Encephalitozoon intestinalis infection in free-ranging giant anteater (Myrmecophaga tridactyla) and armadillo species (Priodontes maximus, Euphractus sexcinctus, Cabassous squamicaudis)

Abstract

Microsporidia are emerging, opportunistic fungi that infect a diverse population of vertebrates and invertebrates. Mammals of the superorder Xenarthra can harbor and transmit several pathogens, acting as important sources of infection for spreading various zoonoses. Microsporidia have not yet been described in this group of animals, the aim of this study was to analyze the occurrence of the zoonotic microsporidian Encephalitozoon intestinalis, Encephalitozoon cuniculi and Enterocytozoon bieneusi in the feces of giant anteater (Myrmecophaga tridactyla) and armadillo species (Priodontes maximus, Euphractus sexcinctus, Dasypus novemcinctus, Cabassous squamicaudis) monitored by Wild Animal Conservation Institute (ICAS) in Brazil. Fecal samples (n=127) were subjected to DNA extraction with the QIAamp Fast DNA Stool Mini Kit. Amplification by PCR was performed with generic primers and the product generated from this reaction was subjected to nested PCR with specific primers. Eleven samples tested positive for E. intestinalis, two from M. tridactyla (2/56, 3.6%), seven from E. sexcinctus (7/51, 13.7%), two from P. maximus (2/11, 18%) and one from C. squamicaudis (1/3, 33.3%). There was a predominance of positive results in adult animals, of both sexes across and in the Pantanal and Cerrado biomes. In conclusion, the prevalence in Xenarthra was 9.4%, with a higher occurrence in armadillos than in anteaters. Therefore, the species of wild mammals studied here should be considered reservoirs of microsporidian pathogens and have a relevant role in the concept of One Health.

INTRODUCTION

The phylum Microsporidia comprises more than 220 genera and 1,700 species of obligate intracellular opportunistic fungi that infect a wide range of vertebrate and invertebrate hosts, being present in all biomes [26, 34, 37]. The main route of transmission is oro-fecal through spores, the infectious form released by hosts throughout their biological cycle. The spores have a thick chitinous wall, giving the pathogen resistance to environmental adversities [12, 26].

Some species of Microsporidia that infect humans are also capable of infecting other animals, supporting zoonotic transmission, although there is no evidence yet for all species of this phylum [15, 36]. Among the 17 described zoonotic microsporidians, Enterocytozoon bieneusi, Encephalitozoon intestinalis, Encephalitozoon hellem, and Encephalitozoon cuniculi are the most reported species in mammalian infections [13, 16, 33, 35].

The risk of transmission from animals to humans is linked to close contact with infected wild or domestic animals, pets, or livestock, as well as exposure to water, food, or aerosols containing microsporidian spores [36]. This risk is especially high in ecosystems heavily influenced by deforestation, which results in the proximity of wildlife to human and domestic animal populations, favoring the spread of diseases at all levels [31].

One state that has been significantly affected by this condition is Mato Grosso do Sul in central Brazil, which has a great biodiversity, covering three distinct Neotropical biomes: Cerrado, Atlantic Forest, and Pantanal, presenting high faunal diversity [4, 5]. The state is home to several species that have relevant ecological roles and are vulnerable to extinction, especially Xenarthra, a superorder that includes anteaters, armadillos and sloths. This includes Myrmecophaga tridactyla (giant anteater), Priodontes maximus (giant armadillo), Euphractus sexcinctus (yellow armadillo), Dasypus novemcinctus (nine-banded armadillo) and Cabassous squamicaudis (southern naked-tailed armadillo).

Myrmecophaga tridactyla is a Central and South America mammal listed as vulnerable to extinction by the International Union for Conservation of Nature [19], predominantly inhabiting the Cerrado. This species was chosen to name the Anteaters & Highways Project by the Wild Animal Conservation Institute (ICAS), which promotes actions aimed at conserving and preserving threatened species. The largest species of armadillo, P. maximus, is also listed as a vulnerable species on the IUCN red list [20] and can be found in all three biomes. Despite their importance, infections by Microsporidia have never been reported in the Xenarthra group, but other pathogens have been described to harbor these animals [21].

