Skip to main content
Poultry Science logoLink to Poultry Science
. 2025 Feb 17;104(4):104903. doi: 10.1016/j.psj.2025.104903

Mechanisms of the effects of turpiniae folium extract on growth performance, immunity, antioxidant activity and intestinal barrier function in LPS-challenged broilers

Wenjing Song a,b,1, Jiang Chen a,b,1, Gaoxiang Ai a,b, Pingwen Xiong a,b, Qiongli Song a,b, Qipeng Wei a,b, Zhiheng Zou a,b, Xiaolian Chen a,b,⁎
PMCID: PMC11904579  PMID: 39985896

Abstract

Turpiniae folium extract (TFE) has shown anti-inflammatory and immunomodulatory effects in broilers. However, its mechanisms remain unclear. The aim of this study is to investigate the underlying mechanisms by which TFE influences growth performance, jejunal morphology, immune function, antioxidant capacity and barrier integrity in broilers challenged with Lipopolysaccharide (LPS). A total of 240 one-day-old female broilers were randomly divided into four groups with six replicates of ten birds each. A 2 × 2 factorial design with TFE (basal diets supplemented with 0 or 500 mg/kg TFE) and LPS challenge (intraperitoneal injection of 1 mg/kg body weight of sterile saline or LPS at 21, 23 and 25 days of age). The trial lasted for 26 days. The results showed that: Prior to the LPS challenge, dietary supplementation with TFE for 21 days increased both average daily gain (ADG) (P = 0.037) and average daily feed intake (ADFI) (P = 0.045) in broilers. During the LPS challenge period, LPS challenge led to a decline in growth performance and a negative impact on intestinal morphology, while TFE supplementation significantly reversed these adverse effects, as evidenced by increases in ADG (P = 0.004), ADFI (P = 0.046), jejunal villus height (VH) (P = 0.035), the villus height to crypt depth ratio (VH/CD) (P = 0.007) and decreases in the feed-to-gain ratio (F/G) (P = 0.025), jejunal crypt depth (CD) (P = 0.049). LPS induced inflammatory responses and oxidative stress in the jejunum, leading to a significant upregulation of pro-inflammatory factor gene and protein expression, and a marked downregulation of anti-inflammatory and antioxidant gene and protein expression. TFE supplementation mitigated these effects by yielding completely opposite results except for the expression of toll-like receptor 4 (TLR4) protein (P = 0.916). LPS negatively regulates the expression of genes and proteins involved in intestinal mucosal barrier function. In contrast, TFE supplementation significantly upregulated the expression of zonula occludens-1 (ZO-1) (P < 0.001) gene and ZO-1 (P < 0.001), occludin (OCLN) (P < 0.001), claudin (CLDN) (P < 0.001) proteins. In conclusion, dietary supplementation with TFE effectively counteracts the intestinal immune and oxidative stress induced by LPS challenge in broilers, improves intestinal mucosal barrier integrity and tissue morphology, and ultimately mitigates the negative impact of LPS on broiler growth performance. This effect may involve the modulation of the Nrf2 and nuclear factor kappa B (NF-κB) signaling pathways.

Keywords: Turpiniae Folium extract, Broiler, Lipopolysaccharides, Immune and antioxidant function, Intestinal barrier

Introduction

In intensive poultry farming, broiler chickens are frequently exposed to Gram-negative bacteria. Antibiotics are commonly employed to mitigate diseases, infections, and growth disorders caused by Gram-negative bacteria (Roth et al., 2019). However, the use of antibiotics can damage the cell walls of Gram-negative bacteria, resulting in the release of endotoxins (LPS), which may exacerbate the adverse effects (Raetz and Whitfield, 2002). LPS induces oxidative stress, inflammatory responses, growth inhibition, increased intestinal permeability, dysbiosis of the intestinal microbiota, and a range of detrimental side effects, potentially culminating in mortality (Sampath, 2018; Zhang, et al., 2022; Zhong, et al., 2019). Plant extracts are widely studied as natural products because of their high efficiency, environmental friendliness and safety. They have been identified as effective nutritional interventions for alleviating stress (mycotoxins, LPS, transport, heat stress, etc.) (Alzarah, et al., 2021; Umaya, et al., 2021), preventing disease, improving growth performance and intestinal barrier function (Wang, et al., 2024). Investigating the effects of plant extracts on immunity, antioxidant function and intestinal health of broilers under LPS-induced inflammatory models is of significant importance.

LPS plays a crucial role in stimulating innate immune responses and is widely used in studies of animal immunity, inflammation and oxidative stress (Sampath, 2018; Tan and Kagan, 2014). It is well recognized that oxidative stress induced by LPS is an important factor contributing to the decline in growth performance in broilers (Xu, et al., 2022). Administration of LPS, either intraperitoneally or orally, can trigger oxidative stress responses, leading to the accumulation of reactive oxygen species (ROS). This accumulation, in turn, activates inflammatory responses, alters nutrient distribution, impedes growth rates, and contributes to the onset of various diseases (Bi, et al., 2022; Han, et al., 2020; Hu, et al., 2023; Wang, et al., 2019). The mechanism underlying LPS-induced inflammatory responses has been extensively studied. LPS signals through the transmembrane TLR4, activating downstream signaling pathways, such as NF-κB, which promotes the biosynthesis of pro-inflammatory cytokines (Liu, et al., 2017b). Activation of TLR4-, myeloid differentiation factor 88 (MyD88)- and NF-κB-dependent signaling cascades also leads to damage to the intestinal mucosal barrier (Yi, et al., 2016) which subsequently impairs both growth performance and immune function in affected animals.

Turpiniae Folium contain a variety of bioactive compounds, including flavonoids, triterpenes, phenolic acids, alkanes, tannins and alkaloids (Yan, et al., 2022), which exhibit anti-inflammatory, antibacterial and immunomodulatory activities (Wu, et al., 2011, 2012). Clinical studies have demonstrated that extracts of Turpiniae Folium possess therapeutic potential as a traditional medicine for treating various diseases. Turpiniae Folium polysaccharides can reduce oxidative stress, inflammation and pathological changes in liver tissue, thereby reducing blood lipid levels and exhibiting significant potential for treating hyperlipidemia (Yang, et al., 2021). The flavonoids in Turpiniae Folium exhibit notable anti-inflammatory effects (Zhang, et al., 2008), with one key flavonoid component, quercitrin (Liu, et al., 2017a), demonstrating significant anti-inflammatory effects in a carrageenan-induced rat edema model (Eldahshan and Azab, 2012). Quercitrin accelerates the healing of acute inflammatory liver and lung tissue damage in mice, inhibits paw edema in rats, and suppresses the secretion of tumor necrosis factor-α (TNF-α), interleukin-1β (IL-1β), and interleukin-6 (IL-6) in serum from rat and mouse models. It also reduces mRNA expression of inducible nitric oxide synthase (iNOS) and chemokine ligand 2 (CCL2) in RAW264.7 cells and inhibits the phosphorylation of nuclear factor inhibitory protein (IκBα) and inhibitor of κ B kinase β (IκKβ) (Fang, et al., 2020). Another important flavonoid component, ligustroside, has been found to attenuate the upregulation of NOD-like receptor protein 1 (NLRP1) inflammasome complex and reduce the expression of inflammatory cytokines TNF-α, interleukin-18 (IL-18), IL-6, and IL-1β (Bi, et al., 2023).

Studies have shown that supplementing 600 mg/kg TFE in the broiler diet can improve growth performance, modulate antioxidant and immune systems, regulate intestinal microbiota, and mitigate heat stress (Song, et al., 2022b). The intestine serves as a primary defense barrier against the entry of pathogenic bacteria, viruses and other harmful substances into the host, making an intact and healthy intestinal system crucial for maintaining animal health and productivity (Rysman, et al., 2023). In broilers, the intestinal barrier is particularly vulnerable to various stress factors, especially immune problems, due to the high stocking density and the prohibition of antibiotics (Wang, et al., 2023b; Zhou, et al., 2023). Previous studies conducted by our team have revealed that TFE exhibits significant immunomodulatory and antioxidant effects in LPS-challenged broilers, effectively reducing inflammatory cytokine levels in serum and liver, improving antioxidant capacity and modulating gut microbiota. However, the underlying mechanisms of action remain unclear. The present study aims to elucidate the possible mechanisms by investigating the effects of TFE on the expression of genes and proteins related to antioxidant, immunological and intestinal barrier functions in the jejunal mucosa of LPS-challenged broilers.

Materials and methods

Experimental animals and materials

The white-feathered broilers were purchased from Fujian Sunner Development Inc.(Fujian, China). TFE was extracted and obtained by the animal nutrition team of Jiangxi Academy of Agricultural Sciences, Institute of Animal Husbandry and Veterinary Medicine, with total flavonoids, total polysaccharides and polyphenol contents measured at 119.75 mg/g, 10.15 g/100 g and 100.90 mg/g. LPS (serotype O55:B5, article number L2880) was purchased from Sigma-Aldrich Inc. (St. Louis, MO, USA).

