcDNA3.1 vector with a Flag tag. The full length of the CMTM7 gene was amplified using PCR, and the PCR product and the vector were digested using the restriction enzymes BamH1 and Xho1 at 37°C for 3 hours separately. The enzymatic products were segregated, isolated and purified. Subsequently, the PCR products were ligated with vector using T4 DNA ligase (Takara Biotechnology Co., Ltd.) at a ratio of 3:1 at 16°C overnight. The recombinant plasmids were then transformed into DH5α cells, and the cell mixture was smeared onto the surface of LB culture dishes for incubation overnight. The selected single clones were amplified in LB culture containing ampicillin, and the plasmids were finally extracted using a TIANprep Mini Plasmid kit (Tiangen Biotech Co., Ltd., Beijing, China) for verification by Genewiz, Inc. (Suzhou, Jiangsu, China).
Plasmids were transiently transfected into liver cancer cells using Lipofectamine 2000 (Invitrogen; Thermo Fisher Scientific, Inc.) according to the manufacturer's protocol.
2.7. Cell growth and viability
Cells transfected with empty vector or CMTM7 plasmids were harvested and plated in 96‐well plates at a density of 2000 per well and then incubated for 0, 24, 48, or 72 hours. Each well was added 1/10 μL volume of CCK‐8 (Bimake, Houston, Texas). After incubating for 2 hours, the absorbance of each well was measured at 450 nm using SpectraMax i3x as previously described.13
2.8. Wound‐healing assay
Cells infected with CMTM7 or empty vector were cultured until confluent; the cell layers were then carefully scratched using sterile tips. After incubation for 0, 24, or 48 hours, the cells were photographed under a phase contrast microscope.
2.9. Transwell assay
Transwell assay was performed in a 24‐well chemotaxis chamber (8 μm, 24‐well format; NUNC, Denmark). The transfected cells (3 × 105 cells/ml) were resuspended with serum‐free DMEM medium and added to the upper part of the chamber. Six hundred microliters of DMEM containing 20 μg/ ml human EGF (Peprotech, Rockville, New Jersey) was added to the bottom well of the chamber. After incubation for 48 hours, scraped off the nonmigrating cells in the upper chamber, cells at the bottom part of the filter were washed, fixed with 4% paraformaldehyde and stained with 0.5% crystal violet. The basement membrane of the chamber was taken out and put in the microscope, cell number was calculated.
2.10. Cell cycle analysis
SK‐Hep‐1 Cell lines were cultured with serum‐free DMEM for 24 hours for the purpose of synchronization. Cells were harvested by trypsinization and washed twice with pre‐cooling PBS and fixed in 75% ethanol at −20°C overnight. Resuspended the cells with PBST and centrifuge the cells for depuration, incubated with 1 mg/mL of PI/RNase Staining Buffer (BD Pharmingen, San diego, California) for 30 minutes in the dark. Cell cycle was analyzed by the flow cytometry Attune NxT (Thermo Fisher Scientific, Inc., Waltham, MA, USA).
2.11. Statistical analysis
Statistical analysis was carried out using Statistical Package for Social Sciences 13.0 for Windows (SPSS Inc., Chicago, Illinois). The association of CMTM7 expression in liver cancer tissues with the clinicopathologic characteristics was evaluated using the Chi square (χ2) analysis. Values are expressed as means ± SD when necessary. ANOVA was used when making comparisons in data sets containing multiple groups. Differences were considered significant when P < 0.05.
3. RESULTS
3.1. CMTM7 is downregulated in liver cancer
To evaluate the expression levels of CMTM7 in liver cancer, 52 pairs of liver cancer tumor tissues and their paired non‐tumor tissue samples at the surgical margins were collected. As shown in Figure 1A, CMTM7 was downregulated in 42 of the 52 (80.77%) tumor tissues, as detected by RT‐qPCR. The amplification products of RT‐qPCR were electrophoresed in a 1.5% agarose gel to ensure the correct amplification (Figure 1B). CMTM7 protein expression levels were subsequently analyzed in representative samples by western blotting and immunohistochemistry. Consistently with the mRNA expression results, CMTM7 was downregulated in liver cancer tissues compared with the non‐tumor samples removed from the surgical margins (Figure 1C,D). Furthermore, the western blotting and RT‐qPCR results indicated that CMTM7 was downregulated in liver cancer cell lines compared with the immortalized but non‐transformed hepatocytes (Figure 1E,F). Taken together, these results demonstrated that CMTM7 was downregulated in liver cancer.