Given the vulnerability of these species of mammals and their importance for Brazilian biomes, the objective of this work was to analyze the occurrence of the zoonotic microsporidian E. cuniculi, E. intestinalis, and E. bieneusi in the feces of free-ranging armadillos and giant anteaters from Mato Grosso do Sul.

MATERIAL AND METHODS

Sampling

A total of 127 fecal samples were analyzed from five different species of both sexes and all ages (Table 1), belonging to M. tridactyla (n=56), P. maximus (n=11), E. sexcinctus (n=51), D. novemcinctus (n=6) and C. squamicaudis (n=3). The samples from the other species are all from different individuals. All these samples were donated by ICAS, located in Campo Grande, Mato Grosso do Sul, Brazil (7° 36’ 0” S, 37° 48’ 0” W). They belonged to free-ranging animals from the Cerrado and Pantanal biomes (Fig. 1), collected by veterinarians responsible for the fieldwork of Anteaters & Highways Project and Giant Armadillo Conservation Program. Both research projects take place under licenses approved and issued by the Chico Mendes Institute for Biodiversity Conservation (ICMBIO n◦ 27587-15 and n◦ 53798, respectively). Two methodologies were used for collecting samples: directly from the rectum of anesthetized animals or from the ground immediately after defecation. The fecal samples were placed in preservative-free collection tubes and frozen at −20° C for a maximum of four weeks and sent to the Research Center of Universidade Paulista (UNIP), Indianópolis campus, Laboratory of Molecular and Cellular Biology, where they were also kept under the same conditions of refrigerated and thawed on the day of DNA extraction.

Table 1. Primers used for the diagnosis of Microsporidia through PCR in Xenarthra.

Microsporidia	Primer name	Forward sequence	Reverse sequence	Reference
Generic	GENF/GENR	CACCAGCTTGATTCTGCCTG	GACGGGCGGTGTGTACAAAG	[7]
Enterocytozoonbieneusi	EBIEF1/ EBIER1	GAAACTTGTCCACTCCCTTACG	CCATGCACCCACTCCTGCCATT	[6]
Encephalitozooncuniculi	ECUNF/ECUNR	ATGAGAAGTGATGTGTGTGCG	TGCCATGCACTCACAGGCATC	[8]
Encephalitozoonintestinalis	ISINTF/SINTR	TATGAGAAGTGACTTTTTTTC	CCGTCCTCGTTCTCCTGCCCG	[7]

Fig. 1.

Map of the Brazilian biomes using QGIS 3.34.1 software, highlighting the state of Mato Grosso do Sul, with the delimitation of its biomes and the approximate location where the animals in this study were found. The Sirgas 2000 Geographic Coordinate System and the 2023 IBGE cartographic maps were used.

Molecular assays

DNA extraction and nested PCR: Individualized fecal samples were thawed, and 220 mg separated into tubes with a capacity of 2 mL. DNA extraction was performed using the commercial QIAamp Fast DNA Stool^® Mini Kit (Qiagen, Dusseldorf, Germany), and processed according to the manufacturer’s instructions. In addition, a pretreatment was carried out to release the DNA of the spores by heating at 95°C for five mins in a water bath and freezing for five min in dry ice was performed [29]. DNA was eluted in 100 µL of AE buffer and stored at −20°C until PCR amplification.

The nested PCR technique was used in this study. In the first PCR, generic forward and reverse primers were used, amplifying a 1,216 bp fragment [6, 7, 22]. Next, specific primers were used to identify the main species of Microsporidia as described in Table 1. The first PCR was carried out with a final volume of 25 µL each, containing: 5 µL of DNA, 13.5 µL of ultrapure water, 5 μL of 5X buffer (containing 1.5 mM MgCl₂), 0.2 mM of each deoxynucleotide triphosphate (dATP, dCTP, dGTP and dTTP) (Invitrogen™, Walthan, EUA), 0.3 μM of each primer (Exxtend, São Paulo, São Paulo, Brazil) and 1.25 U of GoTaq^® DNA Polymerase (Promega, São Paulo, Brazil). The 3.0 μL volume of the first PCR was transferred to new tubes and subjected to the second reaction using species-specific primers.

