Abstract
Psoriasis is a multisystem disease affecting about 2% of the population, while keratin16 (KRT16) has been reported to participate in psoriasis. However, the specific mechanism of KRT16 in psoriasis was inadequately investigated. The objective of the study was to elucidate the mechanism by which siRNA‐mediated silencing of KRT16 affects keratinocyte proliferation and vascular endothelial growth factor (VEGF) secretion in psoriasis through the extracellular signal‐related kinase (ERK) signaling pathway. Psoriasis‐related core gene KRT16 was screened out. Then, the expression of KRT16, VEGF, and ERK signaling pathway‐related genes was detected in psoriatic patients. To further investigate the mechanism of KRT16, keratinocytes in psoriatic patients were treated with KRT16 siRNA or/and ERK inhibitor (PD98059) to detect the changes in related gene expression and cell survival. KRT16 was involved in psoriasis development. The expression levels of KRT16, p‐ERK1/2, and VEGF in lesion tissues are significantly elevated. Keratinocytes treated with KRT16‐siRNA and KRT16‐siRNA + PD98059 exhibited reduced KRT16, p‐ERK1/2, and VEGF expression. The cell survival rate in cells treated with KRT16‐siRNA, PD98059, and KRT16‐siRNA + PD98059 reduced significantly. These findings indicate that silencing KRT16 inhibits keratinocyte proliferation and VEGF secretion in psoriasis via inhibition of ERK signaling pathway, which provides a basic theory in the treatment of psoriasis.
Keywords: ERK signaling pathway, keratinocyte, KRT16, psoriasis, vascular endothelial growth factor
1. INTRODUCTION
Psoriasis, a chronic, inflammatory and immune‐mediated disease affecting the skin, has been related to cardiovascular disease owing to enhanced systemic inflammation and resulting atherosclerosis.1 Adults and people living in countries further from the equator are more common to suffer from psoriasis, and presently, no cure for psoriasis has been discovered; therefore, psoriatic patients frequently need lifetime management.2 In the past decade, some treatment guidelines, tools, and standards have been introduced and applied, especially in European countries.3 Moreover, psoriasis is a disease characterized by excessive growth and aberrant differentiation of keratinocytes, and an abnormal keratin expression pattern is found in psoriatic keratinocytes.4 Previous evidence has revealed that in psoriasis, keratinocytes are activated and deviate from the normal differentiation cycle, resulting in the excessive proliferation and expression of immune‐related molecules.5 The abnormally accelerated proliferation of keratinocytes leads to epidermal hyperplasia, parakeratosis, and consequently inflammatory infiltration and neoangiogenesis, which thereafter form specific psoriatic lesions.6
Activated keratinocytes express keratins that are distinct from those of the healthy epidermis, such as K6, K16, and K17 keratin proteins.7 Study on changes in the epidermis of psoriasis has provided evidence for the presence of three hyper‐proliferation associated keratins, among which keratin16 (KRT16) serves as the type I keratin in the formation of intermediated filament heterodimers.8 The KRT16 expression has been observed in the skin diseases characterized by hyperproliferation such as psoriasis.9 Moreover, it is reported that KRT16 is the marker of keratinocyte hyperproliferation in psoriasis in vivo and in vitro.10 It was shown that KRT16 owns special properties that may translate into a specialized function in keratinocytes.11 It is suggested that, through the activation of extracellular signal‐regulated kinase (ERK), the epidermal growth factor (EGF) up‐regulates the recruitment of coactivator p300 to the promoter of KRT16, the last being critically important for the EGF regulation of KRT16.12 Vascular endothelial growth factor (VEGF) is a potent endothelial cell mitogen playing a key role in angiogenesis in psoriasis, and it has been shown that VEGF expression is increased in lesion psoriatic skin.13 However, the interaction and mechanism of KRT16, ERK signaling pathway and VEGF in psoriasis remain little known. Thus, this study aims to find out how KRT16 influences keratinocytes proliferation and VEGF secretion in psoriasis.
2. MATERIALS AND METHODS
2.1. Microarray‐based gene expression analysis
The Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/) was applied to retrieve four microarray data: GSE6710, GSE14905, GSE50790, and GSE53552. The “limma” package in the R language programming was used for differential analysis of the genes in psoriasis and healthy control samples of the first three chips. With |logFC| > 2, and P‐value < 0.05 as the screen standard of differential genes, the “pheatmap” package in the R language programming was applied to construct the expression thermal map of differential genes. Based on the Venn diagram website (http://bioinformatics.psb.ugent.be/webtools/Venn/), the intersection of the first 50 differential genes in three chips was obtained. GSE53552 was used for subsequent expression identification of the selected differential genes.
2.2. Gene retrieval and association analysis
With “Psoriasis” as the keyword, the MalaCards database (http://www.malacards.org/) was used to retrieve known psoriasis‐related genes, among which 10 genes with the highest score were used for the following analysis. Interaction of the known genes and differential genes were obtained using the STRING database (https://string-db.org/) and gene interaction network diagram was drawn using the Cytoscape software.
2.3. Ethical statement
The study is in conformity with the Helsinki Declaration. All participants or their guardians have signed and informed consents prior to investigation. This study was approved by the ethics committee of our hospital.
2.4. Study subjects
Clinical tissue specimens were lesioned and non‐lesion tissues of psoriatic patients and normal skin tissues of healthy individuals. From January 2005 to June 2017, 108 specimens definitely diagnosed as psoriasis vulgaris, including 58 males and 50 females, were collected from our hospital. Inclusion criteria were as follows: (a) patients who met the clinical diagnostic criteria for psoriasis;14 (b) patients aged from 20 to 68 years; (c) patients with an illness duration of ≥6 months; (d) patients with impaired surface of ≥10% and psoriasis area and severity index (PASI) score of ≥10;15 (e) women of childbearing age with negative pregnancy test. The exclusion criteria were as follows: (a) patients with lesions in the heart, liver, kidney, and other important organs, or lesions and medical history in blood and endocrine system; (b) patients take drugs without following the doctor's instructions; (c) patients with malignancy or a family history of malignancy; (d) pregnant and lactating patients and female patients with birth plans within 3 years; (e) patients with prior history of tuberculosis or with severe acute or chronic infection locally or systemically; (f) patients with aspartate aminotransferase and alanine aminotransferase levels of ≥1.5 times the upper normal limit. None of the included patients received any treatment with immunosuppressant and drugs for external use. A piece of lesion skin tissue and normal‐appearing skin tissue (their distance is >5 cm) were obtained from psoriasis patients, and each piece was separated into three parts. One part was used for cell culture, one for conventional waxing, and one for RNA/protein extraction. Normal skin tissues were obtained from 126 healthy volunteers (their age and gender are not obviously different from psoriatic patients) by outpatient surgery, half of which were also performed for cell culture and the other for routine paraffin. Total RNA and protein were extracted. Skin tissues were collected from normal voluntary adult individuals who underwent plastic surgery in our hospital without skin or systemic diseases.