Figure 1.
CMTM7 is downregulated in human liver cancer cells and tissues. A, CMTM7 was downregulated in most liver cancer tissues. Fifty‐two pairs of liver cancer tissues were collected and prepared for qPCR against CMTM7. T, tumour; N, adjacent non‐tumour normal tissue. * P < 0.05; ** P < 0.01. B, The amplification products of RT‐PCR were electrophoresed to indicate correct amplification. α‐tubulin was used as an internal standard. C, The representative pairs of liver cancer tissues were prepared for western blot CMTM7 and α‐tubulin. D, Representative fields of human liver cancer tissues by immunohistochemical staining using an anti‐CMTM7 antibody. SI, staining intensity; PP, percentage of positively stained cells. E and F, CMTM7 was downregulated in liver cancer cell lines. The expression levels of CMTM7 in liver cancer cell lines was detected by western blot and qRT‐PCR
3.2. CMTM7 is correlated with liver cancer malignancy and distant neoplasm metastasis
Fifty‐two pairs of histological paraffin‐embedded specimens were used for CMTM7 immunohistochemical analyses. Patients and disease characteristics are presented in Table 1. Among the 52 pairs of liver cancer tissues, CMTM7 was detected in the majority of the sections. Thirty cases were scored as 0 to 7 (low IHC score), and 22 cases were scored as 8 to 12 (high IHC score). No significant differences were observed associated with the characteristics of gender, age, liver cirrhosis, HBsAg, vascular invasion and mestastasis. However, Spearman correlation analysis revealed that the correlations between CMTM7 IHC score and liver cancer tumor‐lymph node‐metastasis (TNM) staging were negative (r = −0.771; P < 0.001) (Table 1). Poor TNM stages were associated with low IHC scores (P = 0.001112).
3.3. CMTM7 inhibits liver cancer cell growth
To detect the effect of CMTM7 on the cell growth of liver cancer cells, a CMTM7 plasmid with a Flag tag was constructed. Western blot and RT‐qPCR analyses revealed that CMTM7 was expressed at a progressively higher level in liver cancer cells when the cells were transfected with an increasing concentration of the CMTM7 plasmid (Figure 2A,B). To further elucidate the subcellular localization of CMTM7 in SK‐HEP‐1 cells, confocal microscopy was performed. As shown in Figure 2C, CMTM7 was expressed in the cytoplasm and the nucleus of the liver cancer cells. To examine the effect of CMTM7 on the cell growth of liver cancer, a cell counting kit‐8 (CCK‐8) assay was performed at the indicated time points. The results suggested that overexpression of CMTM7 inhibited liver cancer cell growth (Figure 2D).
Figure 2.
CMTM7 inhibits liver cancer cell growth. A and B, The expression of flag‐CMTM7 plasmids in liver cancer cells. Empty vector or CMTM7 plasmids were transfected into SK‐hep‐1 cells for 48 hours, followed by western blot and qRT‐PCR analysis. C, CMTM7 was expressed in the cytoplasm and the nucleus of liver cancer cells. Empty vector (control) or CMTM7 plasmids (CMTM7‐OE) were transfected into SK‐hep‐1 cells for 48 hours, followed by confocal microscopy analysis by using DAPI and an anti‐CMTM7 antibody. D, CMTM7 inhibited cell growth in liver cancer cells. Empty vector (control) or different concentrations of CMTM7 plasmids were transfected into SK‐hep‐1 cells, followed by CCK‐8 assay at 0, 24, 48, or 72 hours. ** P < 0.01; *** P < 0.001
3.4. Overexpression of CMTM7 inhibits liver cancer cell migration
To explore the effect of CMTM7 on liver cancer migration, wound‐healing assays were performed. As shown in Figure 3A‐C, the results demonstrated that CMTM7 overexpression led to a marked inhibition of tumor cell migration in liver cancer cells. To further confirm the migration‐suppressive ability of CMTM7, transwell assays were performed to detect the migration of SK‐HEP‐1 cells. The results revealed that CMTM7 overexpression reduced the migration of liver cancer cells in a dose‐dependent manner (Figure 3D,E). In addition, the effect of CMTM7 on the expression levels of epithelial‐mesenchymal transition (EMT)‐associated markers was investigated. When liver cancer cells were overexpressed with CMTM7, the expression of the epithelial marker, E‐cadherin, was increased at the protein level, whereas that of the mesenchymal marker, N‐cadherin, was decreased (Figure 3F).