The first and second PCR were incubated in a thermocycler (Mastercycler Gradient, Eppendorf), and subjected to the following conditions: initial denaturation at 95°C for 5 min; followed by 35 amplification cycles consisting of denaturation at 95°C for 1 min, annealing at 55°C for 1 min and extension for 60 sec; and a final extension at 95°C for 10 min.

The samples amplified in the second PCR were stained with 0.5 µL of SYBR ™ Safe (Invitrogen) and subjected to electrophoresis in a 1.5% agarose gel (Amersham Bioscience, Amersham, UK), under a current intensity of 6v/cm. Fragment size was estimated by comparison with the 100 bp Plus DNA Ladder molecular weight marker (Invitrogen). The gel was visualized under an ultraviolet light source (Life Technologies, Carlsbad, CA, USA).

For the positive control, 100 μL purified spores (2 × 10⁸ spores per mL) of E. intestinalis and E. cuniculi were used with 100 μL of ultrapure water, where the extraction and amplification of DNA occurred under the same conditions as the samples analyzed in this study.

The negative control was carried out through the analysis of the products used during the procedures, thus guaranteeing the absence of contamination of the samples through the buffers or primers used. The amplified products from each positive sample were purified, and the concentration was estimated at 10 ng/μL, as required for sequencing by Sanger’s method.

Sequencing and phylogenetic analysis: The sequencing reactions were performed commercially by the company Genomic Engenharia Molecular (São Paulo, Brazil, https://genomic.com.br/). Quality control of the reactions was performed by the company, using pGEM 3Zf (+) and primer M13 (−21) provided by kits specific for sequencing reactions. The nucleotide sequences analyzed in this study ranged from 435 bp to 452 bp in length. The sequences were aligned and submitted to the BLAST system (Basic Local Alignment and Search Tool) for comparison with homologous sequences in the NCBI GenBank database (https://blast.ncbi.nlm.nih.gov/Blast.cgi). The alignment of the consensus sequences was performed with the aid of Clustal W and BioEdit Sequence Alignment Editor [14]. Phylogenetic analyzes were performed using the Mega software program version 11 (Phoenix, AZ) (http://www.megasoftware.net/m_test_reliab.html) [39] and evolutionary distances were determined by the Neighbor-Joining method (NJ) with Kimura 2-parameter and Tamura-Nei models [21]. A total of 1,000 pseudo-replicas were used to support variability in statistical inferences. The generated sequences were deposited in GenBank under the numbers PP871711 to PP871715 for E. intestinalis rRNA gene. We also analyzed the percentage of identity of each sequence using the BLASTn tool.

RESULTS

Of the 127 fecal samples from Xenarthra, 12 (9.4%) were positive for Microsporidia, with all positive samples belonging to the species E. intestinalis in the region of Mato Grosso do Sul (Table 2, Fig. 1). When analyzing the mammals, the prevalence of E. intestinalis in the anteater M. tridactyla (order Pilosa) was 3.6% (2/56) (Table 2) and two positive giant anteater samples for E. intestinalis belonged to a female and her offspring.

Table 2. Fecal samples of anteaters and armadillos collected and analyzed by species, age and sex of each species, number of positive samples for Microsporidia (Encephalitozoon intestinalis), and percentage within the host species.