2.5. Hematoxylin and eosin staining and immunohistochemistry
The above skin tissues were fixed via 10% neutral formalin, dehydrated, cleared, embedded, and made into sections (3 μm). The sections were used for Hematoxylin and eosin (HE) staining and KRT16 and VEGF immunohistochemistry. The sections were dewaxed, and treated with 3% H2O2 for 10 minutes to inactivate endogenous peroxidase activity. After microwave repair, the sections were added with the primary antibodies of rabbit anti‐human keratin (ab76416, 1:250) and VEGF (ab2349, 1:100) at 37°C for 40 minutes, followed by a wash with phosphate buffered saline (PBS). After adding with the goat anti‐rabbit secondary antibody at 37°C, the cells were cultured for 40 minutes. Then that, the cells were conventionally stained with 3‐Amino‐9‐ethylcarbazole (AEC) for 10 minutes and counterstained with hematoxylin. At last, the cells were mounted. The PBS was used as an alternative to negative control (NC). At least, 10 fields were observed under a light microscope (×100) and 100 cells were counted in each field. Cells with staining degree of more than 25% were regarded as positive cells, and obvious brownish or brown granules appeared in the nucleus or nucleus‐cytoplasm. The positive rate = positive cell number/total cell number. The immunohistochemical score was read by two experienced pathologists in a blind manner. The positive rates of KRT16 and VEGF expression in lesion tissues, non‐lesion tissues and normal skin tissues were detected.
2.6. Reverse transcription quantitative polymerase chain reaction
The mRNA expressions of KRT16 and VEGF in lesion tissues, non‐lesion tissues and normal skin tissues as well as in cells were evaluated by Reverse transcription quantitative polymerase chain reaction (RT‐qPCR): (a) total RNA was extracted using Trizol one‐step method. Firstly, 0.1 g specimens were weighed and put in a 1.5 mL centrifuge tube. The specimens with 1.0 mL Trizol were quickly ground into homogenate in ice‐baths for 15 to 30 seconds. The specimens were allowed to stay at room temperature for 5 minutes and then added with 0.2 mL chloroform with sufficient oscillation. Then, the specimens were allowed to place at room temperature for 3 minutes and centrifuged at 12000g for 15 minutes at 4°C. A total of 0.5 mL supernatant were taken, added with 0.5 mL isopropanol with gently shaken. After being allowed to place at −4°C for 2 hour, the specimens were centrifuged at 12000g for 15 minutes at 4°C. The supernatant was discarded, 1 mL 75% ethanol was added, and the specimens were centrifuged at 7500g for 15 minutes at 4°C. The specimens were mixed with 15 μL nuclease‐free water uniformly after removal of the supernatant. The absorbance A260 and A280 value of the finally obtained liquid were detected by an ultraviolet‐visible spectrophotometer and the sample was stored at −50°C for further use. (b) The RNA concentration and purity were detected. The RNA sample (1 μL) was added with 79 μL diethyl pyrocarbonate (DEPC). The A values at 260 nm and 280 nm were detected by the ultraviolet‐visible spectrophotometer. If the A260/A280 ratio ranged between 1.8 and 2.0, the RNA purity of the sample was considered as qualified. The RNA concentration (μg/μL) was calculated, which is A260 × 40 × dilution factor/1000. (c) Complementary DNA (cDNA) was synthesized by reverse transcription. cDNA was synthesized in 5 seconds at 85°C from absorbing 4 μL RNA template and combining the template with primers at 37°C for 15 minutes. (d) PCR amplification reaction system was as follows, the total volume was 20 μL, including 10 μL SYBR Premix Ex Taq (2 ×), 0.4 μL forward primer for PCR (10 μmol/L), 0.4 μL reverse primer for PCR (10 μmol/L), 0.4 μL ROX correction fluid II, 2 μL cDNA template, and 6.8 μL ddH2O. The PCR primer sequences of genes are showed in Table 1, and all PCR primers were synthesized by Takara Biomedical Technology (Beijing) Co., Ltd. (e) The RT‐qPCR amplification conditions were as follows: pre‐denaturation at 95°C for 1 minutes, a total of 40 cycles of denaturation at 95°C for 5 seconds, annealing at 59°C for 30 seconds, and extension at 72°C for 30 seconds, followed by extension at 72°C for 10 minutes. The experiment at each time point was repeated three times, the mean value was obtained and the fold changes were calculated based on 2‐▵▵CT method. PCR products were photographed and used for image analysis after 2% agarose gel electrophoresis. (f) Through retrieving NCBI GenBank database, the primers were designed, respectively, to different exons, with taking β‐actin as an internal reference.
Table 1.
Primers sequences for reverse transcription quantitative polymerase chain reaction
| Genes | Primers sequences (5′‐ 3′) | |
|---|---|---|
| KRT16 | Forward primer | GGGGCATGTCAGTTACCTCC |
| Reverse primer | TGGTACCAGTCCCGGATCTT | |
| VEGF | Forward primer | CAGAGTCAGCACATAGCGCA |
| Reverse primer | TCGACTTGCAACGTGAGTCT | |
| β‐Actin | Forward primer | GAGCGTGGCTACACATTCAC |
| Reverse primer | AATAACCTGTCCGTCGGGGA | |
Abbreviations: KRT16, keratin16; VEGF, vascular endothelial growth factor.
2.7. Western blot analysis
The protein expressions of KRT16, ERK1, ERK2, p‐ERK, and VEGF in lesion tissues, non‐lesion tissues and normal skin tissues as well as in cells were evaluated by western blot analysis. Lesion tissues were placed into a centrifuge tube and lysate was added according to the ratio of 1:8 (m/V). Then the specimens were quickly ground into homogenate in ice‐baths for rapid grinding (ie, intermittent comminution, equally 6 seconds × 6 times). After that, the specimens were rapidly centrifuged at 27000g for 1 hour, and the obtained supernatant was total protein extraction. The partial protein sample was absorbed and Lorry method was performed for quantitative detection. The protein samples (40 μg) were absorbed by a transferpettor and bromophenol blue and protein samples were blended according to the proportion of 1:1. After that, the samples were added into polyacrylamide gel which contained 12% sodium dodecyl sulfate (SDS) and then subjected to electrophoresis at 100 V for 1.5 hour. When bromophenol blue filled gel pores and reached the bottom of the gel, protein bands appeared on polyacrylamide gel by electrophoresis, and then transferred from the gel to a nitrocellulose membrane containing nitric acid. Afterwards, the samples were incubated with KRT16 antibody (1:600; ab53117), ERK antibody (1:1000; ab17942), p‐ERK antibody (1:10000; ab50011) and VEGF antibody (1:2000; ab32152). All antibodies were obtained from Abcam Company (Cambridge, UK). At last, a secondary antibody labeled by horse radish peroxidase (HRP) was added. Gel electrophoresis imaging analysis system (WD‐9413A, Beijing Liuyi Biological Technology Co., Ltd., Beijing, China) was conducted for gel imaging analysis. Relative protein content was expressed with the gray value of corresponding protein bands/the gray value of β‐actin protein bands. This experiment was repeated three times.
