Validation of novel predictors for early detection of cancer therapeutics–related cardiac dysfunction

ABSTRACT

Background

Early identification of cardiotoxicity of chemotherapy is crucial. Gene expression is considered a promising tool.

Aim

To validate the new speckle tracking values, high-sensitive (Hs) troponin and expression of TNNI3K and RyR2 genes for early detection of cardiotoxicity.

Methods

Fifty patients with cancer breast on Anthracycline chemotherapy were subjected to speckle tracking echocardiography and Hs troponin measurement. Relative expression of TNNI3K and RyR2 genes were determined by RT-PCR.

Results

Fifty female patients with age (43.89 ± 6.4) were included. Fourteen patients (28%) developed cardiotoxicity, diagnosed by decrease GLS > 15%. Compared to GLS, Hs-Troponin has sensitivity 73%, specificity 100%, PPV 78.5% and NPV 100%. Cutoff point of GLS > 10% had sensitivity 95%, specificity 78%, PPV 81% and NPV 84%. Using a cutoff of 24% change in TNNI3K Expression; sensitivity 100%, specificity 74%, PPV 79.5% and NPV 100%. Using a cutoff of 25% in RYR-2 expression; sensitivity 67% and specificity 59% with less PPV and NPV (62% and 64%). Adding GLS change >10% to Hs troponin and TNNI3K expression resulted in highest sensitivity (100%) and specificity (95.5%) with 96% PPV and 100% NPV.

Conclusion

Cutoff point of GLS > 10%, Hs-Troponin and TNNI3K gene expression are reliable test for early detection of cardiotoxicity.

Trial registration number (IRB)

042024100222.

1. Introduction

In recent years, advancements in anticancer treatments have led to improved life expectancy for many patients [1]. However, these patients are at a high risk of complications, with cardiac toxicity emerging as a significant concern associated with anticancer therapies [2]. This toxicity predominantly manifests as heart failure but can also encompass arrhythmias, hypertension, thromboembolism, and increased mortality rates.

Among the various chemotherapeutic agents, anthracyclines are notable for their heightened cardiotoxic effects. The mechanism underlying anthracyclines toxicity is attributed to the formation of reactive oxygen species and their interaction with topoisomerase 2, particularly Top2β, which is prominently expressed in the adult heart [3]. Anthracyclines also cause dysregulation of calcium levels, leading to an increase in intracellular calcium through different mechanisms causing impairment in both systolic and diastolic functions of the heart [4].

Epigenetics also has a role in Anthracycline-induced cardiotoxicity through affection DNA methylation or histone modifications which may activate or inhibit gene expression [4]. Doxorubicin, which is a common anthracycline, downregulates the DNA methyltransferase 1 (DNMT1) enzyme activity which leads to reduction in the DNA methylation process. This hypomethylation leads to dysregulation of some genes [4].

Cardiotoxicity has been defined using various classifications. Recent guidelines defined Cancer therapeutics – related cardiac dysfunction (CTRCD) as a decrease in the left ventricular ejection fraction (LVEF) by echocardiography of >10% points to a value below the lower limit of normal [5].

Early detection of cardiac dysfunction can be diagnosed by decrease in global longitudinal strain (GLS) >15% and/or increase troponin level above 99^th percentile [5].

The cardiac-specific kinase (TNNI3K) role in regulating cardiac remodeling has remained enigmatic and subject to controversy. While certain studies demonstrate its ability to induce cardiomyocyte hypertrophy in vitro and enhance cardiac function while safeguarding against ischemic injury in vivo, others suggest that its overexpression may hasten the progression of heart failure in murine models [6–9].

Type 2 ryanodine receptors (RyR2) are predominantly present in cardiac muscle [10].

They play a crucial role in excitation-contraction coupling and in the pathophysiology of heart failure and fatal arrhythmias [10].

During heart failure, RyR2 channels exhibit abnormal activity, often described as “leakiness,” failing to maintain closure during the diastolic phase. Consequently, this dysregulation leads to an elevated frequency of spontaneous Ca + 2 sparks and disrupted Ca + 2 handling within cardiomyocytes and reduction in systolic contraction strength [11,12].

Thus, the literature points to the potential roles of new speckle tracking values, both TNNI3K and RyR2 and their protein products. However, the great majority of clinical data focuses on one gene only. Our literature search failed to find any report of either genes (TNNI3K nor RyR2) or molecules analyzed together. In order to fill this gap in the knowledge, we therefore hypothesized the role of altered expression of both genes in early detection of CTRCD.