Figure 3.
Overexpression of CMTM7 inhibits liver cancer cell migration. A, The expression of flag‐CMTM7 plasmids in liver cancer cells. Empty vector or CMTM7 plasmids were transfected into SK‐hep‐1 cells for 48 hours, followed by western blot against flag. α‐tubulin was used as an internal control. B and C, CMTM7 led to a marked inhibition of cell migration in liver cancer cells. Empty vector (control) or different concentrations of CMTM7 plasmids were transfected into SK‐hep‐1 cells, followed by wound‐healing assay. Representative of images were photographed at 0, 24, or 48 hours after scratching. *** P < 0.001. The relative migration rate was calculated by dividing the change in the distance between the scratch edges by the initial distance. D & E. CMTM7 reduced the migration of liver cancer cells by transwell assay. Empty vector (control) or different concentrations of CMTM7 plasmids were transfected into SK‐hep‐1 cells, followed by transwell assay as described in the materials and methods. * P < 0.05. F. CMTM7 regulates the protein levels of EMT‐associated markers in liver cancer cells. Empty vector or CMTM7 plasmids were transfected into SK‐hep‐1 cells for 48 hours, and then cells were prepared for western blot against E‐cadherin and N‐cadherin. α‐tubulin was used as an internal control
3.5. Overexpression of CMTM7 inhibits cell cycle progression by suppressing EGFR/AKT signaling in liver cancer cells
To explore the molecular mechanisms of CMTM7 on the inhibition of liver cancer cell growth, the cell cycle was analyzed using flow cytometric analysis. As shown in Figure 4A, overexpression of CMTM7 markedly increased the percentage of cells in the G0/G1 phase. Specifically, the percentage of G0/G1 cells was increased from 71% in the control group to 78.6% in the CMTM7‐overexpressed group, along with a decrease in cells in the G2/M phase from 24.8% to 17.2% (Figure 4A,B). These results suggested CMTM7 could induce G0/G1 arrest of the cell cycle. The G1‐to‐S phase progression is regulated by cyclin D1 and its partner kinases, CDK4 and CDK6. To investigate whether CMTM7‐induced cell cycle arrest was associated with cyclin D1, CDK4 and CDK6, the expression levels of these proteins were examined. As shown in Figure 4C, the levels of cyclin D1, CDK4, and CDK6 were clearly decreased in the CMTM7‐overexpressed cells. The protein expression level of p27, which is a potent CDK inhibitor, was also investigated. p27 protein binds to and inhibits the activity of cyclin D‐CDK4/6 complexes, and therefore it functions as a regulator of the cell cycle at the G1/S phase. The results of the present study revealed that the expression level of p27 was increased in CMTM7‐overexpressed cells (Figure 4C). Taken together, these results demonstrated that CMTM7 induced cell cycle arrest at the G0/G1 phase via inhibiting CDK‐mediated signaling in liver cancer cells.
Figure 4.