2.8. Isolation and subculture of psoriatic keratinocytes
The isolation of psoriatic keratinocytes: the skin (2 cm × 2 cm) of psoriasis patients was resected, placed in PBS containing 100 mg/ mL streptomycin sulfate and 100 IU/mL ampicillin, and rinsed with PBS. After removal of fat and connective tissues in skin tissues, the samples were sliced into skin masses (1 cm × 1 cm) and then incubated with Dispase II (2.4 U/mL) at 4°C overnight. Next, cuticular layers were obtained, added into PBS digestive juice containing 0.02% ethylene diamine tetraacetic acid (EDTA) and 0.25% trypsin, and agitated in an incubator shaker at 37°C and 180 rpm for 10 minutes. Digestion was stopped by adding trypsin inhibitor, followed by centrifugation at 1000 rpm for 10 minutes. The cells were collected and inoculated into a keratinocyte serum‐free medium, which was eluted two to three times. When the cell density was adjusted to (1 ~ 2) × 106 cells per milliliter, the cells were in an open culture at 37°C and 5% CO2 with 90% humidity. The subculture of psoriatic keratinocytes: the keratinocytes grew into a confluent monolayer along the medium after being cultured for a period of time. Being washed with PBS (containing calcium‐free Mg2+) twice, the keratinocytes were digestion with PBS digestive juice containing 0.02% EDTA and 0.25% trypsin at 37°C for 5 to 10 minutes, and the digestion process was terminated by the addition of trypsin inhibitor. The keratinocytes were added into an aforementioned serum‐free medium with blowing and beating, sub‐cultured at the ratio of 1:2 in an open culture at 37°C and 5% CO2 with 90% humidity. After 24 hour of incubation, the whole medium was replaced. The sub‐cultured keratinocytes at 3rd to 5th generation were used for cell transfection experiment. The cells were digested and diluted to 4 × 105 cells/ml cells and then seeded in 6‐well plate with 2.5 mL per well with an open culture at 37°C and 5% CO2 with 90% humidity. The number of digestive cells was counted, respectively, at 0, 24, 48, 72, 96, 120, 144, 168, and 192 hours. As each sample repeated three times, the mean value was calculated. The medium was changed at 0, 3, 6, 9 days and the growth curve was drawn by a continuous counting after 9 days of incubation.
2.9. Cell treatment
The cells were grouped into the blank group (no transfection), the NC group (transfection with empty vector), the KRT16‐siRNA group (transfection with KRT16‐siRNA), the PD98059 group (transfection with blank vector and treatment with 50 μmol/L PD98059 for 1 hour, the inhibitor of the ERK signaling pathway) and the KRT16‐siRNA + PD98059 group (transfection with KRT16‐siRNA vector and treatment with 50 μmol/L PD98059 for 1 hour). Transfection of cationic liposome was conducted according to the instructions of Lipofectamine 2000 (11668‐027, Invitrogen company, Carlsbad, CA). The plasmids were purchased from Addgene (Cambridge, MA). Serum‐free Dulbecco's Modified Eagle's Medium (DMEM) medium (JRH Biosciences, Lenexa, KS), were blended with oligonucleotides and liposome at the ratio of 10 mg/L and 20 μL, followed by being placed at room temperature for 20 minutes. Then, liposome‐oligonucleotide complexes were obtained. Partial cells of skin lesion tissues were obtained and seeded in a 24‐well plate with 2 × 105 cells each well. After that, another 24‐hours culture was conducted until cells were adhering to the wall. According to the instructions, the cultured cells were washed with serum‐free medium and assigned to the observation group (addition of liposome‐Oligonucleotide complexes) and control group (addition of liposome). After 48‐hours transfection, the effect of transfection among each group was observed under an inverted fluorescence microscope (Nikon XDY‐1). Based on the observation results, five high‐power fields were randomly selected, and the total number of cells (without green fluorescence) and the number of fluorescent cells were counted. Transfection efficiency was calculated according to the calculation formula of transfection: the number of fluorescent cells/cells total number × 100%. After 24‐hours culture, the cells were digested and collected with trypsin.
2.10. Cell counting kit‐8 (CCK‐8) assay
The transfected cells were digested, centrifuged, and resuspended. The cells were seeded in a 96‐well plate at a density of 5 × 104 cells/mL per well. When the cell confluency reached 70% to 80%, the medium was discarded after being washed with sterile PBS twice, cells were added with PBS in an amount of 10 μL per well and then exposed to NB‐UVB radiation at a dose of 100 mg/cm2. PBS was discarded after irradiation and the cells continued to be cultured for 6, 12, 18, and 24 hours after addition of the medium. To reduce experimental error, the medium was changed and each well was added with 100 μL medium and 10 μL CCK‐8 solutions. Another three control wells (without cells) were established and were added with 100 μL medium and 10 μL CCK‐8 solutions. Then the wells were cultured in an incubator at 37°C for 30 minutes. The optical density (OD) value of each well was measured at 450 nm using a microplate reader (TECAN Company). The number of adherent live cells among groups was determined by their OD values and then the survival rate was calculated. The experiment was repeated three times and the mean values were obtained. OD = ODthe experiment group − ODthe blank group, cell survival rate = ODthe experiment group/ODthe blank group × 100%.
2.11. Enzyme‐linked immunosorbent assay
VEGF levels secreted by, cell's secretion were measured by, Enzyme‐linked immunosorbent assay (ELISA). After transfection, the keratinocytes in the logarithmic growth phase were digested and made into the cell suspension. The cells were seeded in a 96‐well plate at a density of 1 × 104 cells per well. Each group had four duplicated wells. After that, the cells were continuously cultured in an incubator for a day under the required conditions. Then the plate was taken out and the supernatant was discarded. Each well was continuously cultured with the corresponding drugs in an incubator for a day under the required conditions. After 1‐day culture, the supernatant of each well was collected according to operational requirements. The VEGF levels of each well were examined by VEGF ELISA kit (EH015, Shanghai Genetimes Biological Science and Technology Co., Ltd., Shanghai, China). The whole process of VEGF detection was strictly in accordance with the instructions of the ELISA kit. The data, obtained from corresponding analytical software of ELISA, and the OD value were used to calculate the VEGF concentration according to the corresponding formula. Then the corresponding equation and diagram were obtained.
2.12. Statistical analysis
All data were analyzed using SPSS 22.0 (International Business Machines Corporation, New York). Results are presented as mean ± SD. The normality and homogeneity of variance were tested. When the data were with normal distribution and homogeneity of variance, one‐way analysis of variance or repeated measures analysis of variance was used to compare multiple groups. Otherwise, the rank‐sum test was used for comparison. P < 0.05 was considered statistically significant.