Mammal species	Popular name	Analyzed samples	Samples by sex	Samples by age	Positive samples	Percentage of positive samples
Myrmecophaga tridactyla	Giant Anteater	56	26 male 30 female	19 cubs 18 young 19 adults	1 female adult 1 male cubs	3.8
Cabassous squamicaudis	Southern Naked-Tailed Armadillo	3	2 male 1 female	3 adults	1 male adult	33.3
Priodontes maximus	Giant Armadillo	11	2 male 9 female	1 cub 10 adults	2 female adults	18.0
Euphractus sexcinctus	Yellow Armadillo	51	30 male 21 female	1 cub 3 young 47 adults	1 female adult 6 male adults	13.7
Dasypus novemcinctus	Nine-Banded Armadillo	6	4 male 2 female	6 adults	0	0

In armadillos (order Cingulata), the occurrence of E. intestinalis was 12.9%, with 10 animals testing positive among the 77 samples studied (Table 2). This included seven E. sexcinctus (7/57, 13.7%), two P. maximus (2/11, 18%), and one C. squamicaudis (1/3, 33.3%). No positive samples were found for D. novemcinctus (0/6). There was a predominance of positive results in adult animals of both sexes across the Pantanal and Cerrado biomes.

The samples analyzed with direct specific primers (SINTF/SINTR) tested negative. However, analysis performed by PCR with generic primers (GENF/GENR) followed by nested PCR with specific primers (SINTF/SINTR) detected 12 positive samples, as shown in Fig. 1 available in the Supplementary data. Through sequencing analysis, it was possible to obtain the sequence of E. intestinalis in five positive samples, confirming the amplification of the rRNA gene by nested PCR for this species. The other seven sequences did not have a good quality signal, probably due to DNA degradation, and were not used in the analysis. The results of the analyzed clusters are shown in Fig. 2, through the phylogenetic tree. The percentage of identity of each analyzed sequence can be found in the Supplementary Table 1.

Fig. 2.

Phylogenetic relationships of Encephalitozoon intestinalis are inferred from the Neighbor-Joining analysis of the rRNA gene. Numbers on branches are percentage bootstrap values from 1,000 replications. The evolutionary distances were computed using the Kimura 2-parameter method [18]. The sequences obtained in this study are marked with a triangle. Reference sequences for each species are named by their respective accession numbers in NCBI database. Positive samples (45, 54, 57, 58 and 60) included in the phylogenetic tree were deposited in GenBank and can be accessed by numbers PP871711 to PP871715 respectively. Evolutionary analyses were conducted in MEGA11 [39].

DISCUSSION

Initially, E. intestinalis was known as Septata intestinalis, but molecular analyses have shown that it belongs to the genus Encephalitozoon [16]. This genus has a significant importance in human health, since it has a potential zoonotic infection [9]. In most studies involving wild mammals, the species E. bieneusi is more frequently found [11, 23]. However, in the present study, E. intestinalis was detected for the first time in the feces of Xenarthra with 9.4% of prevalence in M. tridactyla, E. sexcinctus, P. maximus, and C. squamicaudis. Given the zoonotic importance of this species of microsporidium, these results are highly significant and show the need to include this species of microsporidium in epidemiological studies.

We used pre-treatment with thermal shock to improve the results obtained. Of the 127 samples, 9.4% were positive for E. intestinalis, a number that might be underestimated due to the mentioned characteristics of the spore wall and the presence of various PCR inhibitors in fecal samples of environmental origin, factors that hinder their genetic expression [29].

As there are no previous descriptions using free-ranging mammals as a basis for comparison, a similar result was identified in captive red pandas (Ailurus fulgens–4%, 8/198), however the study used generic primers for the genus Encephalitozoon which did not allow species-level identification [40]. There are reports of various pathogens affecting the giant anteater, including bacterial, viral, and fungal infections [1]. More recently, the first case of natural SARS-CoV-2 infection in this mammal was described [30]. M. tridactyla is a vulnerable and endangered species. In Brazil, it is considered possibly extinct in the states of Rio de Janeiro, Espírito Santo, and Santa Catarina, and at significant risk of disappearing in Central America [19]. The emergence of a pathogen for an endangered species poses a potential threat to its conservation, making it necessary to expand its management plan for preservation.