Overexpression of CMTM7 inhibits cell cycle progression and EGFR/AKT signaling in liver cancer cells. A, CMTM7 arrested cell cycle at G0/G1 phase in liver cancer cells. Empty vector (control) or different concentrations of CMTM7 plasmids were transfected into SK‐hep‐1 cells for 48 hours, followed by flow cytometry. B, Summary of cell proportions in different phases of cell cycle. The results were expressed as mean ± SD. * P < 0.05; ** P < 0.01. C, CMTM7 regulated the expression of cell cycle‐associated proteins. Empty vector or CMTM7 plasmids were transfected into SK‐hep‐1 cells for 48 hours, followed by western blot against cyclin D1, CDK4, CDK6, and p27. α‐tubulin was used as an internal control. D, CMTM7 inhibited EGFR/AKT signaling in liver cancer cells. Empty vector or CMTM7 plasmids were transfected into SK‐hep‐1 cells for 48 hours, followed by western blot against flag, p‐EGFR, EGFR, p‐AKT, AKT, p‐ERK, and ERK. α‐tubulin was used as an internal control
CMTM7 contains one YXXΦ motif, which is associated with EGFR and regulates EGFR internalization. EGFR has important roles in cell differentiation, proliferation, and maintenance. To further evaluate the association between CMTM7 and EGFR, the p‐EGFR expression level in SK‐HEP‐1 cells was detected by western bolt analysis. The protein expression level of p‐EGFR was shown to be markedly lower in CMTM7‐overexpressed cells (Figure 4D). The Ras/Raf/mitogen‐activated protein kinase (MEK)/ERK and phosphoinositide 3‐kinase (PI3K)/AKT signaling pathways are two major downstream pathways initiated by the activation of EGFR, which has been demonstrated to promote cell proliferation. To examine whether AKT and ERK signaling participated in the regulation of cell migration regulated by CMTM7, the phosphorylation and total levels of AKT and ERK were examined. Notably, overexpression of CMTM7 completely inhibited AKT activation, whereas no marked differences in ERK activation were observed (Figure 4D). These results suggested that overexpression of CMTM7 inhibited EGFR/AKT signaling in liver cancer cells.
4. DISCUSSION
The human gene nomenclature committee (HGNC) recommended denominating CKLFSF1‐8 as “CMTM1‐8” according to their structural features of the protein family members in 2005.14 This family serves major roles in the immune system, male reproductive system and hematopoiesis systems. On the basis of the in‐depth studies in recent years performed by various research groups, a close association between CMTMs and the initiation, development and metastasis of tumors has been demonstrated.15, 16, 17 A number of studies have shown that CMTM 3, 4, 5, and 8 have been extensively studied as tumor suppressors in multiple types of tumor.18, 19, 20, 21 For example, in human renal cell carcinoma (RCC), CMTM5 was significantly downregulated, and overexpression of CMTM5 efficiently suppressed the migration and invasion of RCC cells, and inhibited the cell growth of RCC cells by inducing cell cycle arrest at G0/G1 phase, which were indicated that CMTM5 functioned as a tumor suppressor in RCC cells.18 In gastric cancer, overexpression of CMTM3 suppressed cell proliferation, cell cycle progression and invasion, and promoted cell apoptosis, which also indicated that CMTM3 was a tumor suppressor gene in gastric cancer.22
CMTMs 6, 7, and 8 forms a gene cluster on 3p22, a chromosomal region rich in tumor‐suppressor genes, whereas only CMTM7 has been shown to be downregulated or silenced in several malignancies, but its function and roles were still unknown in liver cancer.5, 10, 23 Several studies have helped to elucidate the mechanisms of CMTM7 as a tumor suppressor, including those performed on EGFR internalization, AKT signaling pathway inhibition, and promoter methylation.5 In agreement with previous studies, the present study revealed that CMTM7 was downregulated in liver cancer, and overexpression of CMTM7 inhibited liver cancer cell growth. Therefore, CMTM7 may be a putative novel prognostic indicator for liver cancer.
EMT has been reported to be a major mechanism by which cancer cells become highly invasive and metastatic. Characteristic changes may be detected during this process, including the loss of E‐cadherin and enhanced cell mobility, as well as the acquisition of N‐cadherin and vimentin.24 In the present study, the migratory capability of the liver cancer cells was shown to be suppressed in CMTM7‐overexpressed cells compared with the control group. In addition, overexpression of CMTM7 increased the expression level of the epithelial marker, E‐cadherin, whereas it led to a decrease in the expression of the mesenchymal marker, N‐cadherin. These results suggested that CMTM7 inhibited the migration of liver cancer cells by suppressing the EMT phenotype.