3. RESULTS
3.1. KRT16 gene is involved in the development of psoriasis
The GEO database was used to screen expression chips in psoriasis. Differentially expressed genes in psoriasis were obtained through difference analysis of the GSE6710, GSE14905, GSSE50790 with the healthy group as control. Eventually, 104 differentially expressed genes were obtained in the GSE6710, 166 in the GSE14905, and 173 in the GSE50790. Expression thermal map of 50 genes with the most significant differential expression in the three chips was drawn (Figure 1A‐C). In order to screen out psoriasis‐related genes, Venn analysis was conducted concerning 50 genes with most significant differential expression in the three chips and the intersection of analytical results of the three chips was obtained (Figure 1D). In the three chips, 12 differentially expressed genes were obtained, which simultaneously existed in the first 50 differentially expressed genes in analytical results of the three chips, indicating that 12 genes were likely to be associated with the development of psoriasis. These 12 differentially expressed genes were chosen as candidate genes. In the MalaCards database, genes related to psoriasis were retrieved with “psoriasis” as the keyword and 10 genes with the highest score were used for subsequent analysis (Table 2). Interaction analysis was carried out regarding the 10 psoriasis‐related genes and 12 candidate genes and gene interaction network diagram was constructed (Figure 1E). The results implied that KRT16 gene was in the core position of the 12 differentially expressed genes and was interacted with known genes as well as differential genes in most diseases, suggesting that KRT16 was likely to be involved in the development of psoriasis. Further analysis (Figure 1F) of KRT16 expression in GSE53552 showed that KRT16 was overexpressed in GSE53552 in psoriasis, which was in line with its expression in GSE6710, GSE14905, and GSE50790. This demonstrated that the KRT16 gene was involved in the development of psoriasis. The present studies indicated that the ERK signaling pathway was likely to be associated with psoriasis development.16, 17, 18 However, it still remains unclear whether the effect of KRT16 gene on psoriasis was exerted via the ERK signaling pathway.
Figure 1.
KRT16 is differentially expressed in psoriasis through microarray‐based gene expression analysis. A‐C, thermal maps of difference analysis of three chips in psoriasis, in which the abscissas referred to sample number and the ordinates referred to gene name. The upper color bars represented sample type. The left dendrogram referred to a cluster of gene expression, in which each block referred to the expression of a gene in a sample. The upper right histogram was color gradation, in which red represented high expression and blue represented poor expression; D, Venn diagram of the first 50 differentially expressed genes in three chips, in which blue referred to the first 50 differentially expressed genes in GSE6710, red referred to the first 50 differentially expressed genes in GSE14905, green referred to the first 50 differentially expressed genes in GSE50790, and the center part was the intersection of three chips; E, intersection network diagram of differentially genes and known psoriasis‐related genes, in which each circle represented a gene and the line between two genes referred to their direct or indirect interaction. More lines between genes represented the higher core degree in the intersection network diagram; F, expression of KRT16 in GSE53552, in which the abscissa referred to sample type, the ordinate referred to gene expression, the left box plot represented KRT16 expression in normal samples, and the right box plot referred to KRT16 expression in psoriasis samples, and P value was at the top left corner
Table 2.
Known psoriasis‐related genes
| Symbol | Description | Score | PubmedIds |
|---|---|---|---|
| HLA‐C | Major histocompatibility complex, class I, C | 65.56 | 10773694, 10545595, 17666781 |
| CDSN | Corneodesmosin | 63.27 | 11454986, 16965413, 15953084 |
| CARD14 | Caspase recruitment domain family member 14 | 56.65 | 29477734, 29150564, 28295164 |
| IL36RN | Interleukin 36 receptor antagonist | 56.52 | 29454537, 29215143, 28369922 |
| CCHCR1 | Coiled‐coil alpha‐helical rod protein 1 | 53.35 | 17221218, 11348465, 10888604 |
| PSORS1C1 | Psoriasis susceptibility 1 candidate 1 | 53.33 | 26653889, 1511512, 16029332 |
| FABP5 | Fatty acid binding protein 5 | 49.8 | 8726632, 128395738427590 |
| KRT17 | Keratin 17 | 49.73 | 11464104, 7577575, 15373909 |
| PSORS1C2 | Psoriasis susceptibility 1 candidate 2 | 47.89 | 12930300, 12823445 |
| TNF | Tumor necrosis factor | 46.8 | 17013997, 14967799, 18329935 |
Symbol referred to gene abbreviation; description represented gene description or full name of gene. Score: This score originates from Solr based GeneCards search engine score, obtained by querying the disease in GeneCards; PubmedIds: the PMID of reference about correlation between gene and psoriasis.
3.2. Baseline characteristics between psoriatic patients and healthy individuals
The recruited 108 psoriatic patients and 126 healthy individuals were grouped into the observation group and the control group according to their basic situation. Mean age of the observation group (58 males and 50 females) was 35.69 ± 9.65 years, and that of the control group (68 males and 58 females) was 36.08 ± 10.08 years. The baseline characteristics, including gender, age, weight, body mass index (BMI), smoking history, drinking history, psychological obstacle, pathological type, family history of psoriasis, and lack of health knowledge, exhibited no significant differences between two groups (all P > 0.05) (Table 3). Patients were classified as “mild” (n = 46), “moderate” (n = 35), and “severe” (n = 27) psoriasis according to the PASI.19
Table 3.
The baseline characteristics of subjects between the observation group and the control group
| Baseline characteristic | Observation group (n = 108) | Control group (n = 126) | χ 2/t | P |
|---|---|---|---|---|
| Age (y) | 35.69 ± 9.65 | 36.08 ± 10.08 | 0.301 | 0.764 |
| Gender | … | … | 0.002 | 0.968 |
| Male | 58 | 68 | … | … |
| Female | 50 | 58 | … | … |
| Mean weight (kg) | 58.12 ± 11.23 | 60.79 ± 9.89 | 1.934 | 0.054 |
| BMI (kg/m2) | 22.84 ± 4.03 | 23.19 ± 4.18 | 0.649 | 0.517 |
| Smoking history | … | … | 2.032 | 0.154 |
| Yes | 52 | 49 | … | … |
| No | 56 | 77 | … | … |
| Drinking history | … | … | 1.265 | 0.261 |
| Yes | 41 | 57 | … | … |
| No | 67 | 69 | … | … |
| Psychological obstacle | … | … | 2.074 | 0.15 |
| Yes | 32 | 27 | … | … |
| No | 76 | 99 | … | … |
| Pathological type | … | … | 2.877 | 0.579 |
| Diabetes | 18 | 16 | … | … |
| Hypertension | 29 | 44 | … | … |
| Coronary heart disease | 14 | 16 | … | … |
| Fatty liver | 22 | 28 | … | … |
| Hypoproteinemia | 25 | 22 | … | … |
| Family history of psoriasis | … | … | 1.272 | 0.259 |
| Yes | 78 | 99 | … | … |
| No | 30 | 27 | … | … |
| Lack of health knowledge | … | … | 0.854 | 0.355 |
| Yes | 25 | 23 | … | … |
| No | 83 | 103 | … | … |
| Severity | … | … | ‐ | ‐ |
| Mild | 46 | ‐ | … | … |
| Moderate | 35 | ‐ | … | … |
| Severe | 27 | ‐ | … | … |
Abbreviation: BMI, Body mass index.