Experiment design

A 2 × 2 factorial design was used to test the effect of dietary TFE (0 or 500 mg/kg) on the broilers with or without LPS challenge. A total of 240 healthy female white-feathered chickens with similar body weight were selected and randomly divided into four groups, with six replicates per group and 10 birds per replicate. The birds were intraperitoneally injected with either 1 mg/kg body weight (BW) of LPS (prepared as 1 mg/mL solution in 0.9 % saline solution) or 0.9 % sterile saline at 21, 23, and 25 days of age. The experimental period lasted 26 days. During the experiment, broilers were given ad libitum access to feed and water. Daily observations were conducted to monitor birds' behavior, feed intake and health status. The immunization procedures were carried out in accordance with the technical specifications DB62/T 4326-2021 for broiler rearing. The basal diet consisted of a formulation based on corn and soybean meal, the composition and nutritional content of which are listed in Table 1.

Table 1.

Composition and nutrient levels of the basal diet (air-dry basis) %.

Ingredients Content Nutrient levelsb Content
Corn 55.75 ME/(MJ/kg) 12.54
Soybean meal 33.28 CP 21.50
Soybean oil 3.67 Lys 1.20
Fish meal 3.50 Met 0.59
CaHPO4 1.31 Cys 0.91
Limestone 1.22 Ca 1.00
Premixa 1.00 TP 0.68
DL-Met 0.26 NPP 0.45
Total 100.00
a

The premix provided the following per kg of the diet:VA 80 00 IU, VD 2 000 IU, VE 20 IU, VK3 15 mg, VB1 3 mg, VB2 8 mg,VB6 3 mg, VB12 0. 015 mg, folic acid 0.95 mg, nicotinic acid 35 mg, d-pantothenic acid 15 mg, biotin 0.1 mg, Cu (as copper sulfate) 7 mg, Fe (as ferrous sulfate) 130 mg, Zn (as zinc sulfate) 70 mg, Mn (as manganese sulfate) 84 mg, I (as potassium iodide) 0.7 mg, Se (as sodium selenite) 0.24 mg.

b

ME was calculated according to tables of feed composition and nutritive values in China (2023 thirty-fourth edition). CP, Lys, Met, Cys, Ca, TP and NPP were measured values.

Animal management

The entire experiment was conducted at the experimental poultry facility of the Animal Husbandry and Veterinary Research Institute, Jiangxi Academy of Agricultural Sciences. This animal study was approved by the Ethics Committee of the Jiangxi Academy of Agricultural Sciences (Approval No. 2022-JXAAS-XM-09) and was carried out in strict accordance with local laws, regulations, and institutional requirements. Prior to the introduction of the broilers, the pen was thoroughly cleaned and disinfected. The birds were housed in wire mesh cages, with five birds per cage (length 75 cm × depth 70 cm × height 40 cm). During the starting period, the house temperature was maintained at 30∼35°C with a relative humidity of 70∼80 %. In the growing period, the temperature was maintained at approximately 23°C with a relative humidity of 65∼75 %. Continuous lighting was provided throughout the trial period at 24 h per day with an intensity of 5 lux.

Sampling

At the end of the experimental period, two birds per replicate were selected randomly. After a 12-hour fast (with ad libitum access to water), the birds were euthanized by cervical dislocation. The abdomen was opened, and the jejunum was quickly separated. Sterile scissors were used to excise approximately 3 cm of the jejunum, which was then rinsed with 0.9 % sterile saline and fixed in 10 % neutral formalin solution for 12 h. After dehydration, clearing, and paraffin embedding, the tissue was embedded in paraffin blocks and sectioned into 5∼7 μm thick slices. Meanwhile, another 10 cm section of the jejunum was excised. The intestinal lumen was gently flushed with pre-chilled saline, and the intestinal mucosa was scraped using a sterilized coverslip and placed in a 2 mL cryovial. The cryovial was immediately dipped in liquid nitrogen to freeze overnight and then stored at −80°C until further testing.

Growth performance

On the 1st, 21st, and 26th days of the experiment, the BW of the chickens was weighted for each pen at 8:00 AM after a 12-hour fasting. The average daily gain (ADG) was then calculated. Throughout the experiment, feed intake was recorded weekly by pen, and the average daily feed intake (ADFI) and feed-to-gain ratio (F/G) were calculated.

Intestinal tissue morphology

Hematoxylin and eosin (H&E) staining was performed on the jejunal paraffin sections, and villus morphology was observed using an optical microscope (Nikon Eclipse CI, Nikon Corporation). The villus height (VH) and crypt depth (CD) were measured using Image-Pro Plus 6.0 software (Media Cybernetics, Inc.), and the ratio of villus height to crypt depth (VH/CD) was calculated.

mRNA expression in jejunal mucosa

All instruments and consumables were treated to remove RNase contamination. Total RNA from jejunal mucosa was extracted using the Precellys Tissue Total RNA Extraction Kit (Bertin Instruments, France). The concentration and purity of total RNA were measured using a Novogene ultramicrospectrophotometer (US850). Genomic DNA was removed using gDNA Eraser according to the manufacturer's instructions for the PrimeScript™ RT Reagent Kit. The genomic DNA removal reaction system consisted of 2.0 µL 5 × gDNA Eraser buffer, 1.0 µL gDNA Eraser, 1.0 µL total RNA, and 6.0 µL RNase-free dH2O. Subsequently, the total RNA treated for genomic DNA removal was reverse transcribed into cDNA. The reverse transcription reaction system included 10 µL genomic DNA removal reaction mix, 1.0 µL PrimeScript RT Enzyme Mix I, 1.0 µL RT Primer Mix, 4.0 µL 5 × PrimeScript Buffer 2, and 4.0 µL RNase-Free dH2O. The reaction was carried out at 42°C for 15 min and then at 85°C for 5 s to obtain cDNA, which was stored at −20°C for further use. Real-time quantitative PCR (qRT-PCR) was performed using the Rocgene Archimed-X4 fluorescent quantitative PCR system with SYBR Green I dye. β-Actin was used as a reference gene and amplification was performed according to the instructions of the PerfectStart® Green qPCR SuperMix kit. The relative expression of target genes was calculated using the 2 (−△△CT) method. Primer sequences were synthesized by Sangon Biotech (as described in Table 2).

Table 2.

Primers sequence.

Gene target Primer sequence/5′ to 3′ Accession no. Amplicon size/bp
β-actin F: GAGAAATTGTGCGTGACATCA NM_205518.1 152
R: CCTGAACCTCTCATTGCCA
TLR4 F: AGGCACCTGAGCTTTTCCTC NM_001030693.1 96
R: TACCAACGTGAGGTTGAGCC
MyD88 F:CCTGGCTGTGCCTTCGGA NM_001030962 198
R:TCACCAAGTGCTGGATGCTA
NF-κB F: GTGTGAAGAAACGGGAACTG XM_025145278.1 203
R: GGCACGGTTGTCATAGATGG
iNOS F: GCCACTTCTGAAACCCAGGTA NM_204961.1 116
R: ATGGCCCTTGTCCATCTCTTG
IL-1β F: ACTGGGCATCAAGGGCTA XM_015297469.2 131
R: GGTAGAAGATGAAGCGGGTC
IL-10 F:CAGACCAGCACCAGTCATCA NM_012854.2 96
R:TCCCGTTCTCATCCATCTTCTC
IL-6 F: AGGGCCGTTCGCTATTTGAA XM_015281283.2 72
R: CAGAGGATTGTGCCCGAACT
LITAF F: TGTGTATGTGCAGCAACCCGTAGT NM_204267.2 229
R: GGCATTGCAATTTGGACAGAAGT
CAT F: GTTGGCGGTAGGAGTCTGGTCT NM_001031215.1 182
R: GTGGTCAAGGCATCTGGCTTCTG
SOD F: TTGTCTGATGGAGATCATGGCTTC NM 205064.1 98
R: TGCTTGCCTTCAGGATT AAAGTGA
GSH-Px F: CAAAGTTGCGGTCAGTGGA NM 001163245.1 136
R: AG AGTCCCAGGCCTTTACTACTTTC
CLDN 1 GGTGAAGAAGATGCGGATGG NM_001013611 139
TCTGGTGTTAACGGGTGTGA
OCLN GATGGACAGCATCAACGACC NM_205128 142
CTTGCTTTGGTAGTCTGGGC
ZO-1 GCCAACTGATGCTGAACCAA XM_015278975 141
GGGAGAGACAGGACAGGACT

TLR4: toll-like receptor 4; MyD88: myeloid differentiation factor 88; NF-κB: nuclear factor κB; iNOS: inducible nitric oxide synthase; IL-1β: interleukin-1β; IL-10: interleukin-10; IL-6: interleukin-6; LITAF: lipopolysaccharide-induced tumor necrosis factor α factor; CAT: catalase; SOD1: superoxide dismutase 1; GSH-Px: glutathione peroxidase; CLDN1: claudin-1; OCLN: occludin; ZO-1: zonula occludens-1.