2. Material and methods

2.1. Study participants

A prospective observational study enrolled 50 female patients (age between 30 and 50 years) with newly diagnosed as breast cancer in Assiut University Hospital. All patients were candidates for receiving Anthracycline (Doxorubicin) and were at low risk for cardiac toxicity defined using HFA-ICOS Risk Tool [5,13]. The sample size was calculated using the G Power program with a power of 0.95 and a hypothetical effect size of 0.35. Exclusion criteria: Insufficient echocardiographic image quality, valvular heart disease, arrhythmia, hypertensive heart disease, diabetes mellitus, cardiomyopathy, chronic renal failure and chronic obstructive lung disease. We excluded these patients and included only low-risk patients to avoid any confounder that may affect our results.

2.2. Ethical disclosure

The study protocol was approved by the Assiut University Faculty of Medicine Institutional Review Board under IRB approval number 042024100222 and was conducted in accordance with the guidelines of the Helsinki Declaration. All participants signed an informed consent form before conducting the study.

2.3. Assessment of clinical and laboratory parameters

Baseline characteristics, clinical data, electrocardiography and baseline high sensitive (Hs) troponin level of study participants were collected.

2.4. Echocardiographic data

Conventional transthoracic echocardiography (TTE) and longitudinal speckle strain were performed before and at 3 and 6 months of chemotherapy treatment were done for all patients.

For 2-dimensional TTE, all views were obtained with a standard echocardiography with a multifrequency transducer.

The LV cavity dimensions and LVEF were determined by M. Mode and modified biplane Simpson’s method [14].

For speckle-tracking echocardiographic (Longitudinal strain), Apical 4- and 2-chamber view acquisitions for longitudinal strain were obtained and recorded by using conventional two-dimensional gray-scale echocardiography during breath holding with stable electrocardiographic tracing, then the images analysis was performed offline. The optimal frame rate for the two-dimensional image acquisition was set between 60 and 110 frames per second [15].

According to last European guidelines of cardiology criteria [5], CTRCD was diagnosed as follows: either decreasing LVEF > 10% points to a value below the lower limit of normal or LVEF ≥ 50% plus decreasing GLA > 15% from baseline and/or increasing troponin level above 99^th percentile [5].

2.5. Laboratory investigations

Venous blood was collected from each patient at baseline before treatment. Serum urea, creatinine, creatine kinase, creatine kinase MB, Hs Troponin, HbA1c, total cholesterol, triglycerides, and high-density lipoprotein were performed by the routine hospital clinical chemistry service (which subscribes to the national quality control service) by established methods. Low-density lipoprotein was calculated according to the Friedewald formula.

2.6. Assessment of TNNI3K and RyR2 gene expression

Total RNA was extracted from EDTA-anticoagulated whole blood using Direct-zol™ RNA Miniprep Plus (Zymo Research, Irvine, CA, USA), followed by a SensiFAST™ SYBR® Hi-ROX One-Step Kit for cDNA by RT-PCR (Meridian Bioscience, Memphis, TN, USA).

The reactions were performed in a thermal cycler (MJ Research, Inc., Waltham, MA, USA) and the reaction products stored at −20°C until the subsequent step 2. The thermal profile consisted of 20 min at 46°C for reverse transcription (RT) and then at 95°C for 1 min for RT inactivation. Gene expression was standardized to that of GAPDH as a control and is registered as fold change.

We applied 1 μM of each forward and reverse primer specific for each target gene: Troponin I interacting kinase (TNNI3K):

(NM_015978.2: c.1441C > T), 5′‐CTAGAGGCTGCTGATGTGCTGTTG‐3′; reverse 5′‐GGCGAGTTACCTGTTCATGTCCATAG‐3′. for GAPDH were 5′-AGCCACATCGCTCAGACAC-3′ (sense) and 5′-GCCCAATACGACCAAATCC-3′ (antisense). GAPDH was used as an internal control for PCR quality ′. Ryanodine receptor 2 (RYR2) (NM_001035.2): 5′-CCGACTTCAGACTTTTCTGGAATTA-3′ and 5′-AAGTGCAAGAGGGTCATGAAAATAC-3′. The products were hybridized to the SYBR green dye. The mean expression levels of GDF15 and TERT mRNA relative to those of GAPDH were analyzed utilizing the quantitation-comparative Ct (ΔΔCt) method on a fluorescence quantitative PCR analyzer (ABI 7500, Applied Biosystems, Foster City, CA, USA).