3.3. The KRT16 protein and VEGF are highly expressed in the lesion tissues
HE staining result showed that in psoriatic patients, keratosis was seen in lesions, granular layer decreased or disappeared, dermal papilla vasodilation was tortuous, inflammatory cell infiltration in dermis and subcutaneous tissue was obvious; while non‐lesion tissues and normal skin tissues showed flatter epidermis, and the infiltration of inflammatory cells in non‐lesion tissues was less (Figure 2A). The positive staining of KRT16 was expressed in the intracytoplasm. There was a strong expression of KRT16 in the lesion tissues, but it was not expressed in normal skin tissues (Figure 2B). The positive expression of KRT16 in lesion tissues and non‐lesion tissues and normal skin tissues were 78.7% (85/108), 33.3% (36/108), and 18.3% (23/126), respectively. The positive rate of KRT16 protein expression in lesion tissues was significantly higher than that in non‐lesion tissues and normal skin tissues (both P < 0.05) (Figure 2D). A high expression of KRT16 was found in lesion tissues. The VEGF was mainly expressed in the cytoplasm. The cells with yellowish‐brown or brown granules in the cytoplasm were considered as positive cells. The expression of VEGF was the highest in the lesion tissues, followed by in the non‐lesion tissues and in the normal skin tissues (Figure 2C). The positive rate of VEGF expression in lesion tissues and non‐lesion tissues and normal skin tissues were 82.4% (89/108), 29.6% (32/108), and 19.8% (25/126), respectively. The positive rate of VEGF expression in lesion tissues was significantly higher than in non‐lesion tissues and normal skin tissues (both P < 0.05). There was no significant difference in the expression of VEGF between the non‐lesion tissues and the normal skin tissues (P > 0.05) (Figure 2E).
Figure 2.
The positive rates of KRT16 and VEGF expression are increased in psoriasis lesion tissues by immunohistochemistry. A, HE staining was applied for evaluating the pathological changes of lesions, non‐lesions and normal skin tissues (×100 or ×400); B, the positive rates of KRT16 expression in lesion tissues, non‐lesion tissues and normal skin tissues (×400, the red arrow means KRT16 positive); C, the positive rates of VEGF expression in lesion tissues, non‐lesion tissues and normal skin tissues (×400, the red arrow means VEGF positive); D, the positive rates of KRT16 expression in lesion tissues, non‐lesion tissues and normal skin tissues; E, the positive rates of VEGF expression in lesion tissues, non‐lesion tissues and normal skin tissues; *, P < 0.05 vs normal skin tissues; #, P < 0.05 vs non‐lesion tissues; KRT16, keratin 16; VEGF, vascular endothelial growth factor. The measurement data presented as the mean ± SD. One‐way analysis of variance was used among multiple groups. Normal skin (n = 126), psoriasis skin (n = 108)
3.4. The mRNA and protein expressions of KRT16, p‐ERK, and VEGF are expressed at a high level in lesion tissues
Results of RT‐qPCR (Figure 3A) revealed the highest mRNA expressions of KRT16 and VEGF in the lesion tissues, followed by the non‐lesion tissues and the normal skin tissues (all P < 0.05). Results of western blot analysis indicated that the protein expressions of KRT16, ERK1/2, p‐ERK1/2, and VEGF in lesion tissues and non‐lesion tissues and normal skin tissues was accorded with the mRNA expressions of KRT16 and VEGF (Figure 3B,C). Compared with the normal skin tissues, the protein expressions of KRT16, ERK1/2, p‐ERK1/2 and VEGF in the lesion and non‐lesion tissues was enhanced significantly (all P < 0.05). PASI scale was used to assess the severity of disease in all patients, and to analyze the relationship between the expressions of protein and the severity of disease. The results showed that the protein expressions of KRT16, ERK1/2, p‐ERK1/2, and VEGF were positively correlated with the severity of psoriasis (Figure 3D,E).
Figure 3.
The expression of KRT16, ERK1/2, p‐ERK1/2 and VEGF is increased in psoriasis detected by RT‐qPCR and western blot analysis. A, the mRNA expressions of KRT16 and VEGF in lesion tissues, non‐lesion tissues and normal skin tissues detected by RT‐qPCR. B and C, protein expressions of KRT16, ERK1/2, p‐ERK1/2 and VEGF in lesion tissues, non‐lesion tissues and normal skin tissues detected by western blot analysis. *, P < 0.05 vs normal skin tissues; #, P < 0.05 vs non‐lesion tissues; D and E, the protein expressions of KRT16, ERK1/2, p‐ERK1/2 and VEGF in psoriasis tissues of patients with different severity. *, P < 0.05 vs mild psoriasis tissues; #, P < 0.05 vs moderate psoriasis tissues. The measurement data presented as the mean ± SD. One‐way analysis of variance was used among multiple groups. Normal skin (n = 126), psoriasis skin (n = 108). Mild psoriasis patients (n = 46), moderate psoriasis patients (n = 35); severe psoriasis patients (n = 27). KRT16, keratin16; VEGF, vascular endothelial growth factor; ERK, extracellular signal‐related kinase; RT‐qPCR, reverse transcription quantitative polymerase chain reaction
3.5. The numbers of keratinocytes increase significantly with time
The separate keratinocytes were seeded and cultured in a 6‐well plate with a density of 4.0 × 105 cells/ml for 9 days. The cultured keratinocytes were counted, respectively, at 0, 24, 48, 72, 96, 120, 144, 168, and 192 hours. Cell growth curve (Figure 4) was drawn according to the counted cell numbers.
Figure 4.
The numbers of keratinocytes obviously increase with time
3.6. Lesion tissues are successfully transfected by KRT16‐siRNA plasmid and empty plasmid
siRNA could efficiently downregulate the expression of KRT16 in keratinocytes. After a 24‐hours transfection of siRNA, a decrease of the mRNA expression of KRT16 was observed in the transfection group compared with the control group. After a 72‐hours transfection, KRT16 protein expression in transfection group also reduced significantly. Then 48 hours for transfection, the lesion tissues were transfected with recombinant plasmid KRT16‐siRNA and empty plasmid, the green fluorescent protein expression in keratinocytes was detected using a fluorescence microscope. The results showed that partial cells gave out green fluorescence with different intensities, the highest transfection efficiency of the KRT16‐siRNA group at 48 hours was about 80%, and that of the NC group was about 50%. Compared with the NC group, the transfection efficiency of the KRT16‐siRNA group was elevated significantly (P < 0.05) (Figure 5). Lesion tissues were successfully transfected with KRT16‐siRNA plasmid and blank plasmid.