The G1‐to‐S phase is regulated by cyclins and their activation partners, the CDKs.25 In the present study, overexpression of CMTM7 was shown to downregulate Cyclin D1, CDK4 and CDK6, thereby further suppressing cell cycle initiation and halting DNA synthesis. P27 is another regulator involved with cell cycle progression at the G1 and S phase.26, 27 The results of the present study demonstrated that the protein level of p27 was increased in CMTM7‐overexpressed cells, which led to the further inhibition of cell cycle progression. In addition, AMP‐activated protein kinase (AMPK) has also been reported to be involved in the cell growth of liver cancer cells via regulation of cyclin D1, CDK4, and CDK6.28 However, whether CMTM7 regulates AMPK was not examined in the present study, and these experiments will be performed in our future work.
EGFR is routinely expressed in numerous types of normal cells and serves an important role in cell growth, differentiation and development. CMTM7 contains one YXXΦ motif which is associated with EGFR and regulates EGFR internalization in several different types of epithelial cells.29, 30 The Ras/Raf/mitogen‐activated protein kinase (MEK)/extracellular signal‐regulated kinase (ERK) and phosphatidylinositol 3 kinase (PI3K)/AKT signaling pathways pathway are two major downstream pathways initiated by the activation of EGFR that are associated with cell cycle regulation and are frequently activated in numerous types of tumors.31 In this study, overexpression of CMTM7 was shown to completely inhibited the phosphorylation of AKT, whereas no effects on ERK were observed, thereby suggesting that inhibiting EGFR activation affects the PI3K/AKT downstream target. Taken together, these results suggested that CMTM7 inhibited cell growth and tumorigenesis by suppressing the PI3K/AKT signaling pathway in liver cancer cells.
5. CONCLUSION
In conclusion, very limited studies have thus far been performed with CMTM7 in order to elucidate its underlying molecular functions. This study has led to the proposal of CMTM7 as a putative, novel prognostic indicator that may be used in the treatment of liver cancer. However, at present, we do not know how the CMTM7 influences the tumor's formation, development and metastasis, and the underling molecular mechanism, has yet to be fully elucidated, and future studies will be focused on an exploration of these aspects.
ACKNOWLEGMENT
The authors thanked Dr. Kunkun Han for her discussion on this project.
PATIENT CONSENT AND ETHICS APPROVAL
The handling of the patient's tissues adhered to the tenets of the Declaration of Helsinki (2013) in protecting patient's confidentiality and all the tissues were used after approved by the Review Board and Ethical Committee of Soochow University (Suzhou, China).
CONFLICTS OF INTEREST
All authors declare no conflicts of interests.
Huang Z‐M, Li P‐L, Yang P, et al. Overexpression of CMTM7 inhibits cell growth and migration in liver cancer. Kaohsiung J Med Sci. 2019;35:332–340. 10.1002/kjm2.12058
Funding information CAMS Initiative for Innovative Medicine, Grant/Award Number: CAMS‐I2M, 2016‐I2M‐1‐005; National Natural Science Foundation of China, Grant/Award Number: 81572378; Natural Science Foundation of Jiangsu Province, Grant/Award Number: BK20171231; Suzhou Municipal Science and Technology Project , Grant/Award Number: SYS201616; the Special Research Fund for Central Universities, Peking Union Medical College, Grant/Award Number: 2016ZX310194
Contributor Information
Xin Xu, Email: zitanxu@163.com.
Feng Xu, Email: sz_xf@suda.edu.cn, Email: feng_xu2018@hotmail.com.