Gene expression profile modulations were evaluated comparing Ct values between treated and non-treated cells, using the 2-ΔΔCt method. We hypothesized a difference in relative expression of TNNI3K or RyR2 of at least 12.5% compared to expression in the controls

2.7. Follow up data

All patients were followed up at 3- and 6-month intervals. Follow-up included echocardiographic, laboratory and TNNI3K and RyR2 gene expression assessment.

2.8. Statistical analysis

The ROC curve was employed to illustrate the diagnostic performance of various modalities, analyzed through the area under the curve (AUC), standard error (SE), and 95% confidence interval (CI). We calculated validity statistics, including sensitivity, specificity, and positive and negative predictive values (PPV & NPV). To achieve an alpha level of 80%, we targeted a total of 40 patients in the cohort study; to enhance robustness, we recruited more than this minimum requirement.

A sample size of 80 provides sufficient power to detect a Pearson correlation coefficient exceeding 0.31. However, in post-hoc analyses, we observed a significant number of patients with CTRCD and examined their results in relation to those without CTRCD. A sample size of 25 per group offers adequate power to detect a 16% difference in a test statistic compared to a baseline group, while a sample size of 50 enables the detection of a Pearson correlation coefficient greater than 0.39. Categorical data were analyzed using the chi-squared test, continuous data were assessed with either Student’s t-test or the Mann-Whitney U-test, and correlations were evaluated using Pearson’s method. All analyses were conducted using Minitab Release 21

3. Results

Our study included 50 female patients with newly diagnosed cancer breast. Their age was 43.89 ± 6.4 (range: 30–55 yr). All patients received Anthracycline chemotherapy in Assuit university hospitals and follow-up was done after 3- and 6-months intervals.

3.1. Echocardiographic findings and troponin level

During the study 14 patients (28%) developed CTRCD as diagnosed by previously mentioned criteria [5].

In CTRCD group, GLS values decreased from baseline during 6 months follow-up more than 15%. They were significantly lower than those of non CTRCD (p value = 0.01). Also, there was a significant increase in the Hs-Troponin in CTRCD than non-CTRCD group during 6-month follow-up (p value = 0.021), but there were no significant changes in EF either by M. Mode or Simpson method from baseline to 3 and 6 month (p value 0.467 and 0.121 respectively) with all patients had EF more than 50%. As shown in Table 1, Figure 1.

Table 1.

Diagnostic modalities differences in patients with versus without CTRCD.

	CTRCD (n = 14)	No CTRCD (n = 36)	P-value
Age/years (Mean ±SD)	43.68 ± 6.9	44.67 ± 4.2	= 0.670*
GLS
Baseline	−21.79 ± 1.8	−20.23 ± 0.8	= 0.051*
At 3-months	−17.48 ± 1.9	−20.59 ± 2.1	= 0.003*
At 6-months	−15.53 ± 1.7	−19.61 ± 1.7	= 0.001*
P-value**	= 0.010	= 0.041
EF by M. Mode %
Baseline	64.00 ± 1.8	69.91 ± 1.7	= 0.270*
At 3-months	60.50 ± 2.3	61.63 ± 2.0	= 0.154*
At 6-months	58.00 ± 2.8	59.54 ± 2.2	= 0.313*
P-value**	= 0.467	= 0.651
EF by Simpson %
Baseline	62.76 ± 2.9	64.48 ± 2.0	= 0.337*
At 3-months	59.17 ± 3.1	60.59 ± 2.8	= 0.282*
At 6-months	55.50 ± 2.9	57.41 ± 1.7	= 0.190*
P-value**	= 0.121	= 0.524
Hs-Troponin (ug/L)
Baseline	0.006 ± 0.001	0.005 ± 0.001	= 0.705
At 3-months	0.017 ± 0.001	0.016 ± 0.001	= 0.935
At 6-months	0.019 ± 0.001	0.014 ± 0.001	= 0.005
P-value**	= 0.021	= 0.009

*Independent t-test was used to compare the mean difference. **Repeated Measure One-way ANOVA was used to compare means over Time. Data are mean (standard deviation) or number of subjects. CTRCD: cancer therapeutic related cardiac dysfunction, GLS: global longitudinal strain, EF: ejection fraction.

Figure 1.

Difference in the Mean GLS Levels in patients with vs. Without CTRCD at 3 and 6 month follow up. CI: confidence interval; CTRCD: cancer therapeutic related cardiac dysfunction, GLS: global longitudinal strain.