Protein extraction and expression

Proteins were extracted and quantified according to the protocol provided with the BCA Protein Assay Kit (R0020, Solarbio Life Sciences). Protein concentrations were standardized to 1 mg/mL. Proteins of different molecular weights were separated using electrophoresis and transferred to a PVDF membrane. The PVDF membrane was blocked with Beyotime Rapid Blocking Buffer at room temperature for 5-15 min, followed by overnight incubation at 4°C with primary antibodies including NLRP3 (1:1000 dilution), ASC (1:1000 dilution), caspase-1 (1:1000 dilution) and β-actin (1:1000 dilution). After incubation, the membrane was washed three times and incubated with secondary antibodies diluted 1:10,000 for 60 min at room temperature. The membrane was washed three more times before being treated with an equal mixture of ECL substrate solutions A and B. Chemiluminescent signals were developed in the dark for 5 min. Excess substrate was removed and the membrane was covered with a transparent film. The prepared membrane was placed in a dark box for imaging and densitometric analysis was performed using ImageJ software (The National Institutes of Health, NIH). The specific antibodies used are listed in Table 3.

Table 3.

Antibodies information.

Antibody Name Brand Catalog Number Antibody Type
TLR4 bioss bs-20379R Rabbit Primary Antibody
NF-κB p65 bioss bs-0465R Rabbit Primary Antibody
p-p65 bioss bs-0982R Rabbit Primary Antibody
MyD88 CST 4283 Rabbit Primary Antibody
TNF-a bioss bsm-33207M Mouse primary antibody
IL-1β ABclonal A16288 Rabbit Primary Antibody
IL-10 bioss bs-0698R Rabbit Primary Antibody
iNOS bioss bs-0162R Rabbit Primary Antibody
ZO-1 ThermoFisher Scientific 33-9100 Mouse primary antibody
OCLN ThermoFisher Scientific 33-1500 Mouse primary antibody
CLDN ThermoFisher Scientific 51-9000 Rabbit Primary Antibody
Nrf2 ThermoFisher Scientific PA5-27882 Rabbit Primary Antibody
HO-1 bioss bs-23397R Rabbit Primary Antibody
SOD1 GeneTex GTX100554 Rabbit Primary Antibody
β-Actin ABclonal AC026 Rabbit Primary Antibody
GoatAnti-Rabbit IgG bioss bs-0295G Secondary antibody
GoatAnti-Mouse IgG bioss bs-0296G Secondary antibody

TLR4: toll-like receptor 4; p65: p65 subunit; p-p65: phosphorylated p65; MyD88: myeloid differentiation factor 88; TNF-α: tumor necrosis factor α; IL-1β: interleukin-1β; IL-10: interleukin-10; iNOS: inducible nitric oxide synthase; ZO-1: zonula occludens-1; OCLN: occludin; CLDN: claudin; Nrf2: nuclear factor erythroid 2-related factor 2; HO-1: heme oxygenase-1; SOD1: superoxide dismutase 1.

Statistical analysis

The data were initially organized using Excel 2019 and analyzed with two-way ANOVA using the GLM procedure in SPSS (IBM, SPSS Inc., Chicago, IL, version 24.0), based on a 2 × 2 factorial design, the main effects of the model include TFE, LPS challenge, and their interaction. A one-way ANOVA followed by Tukey's multiple comparisons test was performed when significant interaction effects were observed. Graphical representations were created using GraphPad Prism (GraphPad Software, USA, version 9.0). All P-values were two-sided, and differences were considered statistically significant at P ≤ 0.05, with tendencies noted at 0.05 < P < 0.10.

Results

Effect of TFE supplementation on growth performance of broilers challenged with LPS

As shown in Table 4, Prior to the LPS challenge, dietary supplementation with TFE for 21 days resulted in increases in both ADG (P = 0.037) and ADFI (P = 0.045) in broilers, while no significant effect was observed on F/G (P > 0.05). LPS challenge significantly decreased ADG and ADFI, while markedly increased F/G (P < 0.001). A 26-day supplementation with TFE yielded opposite results, as evidenced by a significant increase in both ADG (P = 0.004) and ADFI (P = 0.046), alongside a concurrent decrease in F/G (P = 0.025). No significant interactions between TFE and LPS were observed for ADG, ADFI, or F/G (P > 0.05). However, a notable trend of interaction between TFE and LPS was detected respect to ADG (0.05 < P < 0.10).

Table 4.

Effect of dietary TFE supplementation on growth performance of broiler chickens challenged with LPS (n = 6).

Items TFE (-)a
TFE (+)
SEM P-value
LPS (-)b LPS (+) LPS (-) LPS (+) TFE LPS TFE × LPS
1-21 d
ADG/(g/d) 37.86 38.49 39.01 38.79 0.176 0.037
ADFI/(g/d) 50.93 51.75 52.21 52.30 0.230 0.045
F/G 1.35 1.34 1.34 1.35 0.003 0.823
21-26 d
ADG/(g/d) 56.96 47.17 58.26 54.04 1.086 0.004 < 0.001 0.095
ADFI/(g/d) 85.11 74.30 86.45 81.17 1.332 0.046 < 0.001 0.166
F/G 1.50 1.58 1.47 1.52 0.011 0.025 < 0.001 0.375
a

TFE (-) represents a diet without the supplementation of TFE, while TFE (+) indicates a diet supplemented with 500 mg/kg of TFE.

b

LPS (-) indicates intraperitoneal injection of sterile physiological saline in broilers at 21, 23, and 25 days of age, while LPS (+) indicates intraperitoneal injection of 1 mg/kg BW of LPS at the same time points. ADG: average daily gain; ADFI: average daily feed intake; F/G: feed-to-gain ratio; SEM: standard error of the mean; LPS: lipopolysaccharide; TFE: Turpiniae folium extract; TFE × LPS: the interaction between TFE and LPS.

Effect of TFE supplementation on Jejunum morphology in broilers challenged with LPS

As shown in Table 5, LPS challenge resulted in a significant decrease in VH and VH/CD, alongside a significant increase in CD (P < 0.05). Conversely, TFE supplementation significantly increased both jejunal VH and VH/CD (P < 0.05), while significantly decreasing jejunal CD (P < 0.05). No significant interactions between TFE and LPS were observed for jejunal VH, CD, or VH/CD (P > 0.05). As illustrated in Fig. 1, the LPS challenge induced a decrease in the density of the jejunal villi, accompanied by shortening, thickening, and damage, as well as an increase in CD. In contrast, TFE supplementation promoted villus elongation and densification, while reducing CD.

Table 5.

Effect of dietary TFE supplementation on jejunum morphology in broilers challenged with LPS (n = 12).

Items TFE (-)a
TFE (+)
SEM P-value
LPS (-)b LPS (+) LPS (-) LPS (+) TFE LPS TFE × LPS
VH/μm 1419.19 1382.85 1508.79 1411.97 14.179 0.035 0.018 0.283
CD/μm 188.31 226.42 183.73 206.08 3.245 0.049 < 0.001 0.212
VH/CD 8.15 6.74 8.92 7.34 0.132 0.007 < 0.001 0.724
a

TFE (-) represents a diet without the supplementation of TFE, while TFE (+) indicates a diet supplemented with 500 mg/kg of TFE.

b

LPS (-) indicates intraperitoneal injection of sterile physiological saline in broilers at 21, 23, and 25 days of age, while LPS (+) indicates intraperitoneal injection of 1 mg/kg BW of LPS at the same time points. VH: villus height; CD: crypt depth; SEM: standard error of the mean; LPS: lipopolysaccharide; TFE: Turpiniae folium extract; TFE × LPS: the interaction between TFE and LPS.

Fig. 1.

Fig 1

Effect of dietary TFE supplementation on jejunum morphology in broilers challenged with LPS, TFE(-) represents a diet without the supplementation of TFE, while TFE(+) indicates a diet supplemented with 500 mg/kg of TFE. LPS(-) indicates intraperitoneal injection of sterile physiological saline in broilers at 21, 23, and 25 days of age, while LPS(+) indicates intraperitoneal injection of 1 mg/kg BW of LPS at the same time points. TFE: Turpiniae folium extract; LPS: lipopolysaccharide. “→” marked the site of villous damage. TFE: Turpiniae folium extract; LPS, lipopolysaccharide.

