MicroRNA‐21 is upregulated during intestinal barrier dysfunction induced by ischemia reperfusion

Abstract

This study aimed to investigate the expression of miRNA‐21 during intestinal barrier dysfunction induced by intestinal ischemia reperfusion. Forty SPF SD rats were divided into 5 groups randomly. Intestinal ischemia‐reperfusion injury (IRI) was induced by mesenteric artery occlusion for 1 h and reperfusion for 1 h, and the rats were sacrificed at 1, 3, 6 and 12 h after reperfusion. Fresh intestine tissues were immediately isolated for the measurement of transepithelial electrical resistance (TER). The levels of cytokines, ICAM‐1, DAO, iFABP and MPO in serum were determined by ELISA. Intestinal tight junction proteins occludin and claudin‐1 were detected by immunofluorescence analysis and Western blot analysis. miR‐21 expression in intestinal tissues was measured by RT‐PCR. Compared with sham group, the levels of pro‐inflammatory cytokines TNF‐α and IL‐6 and ICAM‐1, DAO, iFABP and MPO increased while IL‐10 level decreased in intestinal ischemia‐reperfusion group. In addition, the levels of intestinal tight junction proteins occludin and claudin‐1 decreased while miR‐21 level increased in intestinal ischemia‐reperfusion group, compared with sham group. In conclusion, miR‐21 expression is upregulated during intestinal barrier dysfunction induced by IRI. miR‐21 may play an important role in the regulation of intestinal barrier function.

Introduction

Intestinal ischemia‐reperfusion injury (IRI) frequently occurs during abdominal surgery, small bowel transplantation and hemorrhagic shock [1]. IRI is associated with oxidative stress with subsequent inflammatory injury that can lead to systemic inflammatory response syndrome (SIRS) and even life‐threatening multiple organ dysfunction (MODS), thus IRI has high morbidity and mortality [[2], [3]]. The gut contains a large number of endotoxins and pathogens, but healthy intestinal barrier can effectively prevent endotoxin and intestinal bacteria from entering into the body. Intestinal mucosal barrier is composed of chemical barrier, mechanical barrier, immune barrier and biological barrier, and mechanical barrier is based on a complete connection between intestinal epithelial cells and forms the foundation of intestinal mucosal barrier. The injury of mucosal barrier is the most critical aspect of IRI. IRI causes damage to intestinal barrier function and systemic inflammatory response [[4], [5]].

It has been widely recognized that a variety of factors such as ischemia‐induced intestinal epithelial damage and apoptosis, increased permeability of epithelial cells, endotoxin and intestinal bacterial translocation are the main cause of IRI. In addition, intestinal infection induced by intestinal barrier dysfunction is a major cause of multiple organ failure and patients death. Therefore, further understanding of molecular mechanisms of IRI is necessary to develop therapeutic approach for IRI.

MicroRNAs are a class of about 22 nt long non‐protein‐coding single‐stranded small RNA nucleotides involved in post‐transcriptional regulation of gene expression and play an important role in apoptosis, cell proliferation and differentiation, metabolism and other processes [6]. Recent studies suggest the role of miRNAs in regulating intestinal tight junction permeability [7]. In particular, miR‐21 was shown to be upregulated in the patients with ulcerative colitis and overexpression of miR‐21 caused intestinal epithelial barrier impairment [8]. However, the role of miR‐21 in IRI remains unclear. Therefore, this study aimed to investigate the expression change of miR‐21 during IRI. We established IRI animal model in vivo and detected the expression of miR‐21 and intestinal epithelial tight junction proteins in intestinal tissues.

Materials and methods

Animals

Adult male SD rats (weight 180–220 g, about 8 weeks old) were purchased from the Experimental Animal Center of Fudan University (Shanghai, China). The experiment protocol was approved by the Ethic Committee of Animal Care. The rats were maintained in cages at room temperature with 12 h light/dark cycle with free access to the food and water. The rats were anesthetized with ketamine and received midline laparotomy, then the intestine was externalized, and IRI was induced by clamping of superior mesenteric artery with microvascular clamps for 1 h (ischemia) followed by reperfusion for 1 h. Forty SPF SD rats were divided into 5 groups randomly (n = 8). In Sham (sh) group, superior mesenteric artery was exposed but not clamped, In IRI1h, IRI3h, IRI6h and IRI12h groups, the rats were sacrificed at 1, 3, 6 and 12 h after reperfusion, respectively.