Figure 5.
Lesion tissues are successfully transfected with the KRT16‐siRNA and blank plasmids (×100)
3.7. KRT16 gene silencing descends the expression of p‐ERK1/2 and VEGF
The results of RT‐qPCR and western blot analysis (Figure 6) showed that, compared with the blank group, the mRNA and protein expressions of KRT16 in the KRT16‐siRNA group and the KRT16‐siRNA + PD98059 group reduced obviously (all P < 0.05) (all P < 0.05). However, KRT16 expression showed no changes in the PD98059 group. Compared with the blank group, the expression of VEGF and the extent of p‐ERK1/2 decreased in the KRT16‐siRNA + PD98059 group and the PD98059 group. No significant difference of VEGF was shown in the KRT16‐siRNA and PD98059 groups, but the expression of VEGF in the KRT16‐siRNA and PD98059 groups was higher than that in the KRT16‐siRNA + PD98059 group. No notable differences in the expressions of KRT16, ERK1/2, p‐ERK1/2, and VEGF were found in the NC and blank groups (all P > 0.05).
Figure 6.
Silencing KRT16 inhibits the expression of VEGF and the activation of the ERK signaling pathway in keratinocytes of psoriasis. A, The mRNA expressions of KRT16 and VEGF in keratinocytes after transfection. (B) Protein bands of KRT16, ERK1/2, p‐ERK1/2, VEGF, and β‐actin. (C) the protein expressions of KRT16, ERK1/2, p‐ERK1/2 and VEGF in keratinocytes. *, P < 0.05 vs the blank group; #, P < 0.05 vs the KRT16‐siRNA + PD98059 group. KRT16, keratin16; VEGF, vascular endothelial growth factor; ERK, extracellular signal‐related kinase. The measurement data presented as the mean ± SD. One‐way analysis of variance was used among multiple groups. The experiment was repeated three times independently
3.8. KRT16 gene silencing depresses the keratinocytes survival rate
The CCK‐8 assay was performed to detect keratinocytes proliferation after silencing of KRT16. The results of CCK‐8 assay expressed that the keratinocytes proliferation of the blank group and the NC group had no significant difference after incubation for 0 h to 12 hours (Figure 7). Since the 12th hour, in comparison with the NC group, the keratinocytes proliferation of the transfected group reduced (all P < 0.05). The results of cell survival rate detection by CCK‐8 assay suggested that, when compared with the blank group and the NC group, a decrease of the cell survival rate was observed in the KRT16‐siRNA, PD98059, KRT16‐siRNA + PD98059 groups (all P < 0.05). The KRT16‐siRNA group and the PD98059 group had a synergistic effect on cell survival rate, and the effect of the KRT16‐siRNA + PD98059 group was twice as much as any group of the KRT16‐siRNA group and the PD98059 group.
Figure 7.
Cell viability is inhibited by silenced KRT16 detected by CCK‐8 assay. *, P < 0.05 vs the blank group; #, P < 0.05 vs the KRT16‐siRNA + PD98059 group. The measurement data presented as the mean ± SD. Repeated measurement analysis of variance was used among multiple groups. The experiment was repeated three times independently
3.9. The protein concentration of VEGF significantly decreased
The results of ELISA assay (Figure 8) displayed that, when compared with the blank group and the NC group, the protein concentration of VEGF in the KRT16‐siRNA, PD98059, KRT16‐siRNA + PD98059 groups significantly decreased (all P < 0.05). KRT16‐siRNA group and PD98059 group had an insignificant difference on inhibiting protein concentration of VEGF (P > 0.05), and there was no significant difference in the protein concentration of VEGF between NC group and blank group (P > 0.05). The inhibitory effect of the KRT16‐siRNA + PD98059 group on the protein concentration of VEGF was twice as obvious as any group of the KRT16‐siRNA group and the PD98059 group.
Figure 8.
The protein level of VEGF is downregulated by KRT16 gene silencing checked by ELISA. *, P < 0.05 vs the blank group; #, P < 0.05 vs the KRT16‐siRNA + PD98059 group. The measurement data presented as the mean ± SD. One‐way analysis of variance was used among multiple groups. The experiment was repeated three times independently
4. DISCUSSION
Psoriasis, a chronic inflammatory skin disease caused by hyper‐proliferation of prematurely differentiated keratinocytes, is marked by the thickened epidermis and several inflammatory phenotypes.20 It is shown that differentiation or activation state of keratinocytes is reflected by keratin expression pattern, which exerts crucial functions by triggering complex responses.4 As a type I keratin, KRT16 has been regarded as a marker of psoriasis and in relapsing psoriasis, the KRT16 expression is upregulated, while in resolving psoriasis downregulated.21 The present study explored the effect of KRT16 gene silencing on keratinocytes proliferation and VEGF secretion in psoriasis. Our findings provided evidence that KRT16 gene silencing suppresses keratinocyte proliferation and VEGF secretion in psoriasis by inhibiting the activation of the ERK signaling pathway.