Effect of TFE on antioxidant genes and proteins expression in the jejunum of broilers challenged with LPS

As shown in Fig. 2, LPS challenge significantly downregulated the relative mRNA expression levels of catalase (CAT) (P < 0.001), glutathione peroxidase (GSH-Px) (P < 0.001), and superoxide dismutase (SOD) (P = 0.020), as well as the relative protein expression levels of nuclear factor erythroid 2-related factor 2 (Nrf2) (P < 0.001), heme oxygenase-1 (HO-1) (P < 0.001), and SOD1 (P < 0.001). In contrast, broilers supplemented with TFE exhibited significant upregulations in these markers (P < 0.05). Significant interactions between TFE and LPS were observed in the relative mRNA expression levels of CAT (P = 0.042) and GSH-Px (P = 0.008), whereas no significant interactions were observed in the relative mRNA expression level of SOD (P = 0.135) or relative protein expression levels of Nrf2 (P = 0.566), HO-1 (P = 0.229), SOD1 (P = 0.223). TFE supplementation significantly upregulated the relative mRNA expression levels of CAT and GSH-Px in the absence of LPS challenge (P < 0.05), but failed to show the same improvement under LPS challenge (P > 0.05).

Fig. 2.

Fig 2

Effect of TFE on the expression of antioxidant related genes and proteins in the jejunum of broilers challenged by LPS, Relative expression of CAT mRNA in different treatment groups (n = 6). B. Relative expression of GSH-Px mRNA in different treatment groups (n = 6). C. Relative expression of the SOD mRNA in different treatment groups (n = 6). D. Western blot analysis of the protein expression levels of Nrf2, HO-1, and SOD1 in the jejunum of different treatment groups (n = 6). E. Relative expression of the Nrf2 protein in different treatment groups (n = 6). F. Relative expression of the HO-1 protein in different treatment groups (n = 6). G. Relative expression of the SOD1 protein in different treatment groups (n = 6). a,bDifferent alphabets denote differences in significant difference (P < 0.05). CAT: catalase; GSH-Px: glutathione peroxidase; SOD: superoxide dismutase; Nrf2: nuclear factor erythroid 2-related factor 2; HO-1: heme oxygenase-1; SOD1: superoxide dismutase 1.

Effect of TFE on immune genes expression in the jejunum of broilers challenged with LPS

As shown in Fig. 3, LPS challenge significantly upregulated the relative mRNA expression levels of IL-6 (P < 0.001), IL-1β (P < 0.001), iNOS (P < 0.001), lipopolysaccharide-induced tumor necrosis factor-α factor (LITAF) (P < 0.001), MyD88 (P = 0.001), NF-κB (P = 0.001), and TLR4 (P < 0.001) in the jejunum, while significantly downregulated the relative mRNA expression level of interleukin-10 (IL-10) (P < 0.05). In contrast, TFE supplementation exhibited completely opposite results (P < 0.05). Significant interactions between TFE and LPS were observed in the relative mRNA expression levels of IL-6 (P < 0.001), IL-1β (P < 0.001), IL-10 (P = 0.036), iNOS (P < 0.001), LITAF (P = 0.018), MyD88 (P = 0.009), NF-κB (P = 0.049), and TLR4 (P = 0.002). TFE supplementation significantly upregulated the relative mRNA expression levels of IL-10 in the absence of LPS challenge (P < 0.05), while downregulated the relative mRNA expression levels of IL-6, IL-1β, iNOS, LITAF, MyD88, NF-κB, and TLR4 under LPS challenge (P < 0.05).

Fig. 3.

Fig 3

Effect of TFE on the expression of immune related genes in the jejunum of broilers challenged by LPS, Relative expression of IL-6 mRNA in different treatment groups (n = 6). B. Relative expression of IL-1β mRNA in different treatment groups (n = 6). C. Relative expression of IL-10 mRNA in different treatment groups (n = 6). D. Relative expression of iNOS mRNA in different treatment groups (n = 6). E. Relative expression of LITAF mRNA in different treatment groups (n = 6). F. Relative expression of MyD88 mRNA in different treatment groups (n = 6). G. Relative expression of NF-κB mRNA in different treatment groups (n = 6). H. Relative expression of TLR4 mRNA in different treatment groups (n = 6). a,bDifferent alphabets denote differences in significant difference (P < 0.05). IL-6: interleukin-6; IL-1β: interleukin-1β; IL-10: interleukin-10; iNOS: inducible nitric oxide synthase; LITAF: lipopolysaccharide-induced tumor necrosis factor α factor; MyD88: myeloid differentiation factor 88; NF-κB: nuclear factor κB; TLR4: toll-like receptor 4.

Effect of TFE on immune related proteins expression in the jejunum of broilers challenged with LPS

As shown in Fig. 4, LPS challenge significantly upregulated the relative protein expression levels of TLR4, p65, phosphorylated p65 (p-p65), MyD88, TNF-α, IL-1β (P < 0.001), and iNOS (P = 0.001) in the jejunum of broilers, while significantly downregulated the relative protein expression level of IL-10 (P < 0.001). TFE supplementation exhibited opposite results in the relative protein expression levels of p65, p-p65, MyD88, TNF-α, IL-1β, iNOS and IL-10 (P < 0.001). However, no significant effect of TFE supplementation was observed on the relative protein expression level of TLR4 (P = 0.916). Significant interaction between TFE and LPS were observed in the relative protein expression levels of TLR4 (P < 0.001), p65 (P = 0.029), MyD88 (P = 0.005), and IL-10 (P = 0.001), whereas no significant interactions were found in the relative protein expression levels of p-p65 (P = 0.922), TNF-α (P = 0.635), IL-1β (P = 0.717) or iNOS (P = 0.555). TFE supplementation significantly decreased the relative protein expression levels of p65 and MyD88 (P < 0.05), while markedly upregulated the relative protein expression levels of IL-10 (P < 0.05), both in the presence and absence of LPS challenge. It is worth noting that, TFE supplementation significantly downregulated the relative protein expression level of TLR4 in the absence of LPS challenge (P < 0.05), but showed the opposite effect under LPS challenge (P < 0.05).

Fig. 4.

Fig 4

Effect of TFE on the expression of immune related proteins in the jejunum of broilers challenged by LPS. Relative expression of TLR4 protein in different treatment groups (n = 6). B. Relative expression of p65 protein in different treatment groups (n = 6). C. Relative expression of p-p65 protein in different treatment groups (n = 6). D. Relative expression of MyD88 protein in different treatment groups (n = 6). E. Relative expression of TNF-α protein in different treatment groups (n = 6). F. Relative expression of IL-1β protein in different treatment groups (n = 6). G. Relative expression of IL-10 protein in different treatment groups (n = 6). H. Relative expression of iNOS protein in different treatment groups (n = 6). I. Western blot analysis of the protein expression levels of TLR4, p65, p-p65, MyD88, TNF-α, IL-1β, IL-10 and iNOS in different treatment groups. a,b,cDifferent alphabets denote differences in significant difference (P < 0.05). TLR4: toll-like receptor 4; p65: p65 subunit; p-p65: phosphorylated p65; MyD88: myeloid differentiation factor 88; TNF-α: tumor necrosis factor α; IL-1β: interleukin-1β; IL-10: interleukin-10; iNOS: inducible nitric oxide synthase.

Effect of TFE on mucosal barrier related genes and proteins expression in the jejunum of broilers challenged with LPS

As shown in Fig. 5, LPS challenge significantly downregulated the relative mRNA expression levels of ZO-1 (P < 0.001), OCLN (P < 0.001), and CLDN1 (P = 0.007), as well as the relative protein expression levels of CLDN, OCLN, and ZO-1 in the jejunum of broilers (P < 0.001). In contrast, TFE supplementation in the diet significantly upregulated the relative mRNA expression level of ZO-1 and the relative protein expression levels of CLDN, OCLN, and ZO-1 in the jejunum of broilers (P < 0.001), while it had no significant effect on the gene expression of CLDN1 (P = 0.116) and OCLN (P = 0.379). A significant interaction between TFE and LPS was observed for the relative protein expression level of ZO-1 (P = 0.049), whereas no significant interactions were found for the relative mRNA expression levels of CLDN1 (P = 0.429), OCLN (P = 0.115) or the relative protein expression levels of CLDN (P = 0.731), OCLN (P = 0.283), ZO-1 (P = 0.682). TFE supplementation significantly upregulated the relative mRNA and protein expression levels of ZO-1, both in the presence and absence of LPS challenge (P < 0.05).

Fig. 5.

