Lean ZSF1 rats in basic research on heart failure with preserved ejection fraction

Abstract

Aims

ZSF1 obese rats harbouring two mutant leptin receptor alleles (Lepr ^cp and Lepr ^fa ) develop metabolic syndrome and heart failure with preserved ejection fraction (HFpEF), making them a widely used animal model in cardiometabolic research. Studies using ZSF1 rats have contributed significantly to the elucidation of pathophysiological mechanisms underlying HFpEF and therapeutic strategies against this multi‐organ syndrome. In contrast, hybrid, lean ZSF1 rats (L‐ZSF1) do not develop HFpEF and generally serve as controls, disregarding the possibility that the presence of one mutant Lepr allele might affect left ventricular ejection fraction (LVEF), diastolic dysfunction and other relevant HFpEF parameters, such as N‐terminal pro‐brain natriuretic peptide (NT‐proBNP) levels and cardiac inflammation, which could increase during disease manifestation.

Methods and Results

We collected specimens and echocardiography data of male and female L‐ZSF1 rats (n = 165; ZSF1‐Lepr ^fa Lepr ^cp /Crl) at the age of 6–32 weeks from four independent research groups and performed genotyping as well as the genotype–phenotype analyses. The genotype distribution within L‐ZSF1 was in line with the Hardy–Weinberg equilibrium. Genotypes were not associated with CD68 counts (n = 52, P = 0.886), E/e′ ratio (n = 125, P > 0.250) and NT‐proBNP (n = 126, P = 0.874). LVEF significantly decreased from 25 weeks of age (P = 0.021) but was independent of the genotype (P = 0.768 at <25 weeks of age and P = 0.069 at ≥25 weeks of age, n = 128).

Conclusions

In conclusion, validation of the genotype distribution in L‐ZSF1 rats revealed no associations between the genotype and HFpEF‐relevant measures, namely, NT‐proBNP, CD68 count, LVEF or E/e′.

Background

Heart failure with preserved ejection fraction (HFpEF) is associated with high morbidity and mortality with limited therapeutic options due to an incomplete understanding of the underlying mechanisms. After crossing a female Zucker diabetic fatty (ZDF) female rat with a spontaneously hypertensive heart failure (SHHF) male rat, 25% of the offspring is compound heterozygous for both parental leptin receptor mutations (Lepr ^{fa 1} /Lepr ^{cp 2} alleles). These ZSF1 rats develop obesity, hyperlipidaemia, hyperglycaemia, hypertension and HFpEF, thereby serving as a clinically relevant animal model (O‐ZSF1) to investigate pathomechanisms ³ , ⁴ , ⁵ and to develop therapies ⁶ , ⁷ , ⁸ , ⁹ for HFpEF induced by metabolic syndrome. Their phenotypic lean littermates with different leptin receptor genotypes [wild‐type (wt)/Lepr ^fa , wt/Lepr ^cp or wt/wt] are used as controls (L‐ZSF1) in experimental studies. Recently, a comparison of Wistar–Kyoto outbreed rats with inbreed L‐ZSF1 (aged 20 weeks) indicated cardiomyocyte hypertrophy and hypertension in the latter. ⁵ Furthermore, cardiovascular diseases, like hypertension and cardiac hypertrophy, are frequently observed in heterozygous rats of the parental strains, ¹⁰ , ¹¹ , ¹² , ¹³ which might affect the interpretation of the results and, thus, complicate their use as ‘healthy’ controls.

Aims

We analysed potential associations between L‐ZSF1 genotypes and echocardiographic parameters, including left ventricular (LV) ejection fraction (LVEF %) and E/e′ ratio (a measure of myocardial stiffness), as well as circulating N‐terminal pro‐brain natriuretic peptide (NT‐proBNP) level and cardiac macrophage invasion as a measure of inflammatory remodelling.

Methods

Specimens and data from 165 ZSF1 lean rats (49% male and 51% female, ZSF1‐Lepr ^fa Lepr ^cp /Crl, Charles River, USA) at 6–32 weeks of age were collected from four independent research groups (A—Dresden; B—Graz; C—Leipzig; and D—Porto). All experiments and procedures were performed in accordance with national and European ethical regulations (Directive 2010/63/EU). Rats were kept under a 12:12 h light/dark cycle and had access to water and standard chow rich in energy and protein content (5008*, Ssniff, Soest, Germany) ad libitum. Non‐invasive echocardiography was done according to published studies of the groups. ⁴ , ⁹ , ¹⁴ In brief, LVEF was determined in B‐mode (A) or M‐mode (B–D) (A and B: Vevo 3100 system equipped with a 24 MHz linear array transducer, VisualSonics Inc., Amsterdam, The Netherlands; C: Vivid‐J, GE Healthcare, Chicago, USA; and D: Sequoia 15L8W equipped with a 15 MHz linear probe ⁵ ). Diastolic function was assessed in the apical four‐chamber view using pulsed‐wave Doppler to measure early mitral valve velocity (E) and using tissue Doppler to measure early diastolic mitral annular velocity (e′) as close as possible to the mitral annulus to assess the areas with greater excursion, enabling the recording of maximal velocities with a better temporal resolution. ¹⁵ Groups A–C determined e′ in septal position, whereas Group D determined e′ in a lateral position of the left ventricle. Blood was withdrawn at sacrifice from the beating heart. NT‐proBNP was determined from all available samples in a single measurement using an enzyme‐linked immunosorbent assay (ELISA) kit (abx256287, Hölzel Diagnostika, Cologne, Germany) following the manufacturer's instructions. Cardiac tissue was fixed in 4% paraformaldehyde, embedded in paraffin and cut into 4‐μm‐thick sections. All samples were stained for macrophages using CD68 antibody (MCA341R, Bio‐Rad, Hercules, USA). Macrophage numbers were normalized to the sample area. Genotypes were determined using allele‐specific primers. The ZDF allele Lepr ^fa was amplified using 5′‐GCGTATGGAAGTCACAGATG‐3′ and 5′‐GAGACTCAGGAATCTCTAATTGC‐3′ (179 bp product). The SHHF allele Lepr ^cp was amplified using 5′‐GCAGTCACTCAGTGCTTATCC‐3′ and 5′‐AGGTTCTTCCATTCAATAACCAG‐3′ (108 bp product). Resulting fragments were digested with mutant‐specific restriction enzymes, separated using polyacrylamide gel electrophoresis and analysed after ethidium bromide staining (Lepr ^wt : no cutting; Lepr ^fa : MspI, 80 and 99 bp; and Lepr ^cp : TruI, 38 and 70 bp). SPSS Version 29 (IBM, Armonk, USA) was used for the statistical analysis, and GraphPad Prism Version 8.4.3 was used to create graphs (Dotmatics, Boston, USA). Normal distribution of the data was confirmed using the Kolmogorov–Smirnov test, and means were compared using ANOVA with Bonferroni post hoc testing. Correlations were analysed using the Pearson correlation coefficient.

Results

For the final genotype–phenotype analyses, 165 L‐ZSF1 rats, 52 CD68 counts, 126 NT‐proBNP measurements, and 128 LVEF and 125 E/e′ values were accessible (Figure 1). In all analysed rats, CD68 counts were 13.13 [0, 113] (mean [min, max]), NT‐proBNP was 2.54 [0.18, 13.8] ng/mL, LVEF was 71 [52, 94] and E/e′ was 17.9 [8.7, 27.4]. LVEF was significantly decreased in older rats (P < 0.001), with significant differences between animals older or younger than 25 weeks. Compared with the rats from Groups A–C, the E/e′ ratio was significantly different in rats from Group D, likely due to the different location of e′ assessment, lateral, axial and temporal resolution, as well as the scanhead positioning and echocardiography machine used (P < 0.001). Overall genotype distribution was wt/Lepr ^fa  = 53, wt/Lepr ^cp  = 50 and wt/wt = 62.

Figure 1.

Genotypes in lean ZSF1 rats [two wild‐type alleles (wt/wt), heterozygous for the leptin receptor mutation fa allele from the Zucker diabetic fatty mother rat (wt/fa) and heterozygous for the leptin receptor mutation cp allele from the spontaneously hypertensive heart failure father rat (wt/cp)] and their potential impact on phenotypes that are used to describe pathological alterations in heart failure with preserved ejection fraction. Blue boxes indicate male rats, and red boxes indicate female rats. Numbers in brackets indicate the number of L‐ZSF1 rats. CD68, macrosialin—a marker for tissue macrophages; E/e′, ratio between early mitral valve velocity (E) and early diastolic mitral annular velocity (e′); LVEF, left ventricular ejection fraction; NT‐proBNP, N‐terminal pro‐brain natriuretic peptide.

Assuming an equal Mendelian inheritance of 25% offspring per allele combination, including the potentially expectable 25% Lepr ^fa /Lepr ^cp obese ZSF1 rats, these numbers are within the Hardy–Weinberg equilibrium. We found that the genotype was not associated with CD68 counts (P = 0.886) or NT‐proBNP (P = 0.874). LVEF was also similar in all animals <25 weeks of age (n = 73, P = 0.768) and ≥25 weeks of age (n = 65, P = 0.069), irrespective of the genotype. Moreover, the E/e′ ratio was comparable in all three genotypes of Group A–C rats (n = 105, P = 0.256) and Group D animals (n = 20, P = 0.276). The impact of the genotype was subanalysed accounting for the sex of the animals (Table 1). NT‐proBNP and LVEF % were significantly higher in female rats of the genotype wt/wt but comparable in animals with the Lepr ^fa or Lepr ^cp allele. In contrast, only female rats with the wt/Lepr ^cp genotype had a significantly higher E/e′ ratio (Groups A–C).

Table 1.