A rare and important finding was that the two positive giant anteater samples for E. intestinalis belonged to a female and her offspring. Female giant anteaters generally have a single offspring per gestation with a long period of parental care, during which the offspring remains on the mother’s back for 6 to 9 months until becoming independent [28]. Initially, their diet is based on breastfeeding; however, as they grow, they begin to adopt their mother’s feeding habits [27]. Thus, we can hypothesize that both became infected by ingesting contaminant spores in food (i.e., ants and termites) or water in nature.

Other zoonoses have been identified in armadillos, such as coccidioidomycosis, Hansen’s disease, toxoplasmosis, and Chagas disease. These diseases, which can be transmitted to other mammals and humans through the consumption of armadillo meat, the use of their shells to make ornaments, or for medicinal purposes [12]. Given this situation, the prevalence of E. intestinalis in armadillos is a concerning finding considering these zoonotic aspects.

Armadillos have diverse foraging habits, feeding on ants, termites, fruits, small vertebrates, and even decomposing food, which makes them predisposed to infection and being reservoirs for various pathogens [3]. In this study, the giant armadillos were geographically located in the Pantanal biome (Fig. 1), a more preserved area with minimal urban interference. In the same area, there were also the yellow armadillos, nine-banded armadillos, and southern naked-tailed armadillos. The anteaters, on the other hand, are in the Cerrado biome (Fig. 1), a more degraded biome with significant rural interference. It is important to consider that the armadillos and anteaters described in this work share common water sources with other animals on the farm. This facilitates the transmission of these zoonoses between wildlife and the humans that use the resources provided there. Microsporidia can be transmitted through water, which is one of the most probable ways the infection spreads [32].

Microsporidian spores have a rigid wall containing chitin, which gives them greater resistance in the environment [15]. However, this makes extracting their DNA challenging because the wall does not easily break, necessitating the adoption of alternative and/or supplementary techniques for DNA extraction [29]. We used pre-treatment with thermal shock to improve the results obtained. In fecal samples from domestic and wild pigeons (Columba livia f. domestica) were identified 3.6% (34/940) positive for Encephalitozoon spp., while 13% (120/940) were positive for E. bieneusi [17]. These analyses were performed using microscopy and confirmed by PCR. Additionally, molecular analyses using fecal samples identified microsporidia in 24.8% (145/584) of domestic rabbit samples in China, with 2.7% being E. intestinalis [9]. Nested PCR analysis also detected Encephalitozoon spp. in 25% (25/100) of wild bat samples [2]. Other authors utilize this methodology as an effective means of identifying the occurrence of zoonotic microsporidia in animals [25].

Knowing the diseases that affect wild mammals is fundamental for several reasons. This understanding about the health impact on infected animals, whether clinical symptoms are present or not, and thus concerns the conservation of mammal species, many of which are already at risk or endangered. Another significant health issue is the identification of zoonotic pathogens like Microsporidia, where infected animals become sources of the pathogen in nature, posing a risk for epidemics. Species such as M. tridactyla and P. maximus are constantly threatened by the rapid loss of their habitats [10], placing them on the vulnerable species list for extinction according to IUCN and at risk of extinction in most Brazilian states [18]. These species are already included in management plans for protection and preservation, so understanding their zoonoses supports precautionary measures for their conservation. Zoonoses can serve as didactic examples in the context of One Health, illustrating the involvement of all three pillars: environmental, human, and animal [3]. Since Microsporidia are emerging pathogens of global interest, expanding knowledge of their circulation in the environment is crucial for understanding the epidemiology of these pathogens and proposing mitigating measures aimed at One Health, as infection spread across all biomes can occur through consumption of contaminated water and food [24, 38].

Until the present study, there were no reports of the presence of Microsporidia species in the Xenarthra group. Considering the destruction of their habitat due to deforestation and agriculture, these animals are increasingly coming into closer contact with human populations. Monitoring the zoonotic potential of E. intestinalis is an important public health strategy.

POTENTIAL CONFLICTS OF INTEREST

The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.