3.2. TNNI3K and RyR2 gene expression

In our study, we found a significant difference between gene expression of TNN13K and RYR-2 in patients with CTRCD compared with other group (p value = 0.002 & <0.001 respectively) as shown in Table 2 and Figure 2 and 3.

Table 2.

Gene Expression among patients with vs. without CTRCD.

	Baseline	3-month follow-up	6-month follow-up	P value
TNNIK3:				0.006 0.265
CTRCD	17.56 ± 3.9	19.71 ± 5.1	19.54 ± 5.5
Non CTRCD	18.31 ± 4.4	20.13 ± 5.6	19.57 ± 5.4
RyR2:				0.011 0.135
CTRCD	19.81 ± 3.6	22.05 ± 3.9	21.23 ± 3.7
Non CTRCD	19.18 ± 3.1	21.43 ± 3.5	21.07 ± 3.1
Gene Expression%
TNNI3K:				0.002
CTRCD	2.02 ± 0.1
Non CTRCD	1.00 ± 0.1
RyR2:				<0.001
CTRCD	7.56 ± 0.4
Non CTRCD	1.00 ± 0.1

*Independent t-test was used to compare the mean differences; CTRCD: cancer therapeutics related cardiac dysfunction; RYR-2: Type 2 ryanodine receptors, TNNI3K: Troponin I interacting kinase.

Figure 2.

Difference in the Gene Expression in patients with vs. without CTRCD. CTRCD: cancer therapeutics related cardiac dysfunction, RYR-2: Type 2 ryanodine receptors, TNNI3K: Troponin I interacting kinase.

Figure 3.

Difference in the Mean ct Gene Levels in patients with CTRCD vs. without CTRCD. CTRCD: cancer therapeutics related cardiac dysfunction, RYR-2: Type 2 ryanodine receptors, TNNI3K: Troponin I interacting kinase.

3.3. Diagnostic performance of GLS change >10%, Hs troponin, TNNI3K and RyR2 gene expression for CTRCD Prediction

As we noticed in Table 3 and Figure 4 Hs troponin and TNNI3K have highest sensitivity but GLS > 10% has highest specificity. RyR-2 is both less sensitive and less specific. When we combined GLS Change > 10% + hs- Troponin + TNNI3K expression, the predictive accuracy was Excellent (0.924 (95% CI 0.831–1.000)), p value = 0.002). Using a cutoff of 10% for GLS & 11 ng/L for Hs troponin & 24% for TNNI3K expression, the sensitivity was 100%, the specificity was 95.5%. Additionally, PPV was 96% and NPV was 100%.

Table 3.

Diagnostic performance of 10% GLS Change for CTRCD Prediction, analyzed as area under the curve (95% CI).

Parameter	GLS Change (>10%)	Hs-Troponin	TNNI3K	RYR-2	GLS + hs-Troponin+ TNN13K
AUC (95% CI)*	0.865	0.731	0.748	0.678	0.924 (0.831–1.000)
P-value	= 0.002	= 0.038	= 0.029	= 0.188	= 0.002
Cut-off Value	10%	11	24%	25%	10% & 11 ng/L &24%
Sensitivity	95%	73%	100%	67%	100%
Specificity	78%	100%	74%	59%	95.5%
Positive Predictive Value (PPV)	81%	78.5%	79.5%	62%	96%
Negative Predictive Value (NPV)	84%	100%	100%	64%	100%

*AUC = Area under the Curve, CI = Confidence Interval, CTRCD: cancer therapeutics related cardiac dysfunction GLS: global longitudinal strain, RYR-2: Type 2 ryanodine receptors, TNNI3K: Troponin I interacting kinase.

Bold values mean significant P value which is less than 0.05.

Figure 4.

(a) ROC curve for CTRCD Prediction by GLS Change (value >10%); (b) ROC curve for CTRCD Prediction by Hs-Troponin; (c) ROC curve for CTRCD Prediction by Different Gene Expressions, (d) ROC curve for Cardiomyopathy Prediction by GLS Change >10% + hs-Troponin + TNNI 3KGene Expression. CTRCD: cancer therapeutics related cardiac dysfunction; GLS: global longitudinal strain; RYR-2: Type 2 ryanodine receptors; TNNI3K: Troponin I interacting kinase.

4. Discussion

Anthracyclines serve as the primary treatment option for breast cancer, with their cardiotoxicity significantly impacting the survival, mortality, and prognosis of patients [16,17].