Mean (M) with standard deviation (SD) and number of animals per comparison are given.

	wt/wt			wt/fa			wt/cp			Genotype comparisons			♀/♂ comparisons
	All	♀	♂	All	♀	♂	All	♀	♂	All	♀	♂	wt/wt	wt/fa	wt/cp
n (total)
	62	30	32	53	31	22	50	23	27
CD68 count
M ± SD	13.7 ± 16.3	12.7 ± 10.1	14.2 ± 19.3	10.8 ± 18.1	8.7 ± 7.7	12.6 ± 24.5	14.2 ± 24.9	9.8 ± 4.7	18.2 ± 34.4	0.886	0.604	0.896	0.857	0.716	0.477
n	20	7	13	13	6	7	19	9	10
NT‐proBNP
M ± SD	2.5 ± 2.6	3.3 ± 3.2	1.5 ± 0.9	2.4 ± 2.3	2.6 ± 2.5	2 ± 1.9	2.7 ± 2.2	2.1 ± 1.4	3.3 ± 2.7	0.874	0.299	0.21	0.024	0.397	0.081
n	47	27	20	41	27	14	38	20	18
E/e′ ratio (Groups A–C)
M ± SD	18.1 ± 3.9	18.7 ± 3.5	16.4 ± 4.5	19.3 ± 3.2	19.6 ± 3.3	17.7 ± 2.7	19.4 ± 3.6	20.3 ± 3.5	17.2 ± 3.1	0.256	0.304	0.794	0.105	0.196	0.038
n	38	28	10	37	31	6	30	22	8
E/e′ ratio (Group D)
M ± SD	11.7 ± 1.5	nm	11.7 ± 1.5	12.5 ± 0.7	nm	12.5 ± 0.7	13 ± 2	nm	13 ± 2	0.276	na	0.276	na	na	na
n	7	nm	7	4	nm	4	9	nm	9
LVEF % < 25 weeks
M ± SD	72.9 ± 8.2	72.8 ± 8.4	72.9 ± 8.2	74.5 ± 8	73.8 ± 9.3	76.1 ± 3.3	73.7 ± 6.6	72.3 ± 6.7	75.7 ± 6.3	0.768	0.874	0.551	0.978	0.527	0.229
n	25	16	9	25	18	7	23	13	10
LVEF % > 25 weeks
M ± SD	67.7 ± 7.2	70.5 ± 7.4	64.3 ± 5.6	72 ± 8.7	71.6 ± 9.3	73.6 ± 6.2	65.7 ± 7.8	65.2 ± 9	66.2 ± 6.7	0.069	0.217	0.099	0.044	0.739	0.803
n	22	12	10	16	13	3	17	9	8

Note: ANOVA was used to detect significant differences (bold) between the different genotypes [wild‐type (wt), Lepr ^fa (fa) and Lepr ^cp (cp)] and between female (♀) and male (♂) rats. Group D analysed only male rats; thus, some data and the equivalent comparisons are not accessible (na).

Abbreviations: LVEF, left ventricular ejection fraction; nm, not measured; NT‐proBNP, N‐terminal pro‐brain natriuretic peptide.

Conclusions

The genotype distribution in L‐ZSF1 rats showed an expected distribution of parental allele inheritance. Furthermore, in all analysed rats, we found no genotype association with relevant measures of HFpEF, namely, NT‐proBNP, CD68 count, LVEF or E/e′. Thus, the genotype of L‐ZSF1 rats can likely be neglected in experimental studies that rely on these parameters. Nevertheless, sex should be taken into account in experimental planning as it may have an impact on NT‐proBNP level, LVEF % or E/e′ ratio. Importantly, the parental strain‐derived alleles Lepr ^fa and Lepr ^cp were associated with cardiovascular and metabolic diseases. ¹⁰ , ¹¹ , ¹² , ¹³ Lean SHHF rats, heterozygous for the Lepr ^cp allele, develop LV hypertrophy at the age >57 weeks compared with outbreed Wistar rats. ¹² Also, SHHF male rats have been reported to develop heart failure starting >10 months of age and earlier than female rats. ¹³ Lean wild‐type ZDF rats aged 14 weeks were found to suffer from mild renal pathology, had increased angiopoietin 1 level and showed decreased LV end‐diastolic pressure compared with outbreed Sprague–Dawley rats, suggesting that these alterations may contribute to cardiac dysfunction at increased age. ¹¹ Importantly, we found a significant decrease in LVEF in all L‐ZSF1 genotypes at the age of >25 weeks. However, no animal older than 32 weeks was included in the analysis. This is partly due to the fact that advancing age in ZSF1 rats is associated with progressive obesity, severe diabetes, metabolic syndrome, diabetic nephropathy, moderate hepatic steatosis and diastolic LV dysfunction, which is an increasingly distressing phenotype. ¹⁶ In summary, although L‐ZSF1 rats can be regarded as a reliable control group at younger ages, further studies should examine whether L‐ZSF1 rats of different genotypes and sex are more prone to develop heart disease during ageing.

Büttner, P. , Augstein, A. , Abdellatif, M. , Lourenço, A. , Leite‐Moreira, A. , Falcão‐Pires, I. , Werner, S. , Thiele, H. , Sedej, S. , Schauer, A. , and Adams, V. (2025) Lean ZSF1 rats in basic research on heart failure with preserved ejection fraction. ESC Heart Failure, 12: 1474–1478. 10.1002/ehf2.15111.