REFERENCES
- 1. Ferlay J, Soerjomataram I, Dikshit R, Eser S, Mathers C, Rebelo M, et al. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int J Cancer. 2015;136:E359–E386. [DOI] [PubMed] [Google Scholar]
- 2. Raoul JL, Raimbourg J, Hiret S, Adhoute X, Senellart H. Hepatocellular carcinoma: Increase in incidence or future plague? Bull Cancer. 2018;105:502–507. [DOI] [PubMed] [Google Scholar]
- 3. Miyazaki A, Yogosawa S, Murakami A, Kitamura D. Identification of CMTM7 as a transmembrane linker of BLNK and the B‐cell receptor. PLoS ONE. 2012;7:e31829. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4. Zhang Y, Wang JY, Han W. A role for CMTM7 in BCR expression and survival in B‐1a but not B‐2 cells. Int Immunol. 2014;26:47–57. [DOI] [PubMed] [Google Scholar]
- 5. Li H, Li J, Su Y, Fan Y, Guo X, Li L, et al. A novel 3p22.3 gene CMTM7 represses oncogenic EGFR signaling and inhibits cancer cell growth. Oncogene. 2014;33:3109–3118. [DOI] [PubMed] [Google Scholar]
- 6. Shao L, Cui Y, Li H, Liu Y, Zhao H, Wang Y, et al. CMTM5 exhibits tumor suppressor activities and is frequently silenced by methylation in carcinoma cell lines. Clin Cancer Res. 2007;13:5756–5762. [DOI] [PubMed] [Google Scholar]
- 7. Xu G, Dang C. CMTM5 is downregulated and suppresses tumour growth in hepatocellular carcinoma through regulating PI3K‐AKT signalling. Cancer Cell Int. 2017;17:113. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8. Bei C, Zhang Y, Wei R, Zhu X, Wang Z, Zeng W, et al. Clinical significance of CMTM4 expression in hepatocellular carcinoma. Onco Targets Ther. 2017;10:5439–5443. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9. Yuan W, Liu B, Wang X, Li T, Xue H, Mo X, et al. CMTM3 decreases EGFR expression and EGF‐mediated tumorigenicity by promoting Rab5 activity in gastric cancer. Cancer Lett. 2017;386:77–86. [DOI] [PubMed] [Google Scholar]
- 10. Liu B, Su Y, Li T, Yuan W, Mo X, Li H, et al. CMTM7 knockdown increases tumorigenicity of human non‐small cell lung cancer cells and EGFR‐AKT signaling by reducing Rab5 activation. Oncotarget. 2015;6:41092–41107. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real‐time quantitative PCR and the 2(−Delta Delta C[T]) method. Methods. 2001;25:402–408. [DOI] [PubMed] [Google Scholar]
- 12. Zeng Y, Xu X, Wang S, Zhang Z, Liu Y, Han K, et al. Ring finger protein 6 promotes breast cancer cell proliferation by stabilizing estrogen receptor alpha. Oncotarget. 2017;8:20103–20112. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13. Xu X, Wang J, Han K, Li S, Xu F, Yang Y. Antimalarial drug mefloquine inhibits nuclear factor kappa B signaling and induces apoptosis in colorectal cancer cells. Cancer Sci. 2018;109:1220–1229. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Zhong J, Wang Y, Qiu X, Mo X, Liu Y, Li T, et al. Characterization and expression profile of CMTM3/CKLFSF3. J Biochem Mol Biol. 2006;39:537–545. [DOI] [PubMed] [Google Scholar]
- 15. Gao DH, Hu H, Fang ZW, Huo F, Wang HR, Xu KX, et al. Research advances in chemokine‐like factor super family member 8. Zhongguo Yi Xue Ke Xue Yuan Xue Bao Acta Academiae Medicinae Sinicae. 2016;38:746–749. [DOI] [PubMed] [Google Scholar]