Fig 5

Effect of TFE on the expression of mucosal barrier genes and proteins in the jejunum of broilers challengeded by LPS. Relative expression of ZO-1 mRNA in different treatment groups (n = 6). B. Relative expression of OCLN mRNA in different treatment groups (n = 6). C. Relative expression of CLDN1 mRNA in different treatment groups (n = 6). D. Western blot analysis of the protein expression levels of ZO-1, OCLN, and CLDN in different treatment groups (n = 6). E. Relative expression of ZO-1 protein in different treatment groups (n = 6). F. Relative expression of OCLN protein in different treatment groups (n = 6). G. Relative expression of CLDN protein in different treatment groups (n = 6). a,b,c,dDifferent alphabets denote differences in significant difference (P < 0.05). CLDN: claudin; OCLN: occludin; ZO-1: zonula occludens-1.

Discussion

LPS is known to significantly impair the growth performance of broilers (Li, et al., 2021). In this study, LPS challenge had a significant adverse effects on ADFI, ADG and F/G, which is consistent with previous research findings (Chen, et al., 2018). This could be attributed to LPS reducing the expression of appetite-enhancing neuropeptides, such as neuropeptide Y (NPY) and agouti-related peptide (AgRP) in the hypothalamus (Yousefi, et al., 2021), thereby suppressing appetite and decreasing feed intake. Additionally, LPS may affect the absorption and distribution of nutrients in the body (Zhang, et al., 2013), redirecting more nutrients towards stress response rather than growth deposition. TFE, a natural plant extract, contains various anti-inflammatory components, including polyphenols, flavonoids, and polysaccharides, which may have appetite-stimulating and growth-promoting effects. In the absence of an LPS challenge, TFE significantly increased ADFI and ADG in broilers, consistent with the findings of the previous studies (Song, et al., 2022a, 2022b). Differently, TFE had no significant effect on F/G. This discrepancy may be due to differences in feeding duration and broiler breed, extending the feeding period by 5 days in this study led to the same conclusion, with a significant decrease in F/G. Importantly, no significant interactions between TFE and LPS were observed for ADG, ADFI, or F/G, indicating that the growth-promoting effects of TFE are not affected by the LPS challenge. In other words, TFE can effectively enhance the growth performance of broilers even under LPS-induced stress.

The intestine plays a vital role in nutrient digestion and absorption, as well as in maintaining overall health (Liu, et al., 2019). This study shows that LPS challenge significantly reduced VH and the VH/CD, while significantly increasing CD in the jejunum, which is consistent with previous findings (Jiang, et al., 2023). This effect may be attributed to LPS-induced activation of apoptotic signaling pathways, leading to damage and death of intestinal epithelial cells, thereby impairing villus formation (Gao, et al., 2021). The present study further reveals that dietary supplementation with TFE significantly increased VH and the VH/CD, while significantly decreasing CD in jejunum. Notably, no significant interactions between TFE and LPS were observed for VH, CD, or VH/CD, suggesting that TFE effectively protects the intestinal tissue morphology of LPS-challenged broilers from the harmful effects of LPS-induced inflammatory cytokines and reactive oxygen species. It also promotes the renewal and repair of intestinal villous cells, thereby playing a positive role in alleviating LPS-induced intestinal damage.

LPS as important pathogenic factors of gram-negative bacteria, can trigger oxidative damage and apoptosis in the intestine(Luo, et al., 2023). The present study showed that the LPS challenge significantly downregulated the relative mRNA expression levels of CAT, GSH-Px, and SOD, as well as the relative protein expression levels of Nrf2, HO-1, and SOD1, which is consistent with previous findings (Shie, et al., 2015; Xun, et al., 2023). This suggests that LPS exacerbates intestinal oxidative stress by suppressing the expression of antioxidant enzymes, thereby impairing intestinal barrier function. In the present study, dietary supplementation with TFE significantly enhanced the relative mRNA expression levels of CAT, GSH-Px, and SOD, as well as the relative protein expression levels of Nrf2, HO-1, and SOD1 in the jejunum of broilers. These findings suggest that TFE supplementation did not significantly ameliorate the downregulation of CAT and GSH-Px genes induced by LPS challenge, but it notably upregulated the expression of antioxidant-related genes and proteins in LPS-challenged broilers, thereby mitigating oxidative stress and providing protective effects against LPS-induced oxidative damage, which are closely linked to the activation of the Nrf2/HO-1 signaling pathway (Kaspar, et al., 2009). Previous studies have shown that plant polysaccharides can alleviate oxidative stress by inducing Nrf2-ARE binding, enhancing the activity of antioxidant enzymes, and reducing ROS accumulation (Meng, et al., 2022). Plant flavonoids such as quercetin significantly increase Nrf2 and HO-1 expression and inhibit LPS-induced oxidative responses through activation of the Nrf2 signaling pathway (Jiang, et al., 2018). In addition, sanghuang or Phellinus linteus polyphenol can induce the expression of HO-1 protein, suppress iNOS and NO production in LPS-stimulated BV-2 cells, and exhibit antioxidant, anti-inflammatory, and anti-apoptotic properties (Huang, et al., 2020). TFE is rich in phenolic compounds, flavonoids and polysaccharides, all of which have powerful antioxidant properties. However, further studies are required to identify the specific compounds in TFE that play a dominant role in modulating the Nrf2 signaling pathway (Ma, et al., 2018).

The intestine serves as the primary habitat for immune cells and accounts for approximately 70∼80 % of the total immune cell population (Sender, et al., 2016). Lipopolysaccharides (LPS) are recognized by receptor proteins in immune-related cells and trigger acute inflammatory immune responses in the host. TLR4 is a crucial sensor for LPS (Levin and Shibolet, 2008), triggering intracellular binding with MyD88 and subsequently activating the NF-κB signaling pathway, which promotes the production and release of pro-inflammatory cytokines (Brandl, et al., 2007). This study demonstrated that LPS challenge significantly upregulated the expression of genes and proteins associated with the TLR4/MyD88/NF-κB pathway, while downregulating the expression of the anti-inflammatory factor IL-10 at both the protein and gene levels. These findings are consistent with previous research (Chen et al., 2021; Hu et al., 2020; Xu et al., 2022). In the present study, dietary supplementation with TFE can upregulate the expression of IL-10 at both the gene and protein levels in the jejunum of LPS-challenged broilers, thereby aiding in the regulation and alleviation of inflammation and counteracting the pro-inflammatory response induced by LPS (Yeung, et al., 2023). TFE reduces the activation of the TLR4 signaling pathway by downregulating the expression of MyD88, thereby attenuating TLR4-mediated inflammatory responses. It is worth noting that TFE supplementation significantly downregulated the relative protein expression level of TLR4 in the absence of LPS challenge, but exhibited the opposite effect under LPS challenge. The potential underlying mechanisms, such as modulation of immune response and feedback regulation, warrant further investigation. Supplementation with TFE significantly downregulated the expression and phosphorylation of the p65 protein, thereby inhibiting transcriptional activation of the NF-κB signaling pathway and decreasing the protein levels of downstream key pro-inflammatory factors, including TNF-α, IL-1β, and iNOS (Xiao, et al., 2023; Zhang, et al., 2021). This ultimately alleviated LPS-induced intestinal inflammation and improved intestinal immune function. The observed effects can be attributed to the flavonoid components of TFE. Research suggests that the primary flavonoid component in TFE, corilagin, may suppress the activity of the NF-κB and mitogen-activated protein kinase pathways, inhibit the expression of nuclear factor of activated T cells 1 (NFATc1), and reduce nuclear translocation p65 (Liao, et al., 2019). Furthermore, it has been shown to decrease NF-κB phosphorylation and inhibit NF-κB activity. There is also a connection between the anti-inflammatory and antioxidant mechanisms of TFE (Peng, et al., 2020). As previously mentioned, TFE can activate the Nrf2 signaling pathway. Reportedly, activation of the Nrf2 pathway can suppress NF-κB activity, thereby reducing inflammation, while inhibition of Nrf2 and HO-1 abrogates this effect, suggesting that the Nrf2 pathway is involved in NF-κB-mediated inflammatory responses is involved (Buelna-Chontal and Zazueta, 2013; Minelli, et al., 2012).