Histological examination

After IRI, rats were sacrificed by cervical dislocation and intestine tissue samples were immediately obtained and fixed in 4% formalin and embedded in paraffin, then 5 μm‐thick sections were stained with hematoxylin and eosin and examined under light microscope by a blinded pathologist. The Chiu scale [9] of mucosal injury was used to evaluate the degree of histological alteration on 10 sections of 1 mm each to complete 1 cm per animal and then averaged. The scale consists of values from 0 to 5, where 0 normal mucosa; 1, development of sub epithelial (Gruenhagen's) spaces; 2, extension of the sub epithelial space with moderate epithelial lifting from the lamina propria; 3, extensive epithelial lifting with occasional denuded villi tips; 4, denuded villi with exposed lamina propria and dilated capillaries; and 5, disintegration of the lamina propria, hemorrhage, and ulceration.

Electron microscopy

Intestine tissue samples were fixed in lanthanum aldehyde solution (Sigma, St Louis, MO, USA) overnight at 4 °C and then stained by uranium acetate following routine protocols of electron microscopy samples preparation. The stained samples were observed under transmission electron microscope (JEOL Ltd., Tokyo, Japan).

Ussing chamber assay

Transepithelial electrical resistance (TER) of intestine tissues was measured by Ussing chamber assay as described previously [10]. Briefly, Ileal mucosa was stripped and kept in 5 ml Krebs solution oxygenated with 95% O₂–5% CO₂ and circulated in water‐jacketed reservoirs at 37 °C. The spontaneous potential difference (PD) was measured using Ringer‐agar bridges connected to the electrodes, and the PD was short‐circuited to measure short‐circuit current ΔIsc. TER (Ω cm²) = PD/ΔIsc.

TUNEL assay

Apoptosis of intestinal epithelial cells was detected by TUNEL assay. Intestine tissue samples were fixed in 4% paraformaldehyde, embedded and cut into 5 μm sections. The sections were then stained with TUNEL kit (Roche Diagnostics, Mannheim, Germany) according to the manufacturer's protocols. Each section was observed under a light microscope and the cells in 4 randomly selected fields were counted. Apoptotic index was calculated as: Apoptotic cell number/total cell number.

Real‐time PCR

Total RNA was extracted from intestine tissues using Trizol (Invitrogen, Carlsbad, CA, USA) and reverse transcription was performed using M‐MLV Reverse Transcriptase kit (Invitrogen, Carlsbad, CA, USA) according to the manufacturer's instruction. Real‐time PCR was performed using SYBR Green PCR Kit (Qiagen, Germany). The primer sequences were as follows: hsa‐miR‐21‐5p 5′ ACACTCCAGCTGGGTAGCTTATCAGACTGAT 3′ and 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGTCAACA 3'; hsa‐miR‐21‐3p 5′ ACACTCCAGCTGGGCAACACCAGTCGATGG 3′ and 5′ CTCAACTGGTGTCGTGGAGTCGGCAATTCAGTTGAGACAGCC 3'; U6 5′ CTCGCTTCGGCAGCACA 3′ and 5′ AACGCTTCACGAATTTGCGT 3'. The relative expression was calculated by the 2^−ΔΔCT method and normalized to the expression of U6 small nuclear RNA.

Western blot analysis

Intestine tissues were lysed in lysis buffer, the lysate was centrifuged and the protein concentration was determined using BCA kit (Bio‐Rad Laboratories, Hercules, CA, USA). Equal amounts of proteins were separated by electrophoresis on SDS‐PAGE gel and then transferred onto polyvinylidene difluoride membrane. After blocking, the blots were incubated with antibodies for occludin, claudin‐1 and β‐actin (all from Santa Cruz Biotech, Santa Cruz, CA, USA). Next, the blots were incubated with horseradish peroxidase conjugated secondary antibodies (Santa Cruz Biotech, Santa Cruz, CA, USA). The protein bands were detected using SuperSignal Ultra