In this study, we found that the mRNA expressions of KRT16, ERK1/2, p‐ERK1/2, and VEGF in lesion tissues are obviously higher than in non‐lesion tissues and normal skin tissues. It was proposed that many sets of genes were related to psoriasis, or differentially expressed in psoriasis samples.22 It has also been observed that KRT16 shows overexpression in keratinocytes in those skin diseases characterized by hyperproliferation like psoriasis.10 A previous study has demonstrated that KRT16 mRNA levels in psoriatic lesion skin were elevated as compared to the non‐lesion and normal skin.21 Psoriatic skin exhibits obviously elevated keratinocyte proliferation with various abnormal signaling pathways, such as the ERK pathway, which has been reported to be mainly activated by growth factors.23, 24 There is growing evidence that ERK1 and ERK2 have increased expression in lesion tissues compared with non‐lesion tissues and normal skin tissues.24, 25 As an extracellular signal‐regulated kinase, ERK1/2 is almost not expressed in normal skin tissues, but highly expressed in psoriasis vulgaris, which suggested that ERK1/2 may play a key role in the pathophysiology of psoriasis vulgaris.24 VEGF, a key cytokine in skin inflammation and the pathogenesis of psoriasis as well as a major epidermis‐derived vessel‐specific growth factor strongly upregulated in psoriatic skin lesions, is demonstrated to affect the immune system through promoting monocyte activation and chemotaxis.26 VEGF could promote the proliferation of vascular endothelial cells and increase the permeability of blood vessels, and it is secreted by keratinocytes, which is increased in patients with psoriasis vulgaris.27 It has been reported that the VEGF mRNA levels were markedly elevated in some diseases, such as in ductal carcinoma in situ (DCIS) and invasive breast carcinoma as well as in psoriasis.28 It was also suggested that in psoriasis, the amount of VEGF increased significantly and elevated levels of VEGF are shown in plaques of psoriasis.29 Additionally, our study also revealed that the KRT16‐siRNA + PD98059 group had stronger inhibit effect on the protein concentration of VEGF in psoriasis than KRT16‐siRNA and PD98059 (ERK signaling pathway inhibitor) groups. KRT16, used as markers of keratinocyte differentiation and activation,30 was reported to provide an innovative framework of understanding the intricate pathogenesis of several chronic inflammatory skin diseases, such as psoriasis.31 It is known that PD98059 is a flavonoid and a potent inhibitor of mitogen‐activated protein kinase (MEK).32 It was shown that in nerve study, PD98059, as an inhibitor of the mitogen‐activated protein kinase (MAPK) family members MEK1/2, inhibited spinal nerve ligation‐induced (SNL).33 It seems that VEGF, a highly conserved, dimeric, heparin‐binding glycoprotein, specifically has an influence on endothelial cell growth, survival, and permeability.34 The concept of downregulating VEGF concentration in diseases was explored quite intensively in recent years. It has been previously shown that VEGF concentration was decreased due to various reasons.35, 36 Besides, it was also demonstrated that VEGF concentration was decreased owing to acute hypoxia in healthy individuals.37
In conclusion, this study revealed that, via the ERK signaling pathway, KRT16 gene silencing inhibits keratinocytes proliferation and VEGF secretion in psoriasis, which will have great significance for the study of this respect. We hope this study will be helpful for the treatment of psoriasis, and more new targets and synthesis methods will be found in the near future. Cytokines secreted by T cells was reported to form complex networks in psoriasis and the imbalance of T helper (Th)1/Th2 cells may lead to psoriasis.38 It has also been found that Th17 cells interact with STAT3 and MAPK in psoriasis vulgaris and participate in the regulation of psoriasis.39 Whether the silencing of KRT16 gene affects Th1 and Th17 cytokines will be the focus of our next work.
CONFLICT OF INTEREST
We declare that we have no conflicts of interest.
ACKNOWLEDGMENTS
We would like to acknowledge the helpful comments on this paper received from our reviewers. This study was supported by Science and Technology Bureau of Wenling (2016C311142).
Chen J‐G, Fan H‐Y, Wang T, Lin L‐Y, Cai T‐G. Silencing KRT16 inhibits keratinocyte proliferation and VEGF secretion in psoriasis via inhibition of ERK signaling pathway. Kaohsiung J Med Sci. 2019;35:284–296. 10.1002/kjm2.12034
Funding information Administration of Traditional Chinese Medicine of Zhejiang Province, Grant/Award Number: 2017ZB097; Science and Technology Bureau of Taizhou, Grant/Award Number: 1701KY29; Science and Technology Bureau of Wenling, Grant/Award Number: 2016C311142
REFERENCES
- 1. Lai YC, Yew YW. Psoriasis as an independent risk factor for cardiovascular disease: An epidemiologic analysis using a National Database. J Cutan Med Surg. 2016;20:327–333. [DOI] [PubMed] [Google Scholar]
- 2. Hamilton MP, Ntais D, Griffiths CE, Davies LM. Identification, management of psoriasis‐associated comorbidity T. Psoriasis treatment and management ‐ A systematic review of full economic evaluations. Br J Dermatol. 2015;172:574–583. [DOI] [PubMed] [Google Scholar]
- 3. Radtke MA, Reich K, Spehr C, Augustin M. Treatment goals in psoriasis routine care. Arch Dermatol Res. 2015;307:445–449. [DOI] [PubMed] [Google Scholar]
- 4. Jiang M, Li B, Zhang J, Hu L, Dang E, Wang G. Vascular endothelial growth factor driving aberrant keratin expression pattern contributes to the pathogenesis of psoriasis. Exp Cell Res. 2017;360:310–319. [DOI] [PubMed] [Google Scholar]
- 5. Sun Y, Zhang J, Zhou Z, Wu P, Huo R, Bf W, et al. CCN1, a pro‐inflammatory factor, aggravates psoriasis skin lesions by promoting keratinocyte activation. J Invest Dermatol. 2015;135:2666–2675. [DOI] [PubMed] [Google Scholar]
- 6. Cheng H, Xu M, Liu X, Zou X, Zhan N, Xia Y. TWEAK/Fn14 activation induces keratinocyte proliferation under psoriatic inflammation. Exp Dermatol. 2016;25:32–37. [DOI] [PubMed] [Google Scholar]
- 7. Freedberg IM, Tomic‐Canic M, Komine M, Blumenberg M. Keratins and the keratinocyte activation cycle. J Invest Dermatol. 2001;116:633–640. [DOI] [PubMed] [Google Scholar]
- 8. Smith FJ, Fisher MP, Healy E, Rees JL, Bonifas JM, Epstein EH Jr, et al. Novel keratin 16 mutations and protein expression studies in pachyonychia congenita type 1 and focal palmoplantar keratoderma. Exp Dermatol. 2000;9:170–177. [DOI] [PubMed] [Google Scholar]
- 9. Yang L, Fan X, Cui T, Dang E, Wang G. Nrf2 promotes keratinocyte proliferation in psoriasis through up‐regulation of keratin 6, keratin 16, and keratin 17. J Invest Dermatol. 2017;137:2168–2176. [DOI] [PubMed] [Google Scholar]
- 10. Wang YN, Chang WC. Induction of disease‐associated keratin 16 gene expression by epidermal growth factor is regulated through cooperation of transcription factors Sp1 and c‐Jun. J Biol Chem. 2003;278:45848–45857. [DOI] [PubMed] [Google Scholar]
- 11. Bernot KM, Coulombe PA, McGowan KM. Keratin 16 expression defines a subset of epithelial cells during skin morphogenesis and the hair cycle. J Invest Dermatol. 2002;119:1137–1149. [DOI] [PubMed] [Google Scholar]
- 12. Chen YJ, Wang YN, Chang WC. ERK2‐mediated C‐terminal serine phosphorylation of p300 is vital to the regulation of epidermal growth factor‐induced keratin 16 gene expression. J Biol Chem. 2007;282:27215–27228. [DOI] [PubMed] [Google Scholar]
- 13. Theoharides TC, Zhang B, Kempuraj D, Tagen M, Vasiadi M, Angelidou A, et al. IL‐33 augments substance P‐induced VEGF secretion from human mast cells and is increased in psoriatic skin. Proc Natl Acad Sci U S A. 2010;107:4448–4453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Raychaudhuri SK, Maverakis E, Raychaudhuri SP. Diagnosis and classification of psoriasis. Autoimmun Rev. 2014;13:490–495. [DOI] [PubMed] [Google Scholar]
- 15. Schmitt J, Wozel G. The psoriasis area and severity index is the adequate criterion to define severity in chronic plaque‐type psoriasis. Dermatology. 2005;210:194–199. [DOI] [PubMed] [Google Scholar]
- 16. Peric M, Koglin S, Dombrowski Y, Gross K, Bradac E, Buchau A, et al. Vitamin D analogs differentially control antimicrobial peptide/"alarmin" expression in psoriasis. PLoS ONE. 2009;4:e6340. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17. Peyssonnaux C, Eychene A. The Raf/MEK/ERK pathway: New concepts of activation. Biol Cell. 2001;93:53–62. [DOI] [PubMed] [Google Scholar]
- 18. Yu XJ, Li CY, Dai HY, Cai DX, Wang KY, Xu YH, et al. Expression and localization of the activated mitogen‐activated protein kinase in lesional psoriatic skin. Exp Mol Pathol. 2007;83:413–418. [DOI] [PubMed] [Google Scholar]
- 19. Barbieri JS, Gelfand JM. Evaluation of the dermatology life quality index scoring modification, the DLQI‐R score, in two independent populations. Br J Dermatol. 2018. 10.1111/bjd.17419. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Tanigawa H, Miyata K, Tian Z, Aoi J, Kadomatsu T, Fukushima S, et al. Upregulation of ANGPTL6 in mouse keratinocytes enhances susceptibility to psoriasis. Sci Rep. 2016;6:34690. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Bhawan J, Bansal C, Whren K, Schwertschlag U, Group ILPS . K16 expression in uninvolved psoriatic skin: A possible marker of pre‐clinical psoriasis. J Cutan Pathol. 2004;31:471–476. [DOI] [PubMed] [Google Scholar]
- 22. Guo P, Luo Y, Mai G, Zhang M, Wang G, Zhao M, et al. Gene expression profile based classification models of psoriasis. Genomics. 2014;103:48–55. [DOI] [PubMed] [Google Scholar]
- 23. Takahashi H, Ibe M, Nakamura S, Ishida‐Yamamoto A, Hashimoto Y, Iizuka H. Extracellular regulated kinase and c‐Jun N‐terminal kinase are activated in psoriatic involved epidermis. J Dermatol Sci. 2002;30:94–99. [DOI] [PubMed] [Google Scholar]
- 24. Johansen C, Kragballe K, Westergaard M, Henningsen J, Kristiansen K, Iversen L. The mitogen‐activated protein kinases p38 and ERK1/2 are increased in lesional psoriatic skin. Br J Dermatol. 2005;152:37–42. [DOI] [PubMed] [Google Scholar]
- 25. Chen JQ, Man XY, Li W, Zhou J, Landeck L, Cai SQ, et al. Regulation of involucrin in psoriatic epidermal keratinocytes: The roles of ERK1/2 and GSK‐3beta. Cell Biochem Biophys. 2013;66:523–528. [DOI] [PubMed] [Google Scholar]
- 26. Crawshaw AA, Griffiths CE, Young HS. Investigational VEGF antagonists for psoriasis. Expert Opin Investig Drugs. 2012;21:33–43. [DOI] [PubMed] [Google Scholar]
- 27. Li Y, Su J, Li F, Chen X, Zhang G. MiR‐150 regulates human keratinocyte proliferation in hypoxic conditions through targeting HIF‐1alpha and VEGFA: Implications for psoriasis treatment. PLoS ONE. 2017;12:e0175459. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28. Shubbar E, Vegfors J, Carlstrom M, Petersson S, Enerback C. Psoriasin (S100A7) increases the expression of ROS and VEGF and acts through RAGE to promote endothelial cell proliferation. Breast Cancer Res Treat. 2012;134:71–80. [DOI] [PubMed] [Google Scholar]
- 29. Flisiak I, Zaniewski P, Rogalska M, Mysliwiec H, Jaroszewicz J, Chodynicka B. Effect of psoriasis activity on VEGF and its soluble receptors concentrations in serum and plaque scales. Cytokine. 2010;52:225–229. [DOI] [PubMed] [Google Scholar]
- 30. Cardinali G, Kovacs D, Mastrofrancesco A, Cota C, Donati P, Cordiali‐Fei P, et al. hMena: Altered expression in psoriatic skin. Arch Dermatol Res. 2013;305:933–938. [DOI] [PubMed] [Google Scholar]
- 31. Lessard JC, Pina‐Paz S, Rotty JD, Hickerson RP, Kaspar RL, Balmain A, et al. Keratin 16 regulates innate immunity in response to epidermal barrier breach. Proc Natl Acad Sci U S A. 2013;110:19537–19542. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32. Reiners JJ Jr, Lee JY, Clift RE, Dudley DT, Myrand SP. PD98059 is an equipotent antagonist of the aryl hydrocarbon receptor and inhibitor of mitogen‐activated protein kinase kinase. Mol Pharmacol. 1998;53:438–445. [DOI] [PubMed] [Google Scholar]
- 33. Rojewska E, Popiolek‐Barczyk K, Kolosowska N, Piotrowska A, Zychowska M, Makuch W, et al. PD98059 influences immune factors and enhances opioid analgesia in model of neuropathy. PLoS ONE. 2015;10:e0138583. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34. Abadie Y, Bregeon F, Papazian L, Lange F, Chailley‐Heu B, Thomas P, et al. Decreased VEGF concentration in lung tissue and vascular injury during ARDS. Eur Respir J. 2005;25:139–146. [DOI] [PubMed] [Google Scholar]
- 35. Lewallen MA, Burggren WW. Chronic hypoxia and hyperoxia modifies morphology and VEGF concentration of the lungs of the developing chicken (Gallus gallus variant domesticus). Respir Physiol Neurobiol. 2015;219:85–94. [DOI] [PubMed] [Google Scholar]
- 36. Wen J, Wang X, Pei H, Xie C, Qiu N, Li S, et al. Anti‐psoriatic effects of Honokiol through the inhibition of NF‐kappaB and VEGFR‐2 in animal model of K14‐VEGF transgenic mouse. J Pharmacol Sci. 2015;128:116–124. [DOI] [PubMed] [Google Scholar]
- 37. Oltmanns KM, Gehring H, Rudolf S, Schultes B, Hackenberg C, Schweiger U, et al. Acute hypoxia decreases plasma VEGF concentration in healthy humans. Am J Physiol Endocrinol Metab. 2006;290:E434–E439. [DOI] [PubMed] [Google Scholar]
- 38. Trifari S, Kaplan CD, Tran EH, Crellin NK, Spits H. Identification of a human helper T cell population that has abundant production of interleukin 22 and is distinct from T(H)‐17, T(H)1 and T(H)2 cells. Nat Immunol. 2009;10:864–871. [DOI] [PubMed] [Google Scholar]
- 39. Fan B, Li X, Ze K, Xu R, Shi RF, Geng L, et al. Expression of T‐helper 17 cells and signal transducers in patients with psoriasis vulgaris of blood‐heat syndrome and blood‐stasis syndrome. Chin J Integr Med. 2015;21:10–16. [DOI] [PubMed] [Google Scholar]