Intestinal epithelial cells serve as a crucial barrier between the host and the external environment, effectively restricting the passage of pathogens and large antigen molecules across the epithelial layer (Arrieta, et al., 2009). LPS stimulation induces the accumulation of inflammatory mediators and oxidative stress, thereby impairing the integrity of intestinal tight junctions and exacerbating the permeability of the intestinal mucosa (Wang, et al., 2023a). In the present study LPS challenge markedly downregulated the relative mRNA expression levels of CLDN1, OCLN, and ZO-1, as well as the relative protein expression levels of CLDN, OCLN, and ZO-1 in the jejunum of broiler chickens, suggesting that LPS induces intestinal inflammation or permeability disorders (Ciccocioppo, et al., 2006). Improved tight junction integrity helps prevent the onset and progression of inflammation (Clayburgh, et al., 2006), and restoration of tight junction barrier function is closely related to improvement in intestinal inflammation (Cording, et al., 2013; Turner, 2006). This study demonstrate that dietary supplementation with TFE significantly upregulated the relative protein expression levels of CLDN, OCLN, and ZO-1 in the jejunum of LPS-challenged broiler chickens. This suggests that TFE can modulate the expression of these tight junction proteins, thereby enhancing epithelial barrier function and improving intestinal barrier integrity (Csernus, et al., 2020), with potential applications in the prevention and alleviation of inflammatory diseases (Suzuki, 2020). The anti-inflammatory and antioxidant properties of TFE are closely related to its ability to improve the integrity of the intestinal barrier. One possible mechanism is that TFE increases transepithelial electrical resistance, thereby reducing intestinal permeability (Wu, et al., 2019). It is worth noting that, in the present study, dietary supplementation with TFE significantly upregulated the relative mRNA expression levels of ZO-1 in the jejunum of LPS-challenged broiler chickens, with no significant effects observed on the mRNA expression of OCLN and CLDN1. ZO-1 gene has been reported to play a crucial role in epithelial repair (Kuo, et al., 2021). Therefore, we hypothesize that the protective effect of TFE on the intestinal mucosa goes beyond maintaining the barrier function of the intestinal mucosal junctions. TFE may also facilitate the repair of damaged intestinal lining, contributing to its overall protective effects.

Conclusion

Dietary supplementation with TFE effectively alleviated LPS-induced oxidative and immune stress in the jejunum of broilers, mitigated jejunal mucosal barrier dysfunction and villus damage, and significantly improved growth performance. The underlying mechanism of action may be associated with the activation of the Nrf2/HO-1 pathway and the inhibition of the TLR4/MyD88/NF-κB pathway.

Ethical statement

This study got approval from the Ethics Committee of the Institute of Animal Husbandry and Veterinary Science, Jiangxi Academy of Agricultural Sciences.

Disclosures

We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled, “Mechanisms of the effects of turpiniae folium extract on immunity, antioxidant activity and intestinal barrier function in lipopolysaccharide-stimulated broilers”.

Acknowledgements

This work was supported by the Fundamental Research and Talent Development Project of Jiangxi Academy of Agricultural Sciences (JXSNKYJCRC202216); the Jiangxi Province Modern Agricultural Poultry Industry Technical System of China (JXARS-12); and the Ganpo Talent Support Program · High-Level and High-Skilled Leading Talent Development Project (2023).

Footnotes

This research is appropriate for Metabolism and Nutrition.