The evolving domain of cardio-oncology seeks to enhance risk evaluation, diagnosis, and management of cardiovascular diseases induced by cancer therapy. Particularly crucial are specific diagnostic algorithms aimed at effectively stratifying risk, monitoring patients, and ensuring long-term follow-up [5,18,19].

In our study 14 patients (28%) developed CTRCD as a result of receiving anthracycline chemotherapy as diagnosed by decrease in GLS > 15%.

Compared with our study, previous studies showed that rate of anthracycline-related toxicity varied between 9.7% and 32% [20–22].

These variations were attributed to several factors, including a previously broader definition of toxicity, differences in the chemotherapy protocols utilized (such as the inclusion of epirubicin, a drug known to be less cardiotoxic than doxorubicin used in older series), and the relatively lower chemotherapy doses currently recommended as first-line therapy for breast cancer [23].

In the present study, we found no notable correlation between age and the incidence of CTRCD. This observation is consistent with earlier studies by Kang et al. [24] and Díaz-Antón et al. [22], who observed no link between age and the onset of cardiomyopathy.

Furthermore, this study revealed a significant decline in global longitudinal strain (GLS) values from baseline to 3 and 6 months among patients who developed CTRCD (p value = 0.01). However, there were no notable changes in left ventricular ejection fraction (EF) measured by either M-Mode or Simpson method from baseline to 3 and 6 months (p value 0.467 and 0.121, respectively). The heightened sensitivity of longitudinal strains in comparison to EF in detecting early cardiotoxicity can be attributed to the regional pattern of chemotherapy-induced cardiac dysfunction. Longitudinal left ventricular mechanics, primarily influenced by the subendocardial region of the myocardium, are particularly sensitive to myocardial diseases [25].

Utilizing a GLS cutoff point of >10%, it demonstrated a sensitivity of 95%, specificity of 78%, a positive predictive value (PPV) of 81%, and a negative predictive value (NPV) of 84%, greatly aiding in the detection of cardiotoxicity.

Regarding high-sensitive cardiac troponin T (cTnT), there was a significant increase in Hs Troponin levels from baseline to 3 and 6 months (0.005, 0.017, and 0.015 respectively) (p value = 0.001).

This was also reported by Kang et al. [24] who revealed that cTnT level were elevated from 0.0010 ± 0.0020 at baseline to 0.0073 ± 0.0038 ng/mL (p < 0.01) at the end of chemotherapy.

Also, Díaz-Antón et al. [22] reported gradually increased cTnT levels, reaching a peak at 96 ± 13 days after chemotherapy (p < 0.001), with 62.5% of patients showed elevated values during treatment. Consequently, recent guidelines have incorporated troponin as a diagnostic tool for CTRCD [5].

However, in the present study, not all patients with a notable reduction in GLS exhibited an increase in troponin levels. This led to a specificity of 100% for high-sensitive troponin, but the sensitivity was 73%. Additionally, the positive predictive value (PPV) was 78.5%, and the negative predictive value (NPV) was 100%.

As for TNNI3K and RYR-2 gene expression, to our knowledge, this is the first study to utilize TNN13K and RYR-2 gene expression to predict the incidence of CTRCD in patients undergoing anthracycline chemotherapy.

Comparison between groups with and without CTRCD regarding gene expression showed that there is a significant difference in gene expressions of TNNI-3K and RYR-2 between patients with and without CTRCD (p value = 0.002 & <0.001, respectively).

Our results were supported by Vagnozzi et al. [26] who stated that patients suffering from cardiomyopathy have shown increased TNNI3K levels in their LV cardiac tissue, suggesting that there is an association between cardiomyopathy and TNNI3K expression. However, little is still known about the mechanism of TNNI3K in cardiomyopathy.

Also, Kumar et al. [27] revealed that TNNI3K expression was significantly elevated among patients with cardiomyopathy.

Moreover, Belevych et al. [28] mentioned that cardiac ryanodine receptor (RyR2) plays a critical role in heart function, regulating the release of Ca2+ from the sarcoplasmic reticulum (SR). Dysfunctional RyR2 is associated with heart failure (HF), characterized by abnormal ‘leakiness’ in both human and animal HF models. This disrupted Ca2+ handling can lead to impaired systolic contraction, irregular contractile and electrical activity, and increased susceptibility to cell death and other detrimental processes, ultimately contributing to HF development.

Qiu et al. also reported that anthracycline-induced cardiomyopathy is associated with alterations in genes involved in calcium exchange regulation, notably impacting the function of the ryanodine receptor, calcium storage gene, Sarco/endoplasmic reticulum ATPase (SERCA2a), and phospholamban. Ultimately, these changes contribute to impairment of both cardiac systolic and diastolic functions [29].

Regarding diagnostic performance of TNNI3K and RyR2 gene expression for CTRCD Prediction. ROC analysis shows predictive accuracy of the models for TNNI3K gene Expression was Good (AUC = 0.748 (95% CI 591–961), p value = 0.029). Moreover, using a cutoff of 24% change in TNNI3K Expression; the sensitivity was 100% and the specificity was 74%. Additionally, PPV was 79.5% and NPV was 100%. While the predictive accuracy of the models for RYR-2 expression was (0.678 (95% CI 0.480–0.876), p value = 0.188). However, using a cutoff of 25% change in RYR-2 expression; the sensitivity was 67% and the specificity was 59%. Additionally, PPV was 62% and NPV was 64%.

Our findings suggest that TNNI3K gene expression serves as a superior predictor for the early detection of CTRCD compared to RYR-2 gene expression, potentially offering a valuable tool for early CTRCD prediction. However, to date, there have been no studies in the literature evaluating the accuracy of these gene expressions for early CTRCD detection. Moreover, the incorporation of GLS change >10% alongside high-sensitivity troponin and TNNI3K expression yielded the highest sensitivity (100%) and specificity (95.5%), with a positive predictive value (PPV) of 96% and a negative predictive value (NPV) of 100%. This combination demonstrates the utmost sensitivity and specificity for the early detection of CTRCD.

However, our study is a single study design with small sample sizes which is susceptible to bias. To avoid this, we used reliable methods and did careful analysis of data. We also advise against overgeneralization of findings and recommend larger and more diverse studies.

4.1. Limitations

The present study was limited by a small sample size, a single-center design, and a relatively short follow-up period. To corroborate our findings, further comparative studies with larger sample sizes and extended follow-up durations are imperative. Moreover, such investigations can aid in determining the optimal treatment strategy with minimal cardiotoxicity incidence and in identifying the risk factors for adverse events.

5. Conclusion

We are confident that our data warrants a larger study to investigate the mechanisms and implications of these findings. We speculate that such research may further contribute to our understanding of the pathogenesis and accurate noninvasive method for early detection of cardiotoxicity after chemotherapy and might facilitate the early intervention in these patients. The incorporation of GLS change >10%, high-sensitivity troponin, and TNNI3K expression has yielded the highest sensitivity and specificity.

Funding Statement

This work was funded by Faculty of Medicine Grant Office Assiut University (QAU), Grant number [2018-01-03-001].

Author contributions

Marwan S. Mahmoud contributed to the analysis and interpretation of the data, drafting the article, and writing of manuscript.

Moustafa Morsy: contributed to data collection, achieving clinical work, statistical analysis.

Mohamed Abdel Ghany: contributed to conception and design and writing of manuscript.

Naglaa K Idriss: contributed to conception and design, achieving laboratory work, and revising the manuscript.

Hatem Abdelrahman Helmy & Yehia T. Kishk: contributed to conception and design, revising and approving the manuscript.

Disclosure statement

The authors have no relevant affiliations or financial involvement with any organization or entity with a financial interest in or financial conflict with the subject matter or materials discussed in the manuscript. This includes employment, consultancies, honoraria, stock ownership or options, expert testimony, grants or patents received or pending, or royalties.

Article highlights

• Cardiotoxicity is a serious side effect of many anticancer treatments, especially anthracyclines.

• Early identification of cardiotoxicity is of paramount importance for prevention of complications.

• Global longitudinal strain (GLS) in echocardiography and gene expression is considered a promising tool for early detection of cardiotoxicity.

• GLS change >10% is an accurate new cutoff point for early detection of cardiotoxicity.

• TNNI3K gene expression is a reliable and accurate diagnostic test for early detection of cardiotoxicity.

• Using a cutoff of 24% change in TNNI3K Expression resulted in sensitivity 100%, and specificity 74%.

• RYR-2 expression is less sensitive and less specific.

• Adding GLS change >10% to Hs troponin and TNNI3K expression resulted in highest sensitivity and specificity.

Ethical declaration

The study protocol was approved by the Assiut University Faculty of Medicine Institutional Review Board under IRB approval number 042024100222 and was conducted in accordance with the guidelines of the Helsinki Declaration. All participants signed an informed consent form before conducting the study.

Data availability statement

The data that support the findings of this study are available from the corresponding author upon reasonable request.