- 16. Li W, Zhang S. CKLF‐like MARVEL transmembrane domain‐containing member 3 (CMTM3) inhibits the proliferation and Tumorigenisis in hepatocellular carcinoma cells. Oncol Res. 2017;25:285–293. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Delic S, Thuy A, Schulze M, Proescholdt MA, Dietrich P, Bosserhoff AK, et al. Systematic investigation of CMTM family genes suggests relevance to glioblastoma pathogenesis and CMTM1 and CMTM3 as priority targets. Genes Chromosomes Cancer. 2015;54:433–443. [DOI] [PubMed] [Google Scholar]
- 18. Cai B, Xiao Y, Li Y, Zheng S. CMTM5 inhibits renal cancer cell growth through inducing cell‐cycle arrest and apoptosis. Oncol Lett. 2017;14:1536–1542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19. Shen Z, Chen X, Li Q, Zhou C, Xu Y, Yu R, et al. Elevated methylation of CMTM3 promoter in the male laryngeal squamous cell carcinoma patients. Clin Biochem. 2016;49:1278–1282. [DOI] [PubMed] [Google Scholar]
- 20. Hu FZ, Yuan WQ, Wang XL, Qin CP, Sheng ZZ, DU YQ, et al. Knockdown of CMTM3 promotes migration and invasion of PC3 cell in vitro. Beijing Da Xue Xue Bao. 2016;48:594–597. [PubMed] [Google Scholar]
- 21. Yuan W, Li T, Mo X, Wang X, Liu B, Wang W, et al. Knockdown of CMTM3 promotes metastasis of gastric cancer via the STAT3/Twist1/EMT signaling pathway. Oncotarget. 2016;7:29507–29519. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Lu M, Huang Y, Sun W, Li P, Li L, Li L. miR‐135b‐5p promotes gastric cancer progression by targeting CMTM3. Int J Oncol. 2018;52:589–598. [DOI] [PubMed] [Google Scholar]
- 23. Liu Q, Su Y, Jiang GC, Zhou ZL, Liu BC, Bu L, et al. Change of CMTM7 expression, a potential tumor suppressor, is associated with poor clinical outcome in human non‐small cell lung cancer. Chin Med J. 2013;126:3006–3012. [PubMed] [Google Scholar]
- 24. Huber MA, Kraut N, Beug H. Molecular requirements for epithelial‐mesenchymal transition during tumor progression. Curr Opin Cell Biol. 2005;17:548–558. [DOI] [PubMed] [Google Scholar]
- 25. Xu X, Zhang J, Han K, Zhang Z, Chen G, Zhang J, et al. Natural pesticide dihydrorotenone arrests human plasma cancer cells at the G0/G1 phase of the cell cycle. J Biochem Mol Toxicol. 2014;28:232–238. [DOI] [PubMed] [Google Scholar]
- 26. Li Y, Huang J, Zeng B, Yang D, Sun J, Yin X, et al. PSMD2 regulates breast cancer cell proliferation and cell cycle progression by modulating p21 and p27 proteasomal degradation. Cancer Lett. 2018;430:109–122. [DOI] [PubMed] [Google Scholar]
- 27. Chen R, He F, He H, York JP, Liu W, Xia X. Phosphorylation of P27 by AKT is required for inhibition of cell cycle progression in cholangiocarcinoma. Dig Liver Dis. 2018;50:501–506. [DOI] [PubMed] [Google Scholar]
- 28. Kawaguchi T, Hayakawa M, Koga H, Torimura T. Effects of fucoidan on proliferation, AMP‐activated protein kinase, and downstream metabolism‐ and cell cycle‐associated molecules in poorly differentiated human hepatoma HLF cells. Int J Oncol. 2015;46:2216–2222. [DOI] [PubMed] [Google Scholar]
- 29. Odintsova E, Voortman J, Gilbert E, Berditchevski F. Tetraspanin CD82 regulates compartmentalisation and ligand‐induced dimerization of EGFR. J Cell Sci. 2003;116:4557–4566. [DOI] [PubMed] [Google Scholar]
- 30. Jin C, Ding P, Wang Y, Ma D. Regulation of EGF receptor signaling by the MARVEL domain‐containing protein CKLFSF8. FEBS Lett. 2005;579:6375–6382. [DOI] [PubMed] [Google Scholar]
- 31. Brazil DP, Yang ZZ, Hemmings BA. Advances in protein kinase B signalling: AKTion on multiple fronts. Trends Biochem Sci. 2004;29:233–242. [DOI] [PubMed] [Google Scholar]