References

  1. Alzarah M.I., Althobiati F., Abbas A.O., Mehaisen G.M.K., Kamel N.N. Citrullus colocynthis seeds: a potential natural immune modulator source for broiler reared under chronic heat stress. Anim. (Basel) 2021;11:1951. doi: 10.3390/ani11071951. [DOI] [PMC free article] [PubMed] [Google Scholar]
  2. Arrieta M.C., Madsen K., Doyle J., Meddings J. Reducing small intestinal permeability attenuates colitis in the IL10 gene-deficient mouse. Gut. 2009;58:41–48. doi: 10.1136/gut.2008.150888. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Bi F., Bai Y., Zhang Y., Liu W. Ligustroflavone exerts neuroprotective activity through suppression of NLRP1 inflammasome in ischaemic stroke mice. Exp. Ther. Med. 2023;25:8. doi: 10.3892/etm.2022.11707. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Bi S., Qu Y., Shao J., Zhang J., Li W., Zhang L., Ni J., Cao L. Ginsenoside Rg3 ameliorates stress of broiler chicks induced by Escherichia coli lipopolysaccharide. Front. Vet. Sci. 2022;9 doi: 10.3389/fvets.2022.878018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Brandl K., Plitas G., Schnabl B., DeMatteo R.P., Pamer E.G. MyD88-mediated signals induce the bactericidal lectin RegIII gamma and protect mice against intestinal Listeria monocytogenes infection. J. Exp. Med. 2007;204:1891–1900. doi: 10.1084/jem.20070563. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Buelna-Chontal M., Zazueta C. Redox activation of Nrf2 & NF-κb: a double end sword? Cell. Signal. 2013;25:2548–2557. doi: 10.1016/j.cellsig.2013.08.007. [DOI] [PubMed] [Google Scholar]
  7. Chen K., Tian J., Wang J., Jia Z., Zhang Q., Huang W., Zhao X., Gao Z., Gao Q., Zou J. Lipopolysaccharide-induced TNFα factor (LITAF) promotes inflammatory responses and activates apoptosis in zebrafish Danio rerio. Gene. 2021;780:145487. doi: 10.1016/j.gene.2021.145487. [DOI] [PubMed] [Google Scholar]
  8. Chen Y., Zhang H., Cheng Y., Li Y., Wen C., Zhou Y. Dietary l-threonine supplementation attenuates lipopolysaccharide-induced inflammatory responses and intestinal barrier damage of broiler chickens at an early age. Br. J. Nutr. 2018;119:1254–1262. doi: 10.1017/s0007114518000740. [DOI] [PubMed] [Google Scholar]
  9. Ciccocioppo R., Finamore A., Ara C., Di Sabatino A., Mengheri E., Corazza G.R. Altered expression, localization, and phosphorylation of epithelial junctional proteins in celiac disease. Am. J. Clin. Pathol. 2006;125:502–511. doi: 10.1309/dtyr-a91g-8r0k-tm8m. [DOI] [PubMed] [Google Scholar]
  10. Clayburgh D.R., Musch M.W., Leitges M., Fu Y.X., Turner J.R. Coordinated epithelial NHE3 inhibition and barrier dysfunction are required for TNF-mediated diarrhea in vivo. J. Clin. Invest. 2006;116:2682–2694. doi: 10.1172/jci29218. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Cording J., Berg J., Käding N., Bellmann C., Tscheik C., Westphal J.K., Milatz S., Günzel D., Wolburg H., Piontek J., Huber O., Blasig I.E. In tight junctions, claudins regulate the interactions between occludin, tricellulin and marvelD3, which, inversely, modulate claudin oligomerization. J. Cell Sci. 2013;126:554–564. doi: 10.1242/jcs.114306. [DOI] [PubMed] [Google Scholar]
  12. Csernus B., Biró S., Babinszky L., Komlósi I., Jávor A., Stündl L., Remenyik J., Bai P., Oláh J., Pesti-Asbóth G., Czeglédi L. Effect of carotenoids, oligosaccharides and anthocyanins on growth performance, immunological parameters and intestinal morphology in broiler chickens challenged with escherichia coli lipopolysaccharide. Anim. (Basel) 2020;10:347. doi: 10.3390/ani10020347. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Eldahshan O.A., Azab S.S. Anti-inflammatory effect of apigenin-7-neohesperidoside (Rhoifolin) in carrageenin-induced rat oedema model. J. Appl. Pharm. Sci. 2012;2:74–79. doi: 10.7324/JAPS.2012.2811. [DOI] [Google Scholar]
  14. Fang J., Cao Z., Song X., Zhang X., Xiao F. Rhoifolin alleviates inflammation of acute inflammation animal models and LPS-induced RAW264.7 cells via ikkβ/NF-κb signaling pathway. Inflammation. 2020;43:2191–2201. doi: 10.1007/s10753-020-01286-x. [DOI] [PubMed] [Google Scholar]
  15. Gao X., Dai J., Li G., Dai X. Gambogic acid protects LPS-induced apoptosis and inflammation in a cell model of neonatal pneumonia through the regulation of TrkA/Akt signaling pathway. BMC Pharmacol. Toxicol. 2021;22:28. doi: 10.1186/s40360-021-00496-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Han H., Zhang J., Chen Y., Shen M., Yan E., Wei C., Yu C., Zhang L., Wang T. Dietary taurine supplementation attenuates lipopolysaccharide-induced inflammatory responses and oxidative stress of broiler chickens at an early age. J. Anim. Sci. 2020;98:skaa311. doi: 10.1093/jas/skaa311. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Hu W., Bi S., Shao J., Qu Y., Zhang L., Li J., Chen S., Ma Y., Cao L. Ginsenoside Rg1 and re alleviates inflammatory responses and oxidative stress of broiler chicks challenged by lipopolysaccharide. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2023.102536. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Hu N., Wang C., Dai X., Zhou M., Gong L., Yu L., Peng C., Li Y. Phillygenin inhibits LPS-induced activation and inflammation of LX2 cells by TLR4/MyD88/NF-κB signaling pathway. J. Ethnopharmacol. 2020;248:112361. doi: 10.1016/j.jep.2019.112361. [DOI] [PubMed] [Google Scholar]
  19. Huang C.Y., Deng J.S., Huang W.C., Jiang W.P., Huang G.J. Attenuation of lipopolysaccharide-induced acute lung injury by hispolon in mice, through regulating the TLR4/PI3K/akt/mTOR and Keap1/Nrf2/HO-1 pathways, and suppressing oxidative stress-mediated er stress-induced apoptosis and autophagy. Nutrients. 2020;12:1742. doi: 10.3390/nu12061742. [DOI] [PMC free article] [PubMed] [Google Scholar]
  20. Jiang P.Y., Zhu X.J., Zhang Y.N., Zhou F.F., Yang X.F. Protective effects of apigenin on LPS-induced endometritis via activating Nrf2 signaling pathway. Microb. Pathog. 2018;123:139–143. doi: 10.1016/j.micpath.2018.06.031. [DOI] [PubMed] [Google Scholar]
  21. Jiang S.Q., Chen Z.L., Zhang S., Ye J.L., Wang Y.B. Protective effects of protocatechuic acid on growth performance, intestinal barrier and antioxidant capacity in broilers challenged with lipopolysaccharide. Animal. 2023;17 doi: 10.1016/j.animal.2022.100693. [DOI] [PubMed] [Google Scholar]
  22. Kaspar J.W., Niture S.K., Jaiswal A.K. Nrf2:iNrf2 (Keap1) signaling in oxidative stress. Free Radic. Biol. Med. 2009;47:1304–1309. doi: 10.1016/j.freeradbiomed.2009.07.035. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Kuo W.T., Zuo L., Odenwald M.A., Madha S., Singh G., Gurniak C.B., Abraham C., Turner J.R. The tight junction protein ZO-1 is dispensable for barrier function but critical for effective mucosal repair. Gastroenterology. 2021;161:1924–1939. doi: 10.1053/j.gastro.2021.08.047. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Levin A., Shibolet O. Toll-like receptors in inflammatory bowel disease-stepping into uncharted territory. World J. Gastroenterol. 2008;14:5149–5153. doi: 10.3748/wjg.14.5149. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Li X., Liu S., Wang J., Yi J., Yuan Z., Wu J., Wen L., Li R. Effects of ND vaccination combined LPS on growth performance, antioxidant performance and lipid metabolism of broiler. Res. Vet. Sci. 2021;135:317–323. doi: 10.1016/j.rvsc.2020.10.007. [DOI] [PubMed] [Google Scholar]
  26. Liao S., Song F., Feng W., Ding X., Yao J., Song H., Liu Y., Ma S., Wang Z., Lin X., Xu J., Zhao J., Liu Q. Rhoifolin ameliorates titanium particle-stimulated osteolysis and attenuates osteoclastogenesis via RANKL-induced NF-κb and MAPK pathways. J. Cell. Physiol. 2019;234:17600–17611. doi: 10.1002/jcp.28384. [DOI] [PubMed] [Google Scholar]
  27. Liu H., Xu C., Wang W., Zhao Y. Development and validation of an LC-ESI-MS/MS method for simultaneous determination of ligustroflavone and rhoifolin in rat plasma and its application to a pharmacokinetic study. J. Chromatogr. Sci. 2017;55:267–274. doi: 10.1093/chromsci/bmw181. [DOI] [PubMed] [Google Scholar]
  28. Liu R., Liu J., Zhao G., Li W., Zheng M., Wang J., Li Q., Cui H., Wen J. Relevance of the intestinal health-related pathways to broiler residual feed intake revealed by duodenal transcriptome profiling. Poult. Sci. 2019;98:1102–1110. doi: 10.3382/ps/pey506. [DOI] [PubMed] [Google Scholar]
  29. Liu T., Zhang L., Joo D., Sun S.C. NF-κb signaling in inflammation. Signal Transduct. Tar. Ther. 2017;2:17023. doi: 10.1038/sigtrans.2017.23. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Luo D., Huang Z., Jia G., Zhao H., Liu G., Chen X. Naringin mitigates LPS-induced intestinal barrier injury in mice. Food Funct. 2023;14:1617–1626. doi: 10.1039/d2fo03586c. [DOI] [PubMed] [Google Scholar]
  31. Ma S.G., Yuan S.P., Liu Y.B., Qu J., Li Y., Wang X.J., Wang R.B., Xu S., Hou Q., Yu S.S. 3-Hydroxy-3-methylglutaryl flavone glycosides from the leaves of Turpinia arguta. Fitoterapia. 2018;124:80–85. doi: 10.1016/j.fitote.2017.10.017. [DOI] [PubMed] [Google Scholar]
  32. Meng M., Huo R., Wang Y., Ma N., Shi X., Shen X., Chang G. Lentinan inhibits oxidative stress and alleviates LPS-induced inflammation and apoptosis of BMECs by activating the Nrf2 signaling pathway. Int. J. Biol. Macromol. 2022;222:2375–2391. doi: 10.1016/j.ijbiomac.2022.10.024. [DOI] [PubMed] [Google Scholar]
  33. Minelli A., Grottelli S., Mierla A., Pinnen F., Cacciatore I., Bellezza I. Cyclo(His-Pro) exerts anti-inflammatory effects by modulating NF-κb and Nrf2 signalling. Int J Biochem Cell Biol. 2012;44:525–535. doi: 10.1016/j.biocel.2011.12.006. [DOI] [PubMed] [Google Scholar]
  34. Peng S., Hu C., Liu X., Lei L., He G., Xiong C., Wu W. Rhoifolin regulates oxidative stress and proinflammatory cytokine levels in Freund's adjuvant-induced rheumatoid arthritis via inhibition of NF-κb. Braz. J. Med. Biol. Res. 2020;53:e9489. doi: 10.1590/1414-431x20209489. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Raetz C.R.H., Whitfield C. Lipopolysaccharide endotoxins. Annu. Rev. Biochem. 2002;71:365–700. doi: 10.1146/annurev.biochem.71.110601.135414. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. Roth N., Käsbohrer A., Mayrhofer S., Zitz U., Hofacre C., Domig K.J. The application of antibiotics in broiler production and the resulting antibiotic resistance in Escherichia coli: a global overview. Poult. Sci. 2019;98:1791–1804. doi: 10.3382/ps/pey539. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Rysman K., Eeckhaut V., Ducatelle R., Goossens E., Van Immerseel F. Broiler performance correlates with gut morphology and intestinal inflammation under field conditions. Avian Pathol. 2023;52:232–241. doi: 10.1080/03079457.2023.2201169. [DOI] [PubMed] [Google Scholar]
  38. Sampath V. Bacterial endotoxin-lipopolysaccharide; structure, function and its role in immunity in vertebrates and invertebrates. Agric. Nat. Resour. 2018;52:115–120. doi: 10.1016/j.anres.2018.08.002. [DOI] [Google Scholar]
  39. Sender R., Fuchs S., Milo R. Are we really vastly outnumbered? Revisiting the ratio of bacterial to host cells in humans. Cell. 2016;164:337–340. doi: 10.1016/j.cell.2016.01.013. [DOI] [PubMed] [Google Scholar]
  40. Shie P.H., Huang S.S., Deng J.S., Huang G.J. Spiranthes sinensis suppresses production of pro-inflammatory mediators by down-regulating the NF-κb signaling pathway and up-regulating HO-1/Nrf2 anti-oxidant protein. Am. J. Chin. Med. 2015;43:969–989. doi: 10.1142/s0192415x15500561. [DOI] [PubMed] [Google Scholar]
  41. Song W.J., Song Q.L., Chen X.L., Liu L.X., Tan J., Zou Z.H., Wei L.M., Xiong P.W., Zhang Y., Sun R.P. Effects of turpiniae folium extract on growth performance, slaughter performance, serum immune and antioxidant function and intestinal microecology in wenchang chicken under hot-humid conditions. Chin. J. Anim. Nutri. 2022;34:5048–5062. doi: 10.3969/j.issn.1006-267x.2022.08.029. [DOI] [Google Scholar]
  42. Song W.J., Song Q.L., Zou Z.H., Chen X.L., Liu L.X., Tan J., Wei L.M., Xiong P.W., Tao X.H., Sun R.P. Effects of TFE on performance, immunity, antioxidant function and microflora of Wenchang chickens. Chin. J. Anim. Nutri. 2022;34:4380–4393. doi: 10.3969/j.issn.1006-267x.2022.07.029. [DOI] [Google Scholar]
  43. Suzuki T. Regulation of the intestinal barrier by nutrients: the role of tight junctions. Anim. Sci. J. 2020;91:e13357. doi: 10.1111/asj.13357. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Tan Y., Kagan J.C. A cross-disciplinary perspective on the innate immune responses to bacterial lipopolysaccharide. Mol Cell. 2014;54:212–223. doi: 10.1016/j.molcel.2014.03.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  45. Turner J.R. Molecular basis of epithelial barrier regulation: from basic mechanisms to clinical application. Am. J. Pathol. 2006;169:1901–1909. doi: 10.2353/ajpath.2006.060681. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Umaya S.R., Vijayalakshmi Y.C., Sejian V. Exploration of plant products and phytochemicals against aflatoxin toxicity in broiler chicken production: present status. Toxicon. 2021;200:55–68. doi: 10.1016/j.toxicon.2021.06.017. [DOI] [PubMed] [Google Scholar]
  47. Wang X., Wang W., Wang L., Yu C., Zhang G., Zhu H., Wang C., Zhao S., Hu C.A., Liu Y. Lentinan modulates intestinal microbiota and enhances barrier integrity in a piglet model challenged with lipopolysaccharide. Food Funct. 2019;10:479–489. doi: 10.1039/c8fo02438c. [DOI] [PubMed] [Google Scholar]
  48. Wang X., Zhang T., Li W., Zhang M., Zhao L., Wang N., Zhang X., Zhang B. Dietary supplementation with Macleaya cordata extract alleviates intestinal injury in broiler chickens challenged with lipopolysaccharide by regulating gut microbiota and plasma metabolites. Front. Immunol. 2024;15 doi: 10.3389/fimmu.2024.1414869. [DOI] [PMC free article] [PubMed] [Google Scholar]
  49. Wang Y., Wang Y., Ma J., Li Y., Cao L., Zhu T., Hu H., Liu H. YuPingFengSan ameliorates LPS-induced acute lung injury and gut barrier dysfunction in mice. J. Ethnopharmacol. 2023;312 doi: 10.1016/j.jep.2023.116452. [DOI] [PubMed] [Google Scholar]
  50. Wang Y., Ye J., Zhang S., Chen Z., Fan Q., Jiang S. Dietary supplementation with anthocyanin attenuates lipopolysaccharide-induced intestinal damage through antioxidant effects in yellow-feathered broiler chicks. Poult. Sci. 2023;102 doi: 10.1016/j.psj.2022.102325. [DOI] [PMC free article] [PubMed] [Google Scholar]
  51. Wu M., Wu P., Xie H., Wu G., Wei X. Monoterpenoid indole alkaloids mediating DNA strand scission from Turpinia arguta. Plant. Med. 2011;77:284–286. doi: 10.1055/s-0030-1250239. [DOI] [PubMed] [Google Scholar]
  52. Wu M., Zhao G.C., Wei X.Y. Triterpenoids from the leaves of Turpinia arguta. J. Trop. Subtrop. Bot. 2012;20:78–83. [Google Scholar]
  53. Wu X.X., Huang X.L., Chen R.R., Li T., Ye H.J., Xie W., Huang Z.M., Cao G.Z. Paeoniflorin prevents intestinal barrier disruption and inhibits lipopolysaccharide (LPS)-induced inflammation in caco-2 cell monolayers. Inflammation. 2019;42:2215–2225. doi: 10.1007/s10753-019-01085-z. [DOI] [PubMed] [Google Scholar]
  54. Xiao Y., Yuan Y., Yang Y., Liu B., Ding Z., Luo J., Chen S., Yu L. GCH1 reduces LPS-induced alveolar macrophage polarization and inflammation by inhibition of ferroptosis. Inflamm. Res. 2023;72:1941–1955. doi: 10.1007/s00011-023-01785-1. [DOI] [PubMed] [Google Scholar]
  55. Xu Y., Ding X., Wang Y., Li D., Xie L., Liang S., Zhang Y., Li W., Fu A., Zhan X. Bacterial metabolite reuterin attenuated lps-induced oxidative stress and inflammation response in HD11 macrophages. Antioxid. (Basel) 2022;11:1662. doi: 10.3390/antiox11091662. [DOI] [PMC free article] [PubMed] [Google Scholar]
  56. Xu R., Ma L., Chen T., Wang J. Sophorolipid suppresses LPS-induced inflammation in RAW264.7 cells through the NF-κB signaling pathway. Molecules. 2022;27:5037. doi: 10.3390/molecules27155037. [DOI] [PMC free article] [PubMed] [Google Scholar]
  57. Xun W., Ji M., Ma Z., Deng T., Yang W., Hou G., Shi L., Cao T. Dietary emodin alleviates lipopolysaccharide-induced intestinal mucosal barrier injury by regulating gut microbiota in piglets. Anim. Nutr. 2023;14:152–162. doi: 10.1016/j.aninu.2023.05.004. [DOI] [PMC free article] [PubMed] [Google Scholar]
  58. Yan J., Zhao L.J., Li Y.M., Zhang Z.M., Lin L.M., Xia B.H. Preparation and characterization of polysaccharides from turpiniae folium and its antioxidative, anti-inflammatory activities and antiproliferative effect on VSMCs. Chem. Biodivers. 2022;19 doi: 10.1002/cbdv.202200459. [DOI] [PubMed] [Google Scholar]
  59. Yang X.L., Li L., Zhang T.F., Deng J., Lin X.L., Li Y.M., Xia B.H., Lin L.M. GC-MS-based serum metabolomic investigations on the ameliorative effects of polysaccharide from turpiniae folium in hyperlipidemia rats. Oxid. Med. Cell. Longev. 2021;2021 doi: 10.1155/2021/9180635. [DOI] [PMC free article] [PubMed] [Google Scholar]
  60. Yeung S.T., Ovando L.J., Russo A.J., Rathinam V.A., Khanna K.M. CD169+ macrophage intrinsic IL-10 production regulates immune homeostasis during sepsis. Cell. Rep. 2023;42 doi: 10.1016/j.celrep.2023.112171. [DOI] [PMC free article] [PubMed] [Google Scholar]
  61. Yi H., Zhang L., Gan Z., Xiong H., Yu C., Du H., Wang Y. High therapeutic efficacy of Cathelicidin-WA against postweaning diarrhea via inhibiting inflammation and enhancing epithelial barrier in the intestine. Sci. Rep. 2016;6:25679. doi: 10.1038/srep25679. [DOI] [PMC free article] [PubMed] [Google Scholar]
  62. Yousefi M., Jonaidi H., Sadeghi B. Influence of peripheral lipopolysaccharide (LPS) on feed intake, body temperature and hypothalamic expression of neuropeptides involved in appetite regulation in broilers and layer chicks. Br. Poult. Sci. 2021;62:110–117. doi: 10.1080/00071668.2020.1813254. [DOI] [PubMed] [Google Scholar]
  63. Zhang H., Zhuo S., Song D., Wang L., Gu J., Ma J., Gu Y., Ji M., Chen M., Guo Y. Icariin inhibits intestinal inflammation of dss-induced colitis mice through modulating intestinal flora abundance and modulating p-p65/p65 molecule. Turk. J. Gastroenterol. 2021;32:382–392. doi: 10.5152/tjg.2021.20282. [DOI] [PMC free article] [PubMed] [Google Scholar]
  64. Zhang L., Li J., Yu S.C., Jin Y., Lv X.W., Zou Y.H., Li Y. Therapeutic effects and mechanisms of total flavonoids of Turpinia Arguta seen on adjuvant arthritis in rats. J. Ethnopharmacol. 2008;116:167–172. doi: 10.1016/j.jep.2007.11.027. [DOI] [PubMed] [Google Scholar]
  65. Zhang R., Liu J., Liu Y., Wu Y., Xu Y., Feng J. Dietary garlic powder alleviates lipopolysaccharide-induced inflammatory response and oxidative stress through regulating the immunity and intestinal barrier function in broilers. Anim. (Basel) 2022;12:2281. doi: 10.3390/ani12172281. [DOI] [PMC free article] [PubMed] [Google Scholar]
  66. Zhang X., Zhao L., Cao F., Ahmad H., Wang G., Wang T. Effects of feeding fermented Ginkgo biloba leaves on small intestinal morphology, absorption, and immunomodulation of early lipopolysaccharide-challenged chicks. Poult. Sci. 2013;92:119–130. doi: 10.3382/ps.2012-02645. [DOI] [PubMed] [Google Scholar]
  67. Zhong W.J., Yang H.H., Guan X.X., Xiong J.B., Sun C.C., Zhang C.Y., Luo X.Q., Zhang Y.F., Zhang J., Duan J.X., Zhou Y., Guan C.X. Inhibition of glycolysis alleviates lipopolysaccharide-induced acute lung injury in a mouse model. J. Cell. Physiol. 2019;234:4641–4654. doi: 10.1002/jcp.27261. [DOI] [PubMed] [Google Scholar]
  68. Zhou X., Wang L., Wang Z., Zhu P., Chen Y., Yu C., Chen S., Xie Y. Impacts of Eimeria coinfection on growth performance, intestinal health and immune responses of broiler chickens. Vet. Parasitol. 2023;322 doi: 10.1016/j.vetpar.2023.110019. [DOI] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES