Skip to main content
NCBI home page
ACS Pharmacology & Translational Science logoLink to ACS Pharmacology & Translational Science
. 2025 Feb 14;8(3):748–761. doi: 10.1021/acsptsci.4c00639

Anti-Inflammatory, Antihyperalgesic, and Gastric Safety Profiling of Ocimene: Attenuation of Nonsteroidal Anti-Inflammatory Drug-Induced Gastric Ulcers by Modulating Toll-like Receptor 4 and Pyroptosis Pathways

Iqra Laraib †, Sumera Qasim ‡,*, Ambreen Malik Uttra †,*, Fakhria A Al-Joufi ‡
PMCID: PMC11915039  PMID: 40109750

Abstract

graphic file with name pt4c00639_0015.jpg

Monocyclic monoterpenoid ocimene (OC) was evaluated as a potential inhibitor of TLR4/NLRP3/GSDMD-driven pyroptosis, implicated in conditions such as chronic pain, inflammation, and gastric ulcers. This study investigated OC’s protective effects against indomethacin (IND)-induced gastric ulcers, aiming to identify an analgesic and anti-inflammatory agent with enhanced gastric safety. OC’s analgesic efficacy was demonstrated by reducing formalin-evoked paw licking, writhing provoked by acetic acid-induced and tail immersion reaction latencies in animal models. Anti-inflammatory effects were confirmed through reduced paw edema (formalin and carrageenan), along with in vitro suppression of protein denaturation and membrane stabilization. qRT-PCR showed that OC significantly (p < 0.001) downregulated TLR4, MyD88, NFκB, NLRP3, and inflammatory mediators (IL-18, IL-1β, caspase-1, ASC, GSDMD, COX-1, COX-2) with upregulation of anti-inflammatory cytokines IL-4 and IL-10. ELISA results indicated a reduction in the oxidative stress marker MDA and inflammatory mediators PGE-2 and 5-LOX, with increased antioxidant markers GSH, CAT, and SOD. Macroscopic and histological analysis showed that OC provided gastric protection by reducing the ulcer index (UI) and improving ulcer scores, with effects comparable to omeprazole. In summary, OC shows potential as a safe antinociceptive and anti-inflammatory agent, effectively reducing gastric ulcer risk by mitigating pyroptosis and inflammation, critical for treating chronic inflammatory conditions with hyperalgesia.

Keywords: ocimene, pyroptosis, anti-inflammatory, gastric ulcer protection, analgesic activity, TLR4/NLRP3 pathway

Chronic pain and inflammation particularly afflicted with certain disorders are of significant concern.1 Pain and inflammation manifest enhanced cytokine release, leading to persistent hyperalgesia, which negatively affects the quality of life.2 NSAIDs are commonly used to treat and mitigate inflammatory diseases, as well as acute and chronic pain. Despite the fact that these drugs successfully lessen the edema caused by inflammation, nonselective or selective inhibition of the constitutive form of cyclooxygenase is linked to serious side effects from NSAIDs, including ulceration and bleeding in the gastrointestinal tract.3 The symptoms occur in 20–30% of chronic users and 40% of the general population.4 However, selective NSAIDs exclusively inhibit COX-2 and do not alter the protective impact of prostaglandins, catalyzed by COX-1, on the gastrointestinal tract and platelets; therefore, they significantly reduce the likelihood of gastrointestinal side effects. Despite being the most widely used therapeutic option for inflammatory complaints, selective COX-2 inhibitors are frequently linked to potential cardiovascular disease side effects.5 Managing inflammation has become more challenging since selective COX-2 inhibitors such as rofecoxib and valdecoxib were withdrawn from use over concerns about cardiovascular side effects.1 Therefore, it is necessary and urgent to find an alternative pain-relieving drug, associated with acute and chronic inflammatory conditions with high safety, fewer side effects, and convenient access to prevent or treat associated gastric ulcer injury.

Recent research has increasingly centered on identifying phytochemicals with therapeutic and preventive potential in inflammation-related diseases. Many such compounds have shown effectiveness in modulating inflammation by inhibiting key proinflammatory mediators.6 Monoterpene ocimene (OC), specifically, has been reported to exhibit substantial anti-inflammatory effects, including the suppression of TNF-α, iNOS, COX-2, IL-1β, and IL-6.7 Furthermore, the antinociceptive properties of essential oils such as those from Piper mollicomum have been highlighted,8 along with the antioxidant and anti-inflammatory effects of volatile oil constituents from Ocimum americanum Linn, which contains OC as a major component.9 These properties suggest OC as a promising candidate for both analgesic and anti-inflammatory applications, especially under chronic inflammatory conditions where long-term treatment may be necessary.

In addition to its effects on inflammatory mediators, OC’s role in mitigating cellular processes like pyroptosis, particularly through pathways such as TLR4/NLRP3/GSDMD, remains underexplored. Given the challenges of NSAID-related GI side effects, this study aims to evaluate the anti-inflammatory and antihyperalgesic potential of OC, along with its gastric-protective effects against NSAID-induced ulceration. We focused on examining how OC influences the expression of specific inflammatory genes (IL-1β, IL-18, NLRP3, MyD88, NFκB, caspase-1, and ASC) and the TLR4/GSDMD-mediated pyroptosis pathway. By characterizing the effects of OC on these markers, this study seeks to establish its efficacy in modulating inflammation and pain while potentially offering a safer alternative for gastric health in long-term inflammatory treatments.

1. Results

1.1. Effect of OC as an Antihyperalgesic Agent

1.1.1. Test for Paw Licking Induced by Formalin

OC exhibited dose-dependent antinociception in formalin-provoked paw licking as seen in Figure 1. At 200 mg/kg, OC showed inhibition during the neurogenic phase (0–5 min), reflecting 58% of mean possible effect (MPE), while piroxicam (PXM) exhibited 51% response. Nonetheless, the test drug (200 mg/kg) showed up to 99.3% MPE during the inflammatory phase (15–30 min), whereas PXM showed up to 92% of the maximum possible effect.

Figure 1.

Figure 1

Open in a new tab

Rat formalin-induced nociception: OC impacted both phase I, lasting 0–5 min, and phase II, lasting 15–30 min. Data are expressed as mean ± SEM (n = 6) and analyzed using two-way ANOVA with Dunnett’s test. Significance levels, compared to the disease control group, are indicated as follows: ***p < 0.001 and ns = nonsignificant.

1.1.2. Writhing Test via Acetic Acid (AA) Administration

OC considerably reduced acetic acid-induced writhing episodes. The % protection was 86% (p < 0.001) at 200 mg/kg of OC. These outcomes were analogous to those of PXM, which demonstrated 81% inhibition (Figure 2).

Figure 2.

Figure 2

Open in a new tab

Impact of OC on AA-induced nociception in rats. Data are expressed as mean ± SEM (n = 6) and analyzed using two-way ANOVA with Dunnett’s test. Significance levels, compared to the disease control group, are indicated as follows: ***p < 0.001.

1.1.3. Tail Immersion Test

Figure 3 shows the impact of the OC on reaction latencies. The results of these treatments showed a maximum reaction at the highest dose, which was statistically significant (p < 0.001). At 45, 60, and 90 min, the reaction latencies at 200 mg/kg dose were 7.73 ± 0.21, 8.4 ± 0.09, and 8.63 ± 0.88, respectively. PXM-provided group had reaction latencies of 6.91 ± 0.30, 7.76 ± 0.20, and 8.4 ± 0.08 at the same time intervals.

Figure 3.

Figure 3

Open in a new tab

Rat tail immersion assay: the impact of OC. Data are expressed as mean ± SEM (n = 6) and analyzed using two-way ANOVA with Dunnett’s test. Significance levels, compared to the disease control group, are indicated as follows: ***p < 0.001 and **p < 0.01.

1.2. Effect of OC as an Anti-Inflammatory Agent

1.2.1. Effect of OC on Paw Edema Produced by Formalin

After 5 h, OC (200 mg/kg) produced an inhibition of 84.26%. Rats administered 10 mg/kg of the reference medication PXM, on the other hand, demonstrated a 79.85% decrease in inflammation. This suggests that OC works better as an anti-inflammatory drug than the reference drug (Figure 4).

Figure 4.

Figure 4

Open in a new tab

Effect of OC on formalin-induced paw edema in rats. Data are expressed as mean ± SEM (n = 6) and analyzed using two-way ANOVA with Dunnett’s test. Significance levels, compared to the disease control group, are indicated as follows: ***p < 0.001, **p < 0.01, and ns = nonsignificant.

1.2.2. Impact of OC on Paw Edema Caused by Carrageenan

Oral therapy with OC (200 mg/kg) significantly (p < 0.001) reduced paw edema in the first, second, third, and fourth hours after the carrageenan test (Figure 5). The carrageenan test results for OC showed 67.04% inhibition in the final hour, which is like PXM’s 63.30% inhibition.

Figure 5.

Figure 5

Open in a new tab

Effects of OC on carrageenan-induced edema in rats. Data are expressed as mean ± SEM (n = 6) and analyzed using two-way ANOVA with Dunnett’s test. Significance levels, compared to the disease control group, are indicated as follows: ***p < 0.001, **p < 0.01, *p < 0.05, and ns = nonsignificant.

1.2.3. Effect of OC in the In Vitro Assays

Antidenaturation effects of OC on egg albumin and BSA are summarized in Figure 6. OC has been shown to subdue protein denaturation in a concentration-specific response; at 6400 μg/mL, it inhibits BSA by 83.56% and egg albumin by 81.25%. The OC is clearly more effective than the standard drug, which shows protection of 76.32% against egg albumin and 78.65% against BSA, respectively. In the HRBC membrane stabilization experiment, OC and the reference drug PXM considerably inhibited (p < 0.001) the lysis of erythrocyte membranes caused by hypotonic solution. The OC showed an 81.75% suppression of RBC hemolysis at 6400 μg/mL, whereas PXM offered 77.22% protection (Figure 6).

Figure 6.

Figure 6

Open in a new tab

Impact of OC on in vitro test analysis, such as membrane stabilization assay (HRBC) and protein denaturation (BSA and Egg Albumin Assay). The findings are shown as mean (n = 3) ± SEM.

1.3. Gastroprotective Impact of OC

1.3.1. Impact of OC on Gastric Physicochemical and Morphological Parameters

Figure 7 illustrates the gastroprotective benefits of OC in ulcerative lesions produced by IND. The test chemical pretreatment clearly reduced the number of lesions (p < 0.001) leading to a significant 73.51% gastroprotection against the ulcer. Rats given just IND had a significant increase in the gastric juice volume (2.98 ± 0.07 vs 1.2 ± 0.03 mL) and a fall in pH (3.6 ± 0.073 vs 1.88 ± 0.037) relative to rats included in the control group. OC (200 mg/kg) caused a noticeable decrease in stomach capacity (1.37 ± 0.053) and adjusted pH to 3.4 ± 0.10. Rats treated with OC showed a significant reduction in IND-induced stomach exudation and volume expansion. Notably, stomach morphometric alterations brought on by IND were significantly lessened at the maximum dose.

Figure 7.

Figure 7

Open in a new tab

Impact of OC on the number of lesions, pH, stomach volume, ulcer index, and severity score in rats. The results are shown as mean ± SEM (n = 6), and a two-way ANOVA is followed by a Dunnett’s test. ns = nonsignificant, *** p < 0.001, and **p < 0.01, relative to the disease control group.

1.3.2. Impact of OC on the Expression of Proinflammatory Genes (qRT-PCR Analysis)

Quantitative reverse transcription polymerase chain reaction was used to evaluate the impact of OC on the expression of TLR4, MyD88, NLRP3, NFκB, IL-1b, IL-18, IL-10, IL-4, ASC, caspase-1,GSDMD, COX-1, and COX-2 genes. Figure 8 shows that the treated groups had significantly decreased levels of gene expression for TLR4, MyD88, NLRP3, NFκB, IL-1b, IL-18, ASC, caspase-1, GSDMD, COX-1, and COX-2. In contrast, there was a significant (p < 0.001) increase in the levels of IL-10 and IL-4 relative to the disease control animals.

Figure 8.

Figure 8

Figure 8

Open in a new tab

TLR4, MyD88, NFκB, NLRP3, ASC, caspase-1, IL-1b, IL-18, GSDMD, IL-10, IL-4, COX-1, and COX-2 gene expressions are all affected by OC. The results are shown as mean ± SEM (n = 6), and a two-way ANOVA is followed by a Dunnett’s test. ns = nonsignificant, ***p < 0.001, **p < 0.01, and *p < 0.05, relative to the disease control group.

1.3.3. Effects of OC on PGE2 and 5-LOX

The administration of OC orally to rats with IND-induced stomach ulcers resulted in a considerable (p < 0.001) suppression of serum PGE-2 and 5-LOX, as shown in Figure 9. With a 200 mg/kg dose, the measured serum PGE-2 level was (3.0 ± 0.02), considerably less than the disease control (75.25 ± 1.6). Furthermore, a significant drop in 5-LOX levels was also seen to (0.255 ± 0.001) relative to the disease control (0.97 ± 0.011).

Figure 9.

Figure 9

Open in a new tab

OC’s effects on 5-LOX and PGE-2. The findings are presented as mean ± SEM (n = 6), with Dunnett’s test conducted after a two-way ANOVA. In comparison to the disease control group, ***p < 0.001, **p < 0.01, *p < 0.05, and ns = nonsignificant.

1.3.4. Evaluation of OC’s Impact on Oxidative Stress Indicators

Serum levels of oxidative stress indicators, such as MDA, a result of lipid peroxidation and SOD, CAT, GSH, and others, were measured for each group in the current investigation. Compared to the ulcerative group (37.81 ± 1.02, 10.65 ± 0.27, 34.18 ± 2.6), the levels of SOD, CAT, and GSH were significantly elevated by OC at a 200 mg/kg dose (194.76 ± 2.74, 61.81 ± 1.07, 205.59 ± 2.33). On the other hand, the MDA level decreased to 32.32 ± 1.4 compared to a significantly higher (317.06 ± 0.82) level in the ulcer control group (Figure 10).

Figure 10.

Figure 10

Open in a new tab

Impact of OC on MDA, CAT, SOD, and GSH. The findings are presented as mean ± SEM (n = 6), with Dunnett’s test conducted after a two-way ANOVA. In comparison to the disease control group, *** p < 0.001, **p < 0.01, *p < 0.05, and ns = nonsignificant.

2. Histopathological Studies

Histological results of the stomach tissues showed marked ulceration, hemorrhage, neutrophil infiltration, and an increased area of mucosal necrosis in rats induced with IND to produce ulcers. However, results from groups III and IV showed that minor degenerative modifications of the gastric mucosa reduced congestion and leukocytic cell infiltration. Group III exhibited mild indications of submucosal edema. Furthermore, group V showed nearly total mucosal tissue healing (Figure 11).

Figure 11.

Figure 11

Open in a new tab

H&E-stained sections of the stomach tissue showing (a) normal muscularis mucosa (yellow arrow), normal surface columnar epithelium (green arrow), and normal stomach mucosa and submucosa are all discernible in the normal control group. (b) Disease control group displayed hemorrhagic ulcers, deteriorating surface columnar epithelium (star), degraded gastric pits, bleeding in the lamina propria, and an increase in parietal and chief cell populations (circle). (c) Normal submucosa and mucosa of the stomach, the fibroblast buildup, and the minor degeneration of the stomach glands (blue arrow) are all visible at an OC dose of 50 mg/kg. (d) OC 100 mg/kg dose demonstrating normal muscularis mucosa and surface columnar epithelium (yellow arrow); (e) OC 200 mg/kg dose demonstrating normal gastric mucosa and submucosa, normal parietal cells, and normal chief cells (red arrow). (f) OMP 20 mg/kg demonstrating normal stomach pits and surface columnar epithelium (green arrow) with normal facial epithelium.

3. Discussion

Numerous molecular signaling pathways contribute to the inflammatory process, which is an integral hallmark of many diseases. NSAIDs are commonly used in the management of pain, fever, and inflammation due to their pervasive use and accessibility. However, NSAIDs are frequently associated with gastric ulceration.10 Many researchers have investigated the pathophysiology of chronic pain conditions to identify new drug targets for developing innovative nonopioid analgesics. With a significant unmet need for analgesic and anti-inflammatory drugs that are both effective and well-tolerated, one promising target is the NLRP3 inflammasome pathway, which is implicated in the pathogenesis of neuropathic and chronic inflammatory pain.11

The activation of NLRP3 in macrophages requires two steps: a priming step (signal 1) that initiates NF-κB-mediated synthesis of pro-IL-1β and NLRP3 and an activation step (signal 2) that initiates caspase-1-mediated cleavage of pro-IL-1β.12 Targeting several nodes in a pathway instead of just one would be more effective because it has been shown that biological systems are only resilient when they are a part of a network.13Figure 12 shows the involvement of TLR4/NLRP3/GSDMD in various gastric disorders. Apart from impeding pyroptosis induced by TLR4/NLRP3/GSDMD, the OC also inhibits the 5-LOX enzyme. As a result, it is thought that the OC is a good fit for a multimodal strategy to treat inflammatory complaints.

Figure 12.

Figure 12

Open in a new tab

Mechanistic pathway of pyroptosis in gastric disorders.

Nociception, as a crucial event in the inflammatory process, can be neurogenic or inflammatory, and these phases are influenced by the duration of the process, as well as immunological factors.14 Imbalance in the NLRP3 inflammasome activation is associated with excessive production of the proinflammatory cytokines, IL-1β and IL-18, leading to severe inflammation. IL-1β and IL-18 secreted by macrophages induce pronociceptive signaling by sensitizing primary afferent sensory nerve fibers, following interaction with their corresponding receptors on nerve terminals. Acetic acid is a well-recognized visceral pain model in rodents, which triggers abdominal contractions (writhing) resulting in response to noxious irritants and are considered as manifestation of pain.15 Acetic acid activates peripheral nociceptors on sensory nerve fibers through the production of proinflammatory mediators and causes pain and hyperalgesia16 According to present findings, OC pretreatment demonstrated a noteworthy (p < 0.001) anti-inflammatory effect that was comparable to the anti-inflammatory effect of PXM. These findings are consistent with previously published research showing similar effects of cuminic alcohol (4-isopropylbenzyl alcohol; 4-IPBA), a monocyclic terpenoid, against acetic acid-induced writhings.17

The formalin test, which produces a characteristic biphasic nociception, displays a peripheral and central nociceptive behavior. The early neurogenic phase reflects the release of Substance P starts immediately (0–5 min), whereas late inflammatory phase began from 15 to 30 min and is subject to the presence of bradykinin, histamine, prostaglandins, TNF-α, and NO levels. Importantly, TNF-α stimulates prostanoid and sympathetic amine production playing a critical role in the maintenance of long-lasting nociception.18 The inhibition of licking by OC at both phases, nonetheless, is ascribed to the analgesic activity mediated by suppressing both neurogenic and inflammatory nociception. The fact that OC suppressed licking in both experimental phases suggests that the analgesic effect is mediated by a reduction in neurogenic and inflammatory nociception, potentially through lowering prostaglandin, histamine, prostaglandin-TNF-α, and NO levels. Citronellal isomers, which are monoterpenes by nature, have previously been shown to have similar effects by successfully reducing the inflammatory reactions triggered by formalin injection stimulation.19

It is believed that tail immersion is a particularly helpful method for evaluating the effects of centrally acting antinociceptive medications and opioid receptor agonists. Opioid μ receptor agonists demonstrate increased sensitivity to thermal nociceptive tests, like the tail immersion test. Extending the delay in latency time by test samples indicates that OC may have affected spinal and supraspinal receptors. This suggests that OC may have an impact on both the central and peripheral nociceptive behaviors.

Inflammation induced by carrageenan and formalin is linked to heightened activity of the NF-κB signaling pathway. NF-κB expression is upregulated via toll-like receptor-4 (TLR-4) and is suppressed in the cytosol by inhibitory kappa B (IκB). Furthermore, the activation of TLR-4 elicits the degradation of IκB, successively triggering the NF-κB signaling. Upon activation, NF-κB penetrates the nucleus to initiate the production of proinflammatory cytokines such as IL-1β and IL-18. The inflammatory cytokines intensify persistent inflammation by means of a positive feedback system. When compared to the disease control, OC has demonstrated a significant (p < 0.001) decrease in acute inflammatory pain caused by carrageenan in this investigation. Similarly, OC also exhibited a noticeable reduction in the biphasic pain and inflammation following formalin induction; these results are in accordance with the previously reported results.20 The inhibition of NF-κB signaling results in reducing the activation of proinflammatory cytokines, which might have enabled the achievement of this goal. Similar results have been shown by monoterpene terpinolene, such as a decrease in the licking time in a formalin-created model and a decrease in paw volume in a carrageenan-induced model.21

Denaturation of proteins is a well-established source of inflammation.22 Stressful conditions including chemicals and heat can cause proteins to denature, which in turn triggers the production of auto antigens that damage the cartilage and synovial membrane of joints23 and other inflammatory diseases such as asthma, RA, and chronic GU.24 OC hindered the denaturation of BSA and egg albumin, demonstrating 83.56 and 81.25% inhibition, respectively, at 6400 μg/mL. Studies indicate that lysosomes are essential in the inflammatory process due to their role in releasing bactericidal enzymes, proteases, and activated neutrophils. Consequently, regulating the release of these components by stabilizing the lysosomal membrane is crucial to prevent damage to the inflamed tissue.25 Protection or stabilization of the HRBC membrane by anti-inflammatory drugs during hyposaline-induced hemolysis is the principle behind the HRBC membrane stabilization assay as this membrane shows analogy with the lysosomal membrane.26 OC showed significant (p < 0.001) activity in the HRBC membrane stabilization assay. The results are in accordance with the previously reported studies.27,28 Moreover, terpinen 4-ol, a monoterpene, has demonstrated similar effects by significantly reducing protein denaturation and stabilizing the membrane.29

It has been well-documented that the inflammasome NLRP3 plays a crucial role in gastric ulcers. The innate immune receptor protein NLRP3, the adaptor protein ASC, and the inflammatory protease caspase-1 make up the cytosolic multiprotein complex known as the NLRP3 inflammasome, which is activated in response to environmental stimuli, endogenous danger signals, and microbial infection.30 NLRP3 triggers caspase-1 and gasdermin D in reaction to oxidative stress and cellular injury. Moreover, it induces the development of cytokines, such as IL-18 and IL-1β. This leads to the activation of cell pyroptosis, which exacerbates stomach damage.31

The present study was in alliance with the findings, as the disease control group significantly increased (P < 0.001) the NLRP3, MyD88, caspase-1, ASC, and gasdermin D gene expression, as well as the IL-1β score in addition to the IL-18 level. Nevertheless, pretreated groups III, IV, and V unveiled a discernible diminution in the expression of caspase-1, NLRP3, MyD88, ASC, and gasdermin D. This was supplemented by a substantial decrease (p < 0.001) in the level of IL-18 in addition to dampening of the IL-1β score. Considering existing research, this work was the first to reveal the link between OC and NLRP3-mediated pyroptosis metrics, such as IL-18, IL-1β, gasdermin D, and caspase-1. Further, it has been demonstrated that NSAIDs cause neutrophil infiltration via activating the signaling pathway of TLR4, a pattern recognition receptor (PRR), which in turn causes inflammatory reactions in the small intestine.3 Herein, IND caused an increase in TLR4 gene expression, as shown in Figure 8. Oxidative stress triggers TLR4 activation, which releases HMGB-1 (high mobility group box 1), a proinflammatory mediator. By attaching to the TLR4 receptor, this mediator can trigger the release of more inflammatory cytokines by increasing the expression of TNF-α and NF-κB, which in turn activates NLRP3. According to current findings, pretreatment with OC (200 mg/kg dose) reduced TLR4 expression, improving it to values that were almost normal. It has been demonstrated that OC offers gastroprotection by modulating the TLR4 receptor. These findings are consistent with past research linking fucoidan to the reduction of metabolic inflammation via disrupting the TLR4/NF-κB/NLRP3 pathway.31

Moreover, OC has significantly (p < 0.001) reduced the levels of TNF-α as compared to the control group. NSAIDs have been linked to damage brought on by neutrophil adherence to the endothelium of the gastric microcirculation. The mucosa is harmed by neutrophil adhesion because it obstructs capillary blood flow, releases proteases, and produces oxygen-free radicals. The ensuing increase of adhesion molecules by these inflammatory mediators promotes neutrophil adherence, which exacerbates inflammation.32

Furthermore, it has been demonstrated that NSAID-induced COX inhibition switches the arachidonic acid metabolism to the 5-LOX pathway, which ascends leukotriene levels, thus subsidizing to the negative effects of COX inhibitors.33 Augmented LTB4 concentrations exacerbate gastric mucosal damage by inducing neutrophil infiltration, chemotaxis, adhesion, and degranulation.3435 In addition to moderate inhibition of the COX enzyme, pretreatment with OC has significantly reduced 5-LOX with a maximum effect observed at the highest dose.

Surprisingly, elevated concentrations of ROS, including superoxide anions, hydroxyl radicals, and hydrogen peroxide, constitute the cause of gastric ulcers. Cytosolic ROS has been shown to function as a shared signal for the NLRP3-mediated activation of inflammatory bodies. ROS have also been demonstrated to act as second messengers, inducing a variety of redox-sensitive signal transduction cascades, including NFκB, and affecting the expression of multiple proinflammatory genes, which in turn causes inflammatory damage to cells and tissues. Reactive oxygen species (ROS) at high concentrations have the potential to kill cells through oxidative damage. These (ROS) gradually cause oxidative stress in the stomach tissue, which is fundamental to the development of ulcers and gastric hemorrhage. By protecting against the deleterious effects of reactive oxygen species (ROS), intracellular antioxidant enzymes such as catalase (CAT) can lessen the unfavorable consequences of ROS. GSH, on the other hand, prevents tissue damage by neutralizing ROS. Furthermore, oxidative stress has the potential to increase lipid peroxidation, and in turn, its product MDA, which is commonly used as a marker for lipid peroxidation, may also increase. The present study has revealed that IND-induced oxidative stress is characterized by a marked increase in lipid peroxidation, as evidenced by elevated MDA concentration, and a decrease in endogenous antioxidants, including SOD, GSH content, and CAT activity, in the stomach tissue. These results were in line with past studies that showed the role of IND in the production of ROS and associated gastric mucosal apoptosis. OC pretreatment has been shown to be helpful in lowering the detrimental effects of ROS-mediated pathways in a dose-related way. These outcomes are in line with past studies that demonstrated (tetramethylpyrazine) TMP’s capacity to increase antioxidant enzyme activity and directly scavenge free radicals in order to indirectly reduce oxidative stress.36 It is important to highlight that OC has a strong antioxidant activity in vitro. Its ability to effectively scavenge hypochlorous acid at acidic pH values that are comparable to intragastric clinical circumstances may be the reason for this. Furthermore, it is possible that OC considerably reduces the production of stress-induced hydroxyl radicals, protecting stomach tissue from oxidative damage.

Clear ulcer damage was shown by histopathological analysis of the stomach tissue in the ulcer model. When 200 mg/kg of OC was administered as a treatment, the results demonstrated a significant (p < 0.001) reduction in the pathological degenerative cellular changes in the mucosal and submucosal tissues. A multitude of inflammatory mediators are thought to contribute to the pathophysiology of stomach ulcers caused by IND by inducing neutrophil infiltration. Notably, elevated levels of inflammatory mediators (IL-1b, IL-18) are known to cause disruption of the stomach endothelium. The results demonstrated that administering OC considerably reduced the damage to the stomach mucosa. Comparable results to earlier research demonstrating a noteworthy decrease in cellular deterioration of rat stomach tissue by a monoterpene known as p-cymene have also been documented.37 Recent histology data showed that the mucosa of treated rats was generally healthy, which shed light on the gastroprotective properties of OC.

4. Conclusions

The NLRP3 inflammasome is a key component of the innate immune system and is crucial to understand the pathophysiology of different forms of central and peripheral neuropathic pain, as well as chronic inflammatory syndromes. Therefore, targeting the NLRP3 inflammasome may be a useful strategy to address the significant unmet medical need for a new class of safe, well-tolerated, and extremely effective analgesic medicines for the treatment of neuropathic pain and chronic inflammatory pain. This study was the first to demonstrate the impact of OC on the expression of the inflammasome NLRP3 and the associated pyroptosis indicators in the tissue of gastric ulcers. In the current investigation, OC’s anti-inflammatory and antioxidant activity demonstrated its dose-dependent analgesic, anti-inflammatory, and gastroprotective safety profile. OC also mitigates the aggression of gastric ulceration by alleviating inflammasome-mediated pyroptosis by inhibiting the TLR4/NLRP3/GSDMD pathway.

5. Materials and Methods

5.1. Ocimene and Animals Employed

Ocimene was purchase from Sigma-Aldrich and all of the properties of the compound are mentioned in Table 1.

Table 1. Properties of Ocimene.

5.1.

Open in a new tab

Animal handling procedures were authorized by the Animal Ethics Committee of the University of Sargodha (Ethical Approval #SU/ORIC/2082). Male and female Sprague–Dawley rats were obtained from the Animal House of the College of Pharmacy, University of Sargodha. The animals were acclimated for 1 week under controlled air-conditioned conditions (22 ± 2 °C) with a 12 h light/dark cycle. Throughout the acclimation and study periods, the rats had free access to food and water ad libitum. Animals (n = 6) were grouped randomly according to the following scheme:

Group 1: Disease control (receiving Tween 80 (2%));

Group 2: Normal control (receiving Tween 80 (2%));

Groups 3–5: Treatment groups (provided with 50, 100, and 200 mg/kg of OC); and

Group 6: Standard group (provided with omeprazole (OMP 20 mg/kg) or piroxicam (PXM 10 mg/kg)).

5.2. Antihyperalgesic Activity Evaluation

5.2.1. Formalin Assay

The assessment of OC’s antinociceptive potential was conducted using a method outlined in previous studies, with slight modifications, and involved the administration of 2% formalin solution (20 μL). The rats were injected with formalin solution subcutaneously in the subplantar area of their right hind paw of all rats 60 min following the oral treatments except to group 2. The number of flinches, i.e., lifting or licking in a certain amount of time, was used to analyze the degree of pain severity. The biphasic animals’ response as Phase I (neurogenic pain; 0–5 min) and Phase II (inflammatory pain; 15–30 min) following treatment was determined.38 The number of flinching observed was converted to Maximum Possible Effect (% MPE) as follows39

5.2.1.

5.2.2. Abdominal Writhing Assay

Abdominal writhings were induced using a 25-gauge injection needle by ip injection of 0.9% acetic acid (10 mL/kg). Group 2 was given Tween 80 (2% v/v). OC was administered to groups 3, 4, and 5 at doses of 50, 100, and 200 mg/kg, respectively. Group 6 was given the usual dose of PXM (10 mg/kg) orally, and Group 1 was only given acetic acid. The latent phase, or the start of the first abdominal writhe upon injection, was noted 5 min after acetic acid was administered. The frequencies of abdominal writhings were then recorded for 30 min.40 The percentage inhibition of writhings was calculated from the following formula41

5.2.2.

5.2.3. Tail Immersion Assay

Rats were allowed to submerge their tails (5 cm) in a 55 ± 0.5 °C water bath until they withdrew either their bodies or their tails. In order to shield the tail’s tissue from potential injury, a 15 s cutoff time was established. Reaction latencies were used to assess pain at 0, 15, 30, 45, 60, and 90 min after being injected with drug. Group I was administered tween 80 (2% v/v). OC was administered to groups II, III, and IV at doses of 50, 100, and 200 mg/kg, respectively. Group V was given the usual dosage of PXM (10 mg/kg) orally.42

5.3. Assessment of Anti-Inflammatory Activity of OC

5.3.1. Formalin-Induced Paw Edema in Rats

To induce edema in the left hind paw, all groups except Group 2 received a subplantar injection of 0.1 mL of 5% formalin, based on a previously established method. The left hind paw served as the control. Groups 3, 4, and 5 were administered OC at doses of 50, 100, and 200 mg/kg, respectively. Group 6 received 10 mg/kg of PXM orally. Anti-inflammatory efficacy was evaluated across treatment and control groups by using a plethysmometer. Paw volumes of both the left and right paws were measured initially (baseline) and then at 1, 3, 6, and 24 h postformalin injection. The edema inhibition percentage was calculated using the following formula

5.3.1.

where VL represents the average displacement volume of the left paw, and VR represents the average displacement volume of the right paw.43

5.3.2. Carrageenan-Induced Paw Edema in Rats

Rats in each group, except group 2, were stimulated with 0.1 mL of 1% freshly prepared carrageenan subcutaneously in the right hind paw. Rats given carrageenan injections had their paw volumes monitored hourly using a plethysmometer starting 1 h before injection (base values) and continuing for up to 4 h after.39 The percentage inhibition of paw edema was calculated as follows

5.3.2.

where “OC” denotes edema volume in the control group and “OT” represents edema volume in treated groups.44

5.3.3. Evaluation of In Vitro Anti-Inflammatory Activity

5.3.3.1. Inhibition of Egg Albumin Protein Denaturation

The assay mixture (total volume of 5 mL) was prepared with varying concentrations of each test sample and the reference drug (PXM) at 50–6400 μg/mL. Each mixture also included fresh hen’s egg albumin (0.2 mL) and phosphate-buffered saline (pH 6.4, 2.8 mL). An equivalent volume of the corresponding solvent served as the control. The reaction mixture was incubated for 15 min at 37 ± 2 °C and then transferred to an oven at 70 °C for 5 min. After cooling for 5 min, absorbance was measured at 660 nm using a UV–visible spectrophotometer. The percentage inhibition was calculated by comparing the absorbance of the treated samples to that of the control45

5.3.3.1.
5.3.3.2. Inhibition of Bovine Serum Albumin Protein Denaturation

To perform the assay, solutions with concentrations from 50 to 6400 μg/mL were prepared for each test sample and the standard drug. The test control solution (0.5 mL) was prepared with 0.45 mL of a 5% bovine serum albumin (BSA) solution and 0.05 mL of a solvent. For the product control (0.5 mL), 0.05 mL of the test solution and 0.45 mL of the solvent were combined. The test solution (0.5 mL) consisted of 0.45 mL of BSA and 0.05 mL of the test compound, while the standard solution (0.5 mL) included 0.45 mL of BSA and 0.05 mL of PXM. All mixtures were adjusted to pH 6.3 using 1 N HCl. Samples were incubated at 37 °C for 20 min, heated to 57 °C for 3 min, and then allowed to cool. Afterward, each sample was mixed with 2.5 mL of phosphate buffer, and absorbance was measured at 660 nm with a UV–visible spectrophotometer to calculate the inhibition percentage of protein denaturation29

5.3.3.2.
5.3.3.3. Human Red Blood Cell (HRBC) Membrane Stabilization Assay

Blood samples were collected from healthy human volunteers who had abstained from NSAIDs for 2 weeks prior to the experiment and mixed with an equal volume of sterilized Alsever’s solution. Following centrifugation at 3000 rpm, the packed cells were separated and washed with isosaline to prepare a 10% (v/v) HRBC suspension. For the test solution, 1 mL of PBS, 2 mL of hypotonic saline, 0.5 mL of test samples at various concentrations (50–6400 μg/mL), and 0.5 mL of the HRBC suspension were combined. The test control solution included 1 mL of PBS, 2 mL of solvent, and 0.5 mL of HRBC suspension. The standard solution consisted of 1 mL of PBS, 2 mL of hypotonic saline, 0.5 mL of PXM (prepared at relevant concentrations), and 0.5 mL of HRBC suspension. All test solutions were incubated at 37 °C for 30 min, after which they were centrifuged at 3000 rpm. The supernatant was collected, and the hemoglobin content was measured at 570 nm using a UV–visible spectrophotometer. The percentage stabilization of the HRBC membrane was calculated46

5.3.3.3.

5.4. Safety Profile of OC against Gastric Ulcer Damage

5.4.1. IND-Induced Gastric Ulcer Model

With regard to the aforementioned grouping, all of the animals received treatment for 7 straight days with the test compound OC 50, 100, and 200 mg/kg dose (groups III, IV, and V), respectively, and 20 mg/kg of OMP (group VI). Group 1 only received IND and group II only received tween 80. Rats were given unrestricted access to drinking water on the last day. Thirty minutes after the last treatment, all rats (except from those in the normal control group) were given an oral dosage of 100 mg/kg of IND after a 24 h fast. After 5 h, all rats were euthanized and the subsequent procedures were performed.47

5.4.1.1. Macroscopic Examination of Gastric Mucosa: Determination of Ulcer Score, Ulcer Index, and Percentage Inhibition

Gastric tissues were assessed with naked eyes, and the length of lesions was remarked by using digital vernier calliper. In order to ascertain the incidence and severity of lesions, the scores were assigned to each ulcer, i.e., 0 = No ulcer; 1 = Lesion of size ≤ 1 mm; 2 = Lesion of size 1–2 mm; 3 = Lesion of size 2–3 mm; 4 = Lesion of size 3–4 mm; and 5 = Lesion of size > 4 mm.48 The ulcer index can be measured using the following scores49

5.4.1.1.

However, US refers to the average severity score, UN refers to the average number of ulcers per animal, and UI refers to the ulcer index. Percentage inhibition of ulceration was calculated as below

5.4.1.1.
5.4.1.2. Gastric Content Volume and pH Measurement

Centrifuge tubes were used to collect all of the stomach content. To scrap any solid residue, these tubes were centrifuged for 5 min at 2500g, and the supernatant content was measured. A digital pH meter was used to determine the pH of the stomach content.50

5.4.1.3. Real-Time Quantitative Polymerase Chain Reaction (RT-PCR)

TLR4, MyD88, NFκB, NLRP3, ASC, caspase-I, IL-Ib, IL-I8, GSDMD, IL-4, IL-10, COX-1, and COX-2 were measured using the RT-PCR technique. RNA was extracted from blood samples taken from ulcerated and treated rats using the Trireagent method, and the RNA yield was determined and assessed using the NanoDrop spectrophotometer. The isolated RNA was reverse-transcribed according to the manufacturer’s instructions for cDNA synthesis using the True cDNA Synthesis kit (ZOKEYO CHINA). To normalize gene expression levels, the housekeeping gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used. The formula 2(−ΔΔCt) was used to calculate the relative expression after evaluating RNA levels using the relative Ct technique.51Table 2 shows the primer sequences for the respective genes.

Table 2. Forward and Reverse Primer Sequences with Respect to Gene Markers in RT-PCR.
marker sequence (5′ → 3′) reverse/forward Tm GC% product length (bp) gene accession number
TLR-4 GATTGCTCAGACATGGCAGT forward 58.25 50.00 137.00 NM_019178.2
CCCACTCGAGGTAGGTGTTT reverse 59.03 55.00
MYD-88 ACCGCATCGAGGAGGACTG forward 61.42 63.16 101.00 NM_198130.2
CTGTGGGACACTGCTCTCCA reverse 61.48 60.00
NF-κB CGTGAGGCTGTTTGGTTTGA forward 58.98 50 89 XM_039079521.1
TCTGCCCTCCTGACTCTACT reverse 59 55
Nlrp-3 GACCTCCAAGACCACGACTG forward 57.34 50.00 124.00 NM_001191642.1
ATCCGCAGCCAATGAACAGA reverse 55.77 45.45
ASC CAGAGCAGTTCATCGGCATCT forward 60.47 52.38 115.00 NM_012820.2
TCGGTTCCAAGCGTGTCATAG reverse 60.40 52.38
Caspase 1 CTGGTCTTGTGACTTGGAGGA forward 59.31 52.38 190.00 NM_012762.3
GGCTTCTTATTGGCATGATTCC reverse 57.75 45.45
IL-1b CACCTCTCAAGCAGAGCACAG forward 60.94 57.14 79.00 NM_031512.2
GGGTTCCATGGTGAAGTCAAC reverse 69.11 52.38
IL-18 GACTCTTGCGTCAACTTCAAGG forward 59.78 50.00 169.00 XM_032909544.1
CAGGCTGTCTTTTGTCAACGA reverse 59.06 47.62
IL-4 ACCCTGTTCTGCTTTCTC forward 54.06 50.00 168.00 NM_201270.1
GTTCTCCGTGGTGTTCCT reverse 56.48 55.56
IL-10 GCAGGACTTTAAGGGTTACTTGG forward 59.24 47.83 181.00 NM_012854.2
GGGGAGAAATCGATGACAGC reverse 58.41 55.00
Cox-1 TTCAGGGAGAAGCGTTTGC forward 58.37 52.63 424.00 NM_017043.4
CTCACAGTGCGGTCCAAC reverse 59.89 55.00
Cox-2 ACACACTCTATCACTGGCACC forward 59.72 52.38 274.00 NM_011198.5
TTCAGGGAGAAGCGTTTGC reverse 58.37 52.63
GSDMD CCAGCATGGAAGCCTTAGAG forward 58.04 55.00 114.00 NM_001400993.1
CAGAGTCGAGCACCAGACAC reverse 60.39 60.00
GAPDH TGCCACTCAGAAGACTGTGG forward 59.61 55.00 85.00 NM_017008.4
GGATGCAGGGATGATGTTCT reverse 57.35 50.00
Open in a new tab
5.4.1.4. Enzyme-Linked Immunosorbent Assays for PGE2 and 5-LOX

Serum samples were quantitatively analyzed using an ELISA plate reader (BioRad), following the manufacturer’s instructions. This assay quantified the amounts of prostaglandin E2 (Rat Prostaglandin E2; Catalogue Number CSB-E13830r) and 5-lipoxygenase (arachidonate 5-lipoxygenase (Alox5); Catalogue Number CSB-E16982r) using ELISA Kits, CUSABIO. To summarize, standard and serum samples were introduced to 96-well microtiter plate antibody-coated wells, and any serum samples present were bound by the immobilized antibody. Following the removal of any unbound components, the test-sample-specific biotin-conjugated antibody was applied to the wells. Following washing, the wells were treated with horseradish peroxidase (HRP) and avidin. Following a wash, a substrate solution was added to the wells to eliminate any unbound avidin-enzyme reagent, and the color develops proportionally to the amount of test samples bound in the first step. The color development was halted, and the color intensity was determined.

5.4.1.5. Estimation of Antioxidant Biomarkers

Blood was obtained via cardiac puncture, and the serum was centrifuged for 5 min at 4000 rpm before being analyzed for antioxidant biomarkers such as MDA, CAT, GSH, and SOD using conventional protocols.

Acknowledgments

This research is funded by the Deanship of Graduate Studies and Scientific research at Jouf University through the Fast-Track Research Funding Program.

The authors declare no competing financial interest.

References

  1. Jacob P J.; Manju S. Identification and development of thiazole leads as COX-2/5-LOX inhibitors through in-vitro and in-vivo biological evaluation for anti-inflammatory activity. Bioorg. Chem. 2020, 100, 103882 10.1016/j.bioorg.2020.103882. [DOI] [PubMed] [Google Scholar]
  2. Simon L. S.; Taylor P. C.; Choy E. H.; Sebba A.; Quebe A.; Knopp K. L.; Porreca F. The Jak/STAT pathway: A focus on pain in rheumatoid arthritis. Semin. Arthritis Rheum. 2021, 100, 278–284. 10.1016/j.semarthrit.2020.10.008. [DOI] [PubMed] [Google Scholar]
  3. Higashimori A.; Watanabe T.; Nadatani Y.; Takeda S.; Otani K.; Tanigawa T.; Yamagami H.; Shiba M.; Tominaga K.; Fujiwara Y.; Arakawa T. Mechanisms of NLRP3 inflammasome activation and its role in NSAID-induced enteropathy. Mucosal Immunol. 2016, 9 (3), 659–668. 10.1038/mi.2015.89. [DOI] [PubMed] [Google Scholar]
  4. Ruiz-Hurtado P. A.; Garduño-Siciliano L.; Domínguez-Verano P.; Balderas-Cordero D.; Gorgua-Jiménez G.; Canales-Álvarez O.; Canales-Martínez M. M.; Rodríguez-Monroy M. A. Propolis and its gastroprotective effects on nsaid-induced gastric ulcer disease: A systematic review. Nutrients 2021, 13 (9), 3169 10.3390/nu13093169. [DOI] [PMC free article] [PubMed] [Google Scholar]
  5. Ju Z.; Li M.; Xu J.; Howell D. C.; Li Z.; Chen F.-E. Recent development on COX-2 inhibitors as promising anti-inflammatory agents: The past 10 years. Acta Pharm. Sin. B 2022, 12 (6), 2790–2807. 10.1016/j.apsb.2022.01.002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Olaoye I. F.; Oso B. J.; Aberuagba A. Molecular mechanisms of anti-inflammatory activities of the extracts of Ocimum gratissimum and Thymus vulgaris. Avicenna J. Med. Biotechnol. 2021, 13 (4), 207. [PMC free article] [PubMed] [Google Scholar]
  7. Yang J.; Lee S.-Y.; Jang S.-K.; Kim K.-J.; Park M.-J. Anti-Inflammatory Effects of Essential Oils from the Peels of Citrus Cultivars. Pharmaceutics 2023, 15 (6), 1595 10.3390/pharmaceutics15061595. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. de Souza Stefnia P.; Valverde S. S.; Costa N. F.; Calheiros A. S.; Lima K. S.; Frutuoso V. S.; Lima A. L. Chemical composition and antinociceptive activity of the essential oil of Piper mollicomum and Piper rivinoides. J. Med. Plants Res. 2014, 8, 788–793. 10.5897/JMPR2013.4425. [DOI] [Google Scholar]
  9. Rana L.; Tewari G.; Pande C.; Prakash O.; Bisht M.; Bhatt S.; Kanyal B.; Rana K. Identification of the Aroma Compounds of Ocimum americanum as a Function of Growth Stages and their In Vitro Antioxidant and Anti-inflammatory Potential. J. Essent. Oil Bear. Plants 2022, 25 (2), 403–418. 10.1080/0972060X.2022.2069479. [DOI] [Google Scholar]
  10. Danisman B.; Cicek B.; Yildirim S.; Bolat I.; Kantar D.; Golokhvast K. S.; Nikitovic D.; Tsatsakis A.; Taghizadehghalehjoughi A. Carnosic Acid Ameliorates Indomethacin-Induced Gastric Ulceration in Rats by Alleviating Oxidative Stress and Inflammation. Biomedicines 2023, 11 (3), 829 10.3390/biomedicines11030829. [DOI] [PMC free article] [PubMed] [Google Scholar]
  11. Chen C.; Smith M. T. The NLRP3 inflammasome: role in the pathobiology of chronic pain. Inflammopharmacology 2023, 31, 1589–1603. 10.1007/s10787-023-01235-8. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Ahn J.-H.; Park Y.-L.; Song A.-Y.; Kim W.-G.; Je C.-Y.; Jung D.-H.; Kim Y.-J.; Oh J.; Cho J.-Y.; Kim D.-J.; Park J. H. Water extract of Artemisia scoparia Waldst. & Kitam suppresses LPS-induced cytokine production and NLRP3 inflammasome activation in macrophages and alleviates carrageenan-induced acute inflammation in mice. J. Ethnopharmacol. 2021, 268, 113606 10.1016/j.jep.2020.113606. [DOI] [PubMed] [Google Scholar]
  13. Daniels M. J. D.; Rivers-Auty J.; Schilling T.; Spencer N. G.; Watremez W.; Fasolino V.; Booth S. J.; White C. S.; Baldwin A. G.; Freeman S.; et al. Fenamate NSAIDs inhibit the NLRP3 inflammasome and protect against Alzheimer’s disease in rodent models. Nat. Commun. 2016, 7 (1), 12504 10.1038/ncomms12504. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Sousa L. F. B.; Oliveira H. B. M.; das Neves Selis N.; Morbeck L. L. B.; Santos T. C.; da Silva L. S. C.; Viana J. C. S.; Reis M. M.; Sampaio B. A.; Campos G. B.; et al. β-caryophyllene and docosahexaenoic acid, isolated or associated, have potential antinociceptive and anti-inflammatory effects in vitro and in vivo. Sci. Rep. 2022, 12 (1), 19199 10.1038/s41598-022-23842-1. [DOI] [PMC free article] [PubMed] [Google Scholar]
  15. de la Puente B.; Zamanillo D.; Romero L.; Vela J. M.; Merlos M.; Portillo-Salido E. Pharmacological sensitivity of reflexive and nonreflexive outcomes as a correlate of the sensory and affective responses to visceral pain in mice. Sci. Rep. 2017, 7 (1), 13428 10.1038/s41598-017-13987-9. [DOI] [PMC free article] [PubMed] [Google Scholar]
  16. Hassanpour S.; Rezaei H.; Razavi S. M. Anti-nociceptive and antioxidant activity of betaine on formalin-and writhing tests induced pain in mice. Behav. Brain Res. 2020, 390, 112699 10.1016/j.bbr.2020.112699. [DOI] [PubMed] [Google Scholar]
  17. Sheikholeslami M. A.; Ghafghazi S.; Parvardeh S.; Koohsari S.; Aghajani S. H.; Pouriran R.; Vaezi L. A. Analgesic effects of cuminic alcohol (4-isopropylbenzyl alcohol), a monocyclic terpenoid, in animal models of nociceptive and neuropathic pain: Role of opioid receptors, L-arginine/NO/cGMP pathway, and inflammatory cytokines. Eur. J. Pharmacol. 2021, 900, 174075 10.1016/j.ejphar.2021.174075. [DOI] [PubMed] [Google Scholar]
  18. Saldanha A. A.; Vieira L.; de Azambuja Ribeiro R. I. M.; Thomé R. G.; Dos Santos H. B.; Silva D. B.; Carollo C. A.; de Oliveira F. M.; de Oliveira Lopes D.; de Siqueira J. M.; Soares A. C. Chemical composition and evaluation of the anti-inflammatory and antinociceptive activities of Duguetia furfuracea essential oil: Effect on edema, leukocyte recruitment, tumor necrosis factor alpha production, iNOS expression, and adenosinergic and opioidergic systems. J. Ethnopharmacol. 2019, 231, 325–336. 10.1016/j.jep.2018.11.017. [DOI] [PubMed] [Google Scholar]
  19. Costa A. O. C.; Rego R.; Andrade H.; Costa T.; Salvadori M.; Almeida R.; Castro R. Evaluation of the antinociceptive effect generated by citronellal monoterpene isomers. Braz. J. Biol. 2023, 83, e271781 10.1590/1519-6984.271781. [DOI] [PubMed] [Google Scholar]
  20. Basit A.; Shutian T.; Khan A.; Khan S. M.; Shahzad R.; Khan A.; Khan S.; Khan M. Anti-inflammatory and analgesic potential of leaf extract of Justicia adhatoda L.(Acanthaceae) in Carrageenan and Formalin-induced models by targeting oxidative stress. Biomed. Pharmacother. 2022, 153, 113322 10.1016/j.biopha.2022.113322. [DOI] [PubMed] [Google Scholar]
  21. Menezes I. O.; da Silva L. Y. S.; Pessoa R. T.; Ramos A. G. B.; da Cunha F. A. B.; Ribeiro-Filho J.; Martins A. O. B. P. B.; Coutinho H. D. M.; de Menezes I. R. A. Terpinolene inhibits acute responses triggered by different inflammatory agents in vivo models of mouse. Food Biosci. 2023, 53, 102621 10.1016/j.fbio.2023.102621. [DOI] [Google Scholar]
  22. Nguemnang S. F. D.; Tsafack E. G.; Mbiantcha M.; Gilbert A.; Atsamo A. D.; Nana W. Y.; Mba V. M. M.; Adjouzem C. F.. In vitro anti-inflammatory and in vivo antiarthritic activities of aqueous and ethanolic extracts of Dissotis thollonii Cogn.(Melastomataceae) in rats Evidence-Based Complementary Altern. Med. 2019, 2019, 10.1155/2019/3612481. [DOI] [PMC free article] [PubMed]
  23. Saleem A.; Saleem M.; Akhtar M. F.; Sharif A.; Javaid Z.; Sohail K. In vitro and in vivo anti-arthritic evaluation of Polystichum braunii to validate its folkloric claim. Pak. J. Pharm. Sci. 2019, 32. [PubMed] [Google Scholar]
  24. Bharathy M. S.; Jeyaleela G. D.; Vimala J. D. R.; Agila A.; Sheela S. A. M. Comparison of anti-inflammatory activities of biogenic gymnema sylvestre-and panicum sumatrense-mediated titanium dioxide nanoparticles. Biomed. Biotechnol. Res. J. (BBRJ) 2021, 5 (4), 405–411. 10.4103/bbrj.bbrj_164_21. [DOI] [Google Scholar]
  25. Kherbache A.; Senator A.; Laouicha S.; Al-Zoubi R. M.; Bouriche H. Phytochemical analysis, antioxidant and anti-inflammatory activities of Helichrysum stoechas (L.) Moench extracts. Biocatal. Agric. Biotechnol. 2020, 29, 101826 10.1016/j.bcab.2020.101826. [DOI] [Google Scholar]
  26. Daram P.; Jitta S. R.; Shreedhara C.; Misra C. S.; Gourishetti K.; Lobo R. Investigation of anti-inflammatory and anti-arthritic potentials of Terminalia catappa bark using in vitro assays and carrageenan-induced inflammation, complete Freund’s adjuvant induced arthritis model in rats. S. Afr. J. Bot. 2021, 141, 313–321. 10.1016/j.sajb.2021.05.010. [DOI] [Google Scholar]
  27. Abbas M. W.; Hussain M.; Qamar M.; Ali S.; Shafiq Z.; Wilairatana P.; Mubarak M. S. Antioxidant and anti-inflammatory effects of Peganum harmala extracts: An in vitro and in vivo study. Molecules 2021, 26 (19), 6084 10.3390/molecules26196084. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Hmidani A.; Bourkhis B.; Khouya T.; Ramchoun M.; Filali-Zegzouti Y.; Alem C. Phenolic profile and anti-inflammatory activity of four Moroccan date (Phoenix dactylifera L.) seed varieties. Heliyon 2020, 6 (2), e03436 10.1016/j.heliyon.2020.e03436. [DOI] [PMC free article] [PubMed] [Google Scholar]
  29. Aslam S.; Younis W.; Malik M. N. H.; Jahan S.; Alamgeer; Uttra A. M.; Munir M. U.; Roman M. Pharmacological evaluation of anti-arthritic potential of terpinen-4-ol using in vitro and in vivo assays. Inflammopharmacology 2022, 30 (3), 945–959. 10.1007/s10787-022-00960-w. [DOI] [PubMed] [Google Scholar]
  30. Huang Y.; Xu W.; Zhou R. NLRP3 inflammasome activation and cell death. Cell. Mol. Immunol. 2021, 18 (9), 2114–2127. 10.1038/s41423-021-00740-6. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Selim H. M.; Negm W. A.; Hawwal M. F.; Hussein I. A.; Elekhnawy E.; Ulber R.; Zayed A. Fucoidan mitigates gastric ulcer injury through managing inflammation, oxidative stress, and NLRP3-mediated pyroptosis. Int. Immunopharmacol. 2023, 120, 110335 10.1016/j.intimp.2023.110335. [DOI] [PubMed] [Google Scholar]
  32. Werawatganon D.; Rakananurak N.; Sallapant S.; Prueksapanich P.; Somanawat K.; Klaikeaw N.; Rerknimitr R. Aloe vera attenuated gastric injury on indomethacin-induced gastropathy in rats. World J. Gastroenterol.: WJG 2014, 20 (48), 18330 10.3748/wjg.v20.i48.18330. [DOI] [PMC free article] [PubMed] [Google Scholar]
  33. Mahesh G.; Kumar K. A.; Reddanna P. Overview on the discovery and development of anti-inflammatory drugs: should the focus be on synthesis or degradation of PGE2?. J. Inflammation Res. 2021, 14, 253–263. 10.2147/JIR.S278514. [DOI] [PMC free article] [PubMed] [Google Scholar]
  34. Mashayekhi-Sardoo H.; Razavi B. M.; Ekhtiari M.; Kheradmand N.; Imenshahidi M. Gastroprotective effects of both aqueous and ethanolic extracts of Lemon verbena leaves against indomethacin-induced gastric ulcer in rats. Iran. J. Basic Med. Sci. 2020, 23 (12), 1639. [DOI] [PMC free article] [PubMed] [Google Scholar]
  35. Liu R.; Zhu N.; Hao Y.; Liu X.; Kang J.; Mao R.; Yu X.; Li Y. The Protective Effect of Walnut Oligopeptides against Indomethacin-Induced Gastric Ulcer in Rats. Nutrients 2023, 15 (7), 1675 10.3390/nu15071675. [DOI] [PMC free article] [PubMed] [Google Scholar]
  36. AlKreathy H. M.; Alghamdi M. K.; Esmat A. Tetramethylpyrazine ameliorates indomethacin-induced gastric ulcer in rats: Impact on oxidative, inflammatory, and angiogenic machineries. Saudi Pharm. J. 2020, 28 (8), 916–926. 10.1016/j.jsps.2020.06.012. [DOI] [PMC free article] [PubMed] [Google Scholar]
  37. Shareef S. H.; Al-Medhtiy M. H.; Ibrahim I. A. A.; Alzahrani A. R.; Jabbar A. A.; Galali Y.; Agha N. F. S.; Aziz P. Y.; Thabit M. A.; Agha D. N.; et al. Gastroprophylactic effects of p-cymene in ethanol-induced gastric ulcer in rats. Processes 2022, 10 (7), 1314 10.3390/pr10071314. [DOI] [Google Scholar]
  38. Noriega V.; Miranda H. F.; Prieto J. C.; Sotomayor-Zárate R.; Sierralta F. Involvement of NO in antinociception of NSAIDS in murine formalin hind paw assay. Drug Res. 2020, 70 (04), 145–150. 10.1055/a-1095-5418. [DOI] [PubMed] [Google Scholar]
  39. Avoseh O. N.; Mtunzi F. M.; Ogunwande I. A.; Ascrizzi R.; Guido F. Albizia lebbeck and Albizia zygia volatile oils exhibit anti-nociceptive and anti-inflammatory properties in pain models. J. Ethnopharmacol. 2021, 268, 113676 10.1016/j.jep.2020.113676. [DOI] [PubMed] [Google Scholar]
  40. Lu Y.-F.; Ren B.; Ling B.-F.; Zhang J.; Xu C.; Li Z. Social interaction with a cagemate in pain increases allogrooming and induces pain hypersensitivity in the observer rats. Neurosci. Lett. 2018, 662, 385–388. 10.1016/j.neulet.2017.10.063. [DOI] [PubMed] [Google Scholar]
  41. Yimer T.; Birru E. M.; Adugna M.; Geta M.; Emiru Y. K. Evaluation of analgesic and anti-inflammatory activities of 80% methanol root extract of Echinops kebericho M.(Asteraceae). J. Inflammation Res. 2020, 13, 647–658. 10.2147/JIR.S267154. [DOI] [PMC free article] [PubMed] [Google Scholar]
  42. Khalilzadeh E.; Saiah G. V.; Hasannejad H.; Ghaderi A.; Ghaderi S.; Hamidian G.; Mahmoudi R.; Eshgi D.; Zangisheh M. Antinociceptive effects, acute toxicity and chemical composition of Vitex agnus-castus essential oil. Avicenna J. Phytomed. 2015, 5 (3), 218. [PMC free article] [PubMed] [Google Scholar]
  43. Eltom S. E. M.; Abdellatif A. A.; Maswadeh H.; Al-Omar M. S.; Abdel-Hafez A. A.; Mohammed H. A.; Agabein E. M.; Alqasoomi I.; Alrashidi S. A.; Sajid M. S.; Mobark M. A. The anti-inflammatory effect of a γ-lactone isolated from ostrich oil of Struthio camelus (Ratite) and its formulated nano-emulsion in formalin-induced paw edema. Molecules 2021, 26 (12), 3701 10.3390/molecules26123701. [DOI] [PMC free article] [PubMed] [Google Scholar]
  44. Ismail S. M.; Rao K.; Bhaskar M. Evaluation of anti-inflammatory activity of Boswellia serrata on carrageenan induced paw edema in albino Wistar rats. Int. J. Res. Med. Sci. 2016, 4 (7), 2980–2986. 10.18203/2320-6012.ijrms20161989. [DOI] [Google Scholar]
  45. Khalid M.; Alqarni M. H.; Shoaib A.; Arif M.; Foudah A. I.; Afzal O.; Ali A.; Ali A.; Alqahtani S. S.; Altamimi A. S. Anti-arthritic and anti-inflammatory potential of Spondias mangifera extract fractions: An in silico, in vitro and in vivo approach. Plants 2021, 10 (5), 825 10.3390/plants10050825. [DOI] [PMC free article] [PubMed] [Google Scholar]
  46. Farooq S.; Shaheen G.; Asif H. M.; Aslam M. R.; Zahid R.; Rajpoot S. R.; Jabbar S.; Zafar F. Preliminary phytochemical analysis: In-Vitro comparative evaluation of anti-arthritic and anti-inflammatory potential of some traditionally used medicinal plants. Dose-Response 2022, 20 (1), 15593258211069720 10.1177/15593258211069720. [DOI] [PMC free article] [PubMed] [Google Scholar]
  47. Mai Y.; Xu S.; Shen R.; Feng B.; He H.; Xu Y. Gastroprotective effects of water extract of domesticated Amauroderma rugosum against several gastric ulcer models in rats. Pharm. Biol. 2022, 60 (1), 600–608. 10.1080/13880209.2022.2047210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  48. Ragab T. I.; Shalaby A. S. G.; El Awdan S. A.; El-Bassyouni G. T.; Salama B. M.; Helmy W. A.; Esawy M. A. Role of levan extracted from bacterial honey isolates in curing peptic ulcer: In vivo. Int. J. Biol. Macromol. 2020, 142, 564–573. 10.1016/j.ijbiomac.2019.09.131. [DOI] [PubMed] [Google Scholar]
  49. Ahmed O.; Nedi T.; Yimer E. M. Evaluation of anti-gastric ulcer activity of aqueous and 80% methanol leaf extracts of Urtica simensis in rats. Metab. Open 2022, 14, 100172 10.1016/j.metop.2022.100172. [DOI] [PMC free article] [PubMed] [Google Scholar]
  50. Tamaddonfard E.; Erfanparast A.; Farshid A. A.; Imani M.; Mirzakhani N.; Salighedar R.; Tamaddonfard S. Safranal, a constituent of saffron, exerts gastro-protective effects against indomethacin-induced gastric ulcer. Life Sci. 2019, 224, 88–94. 10.1016/j.lfs.2019.03.054. [DOI] [PubMed] [Google Scholar]
  51. Iqbal U.; Malik A.; Sial N. T.; Uttra A. M.; ur Rehman M. F.; Mehmood M. H. Molecular insights of Eucalyptol (1, 8-Cineole) as an anti-arthritic agent: in vivo and in silico analysis of IL-17, IL-10, NF-κB, 5-LOX and COX-2. Inflammopharmacology 2024, 32, 1941–1959. 10.1007/s10787-024-01465-4. [DOI] [PubMed] [Google Scholar]

Articles from ACS Pharmacology & Translational Science are provided here courtesy of American Chemical Society

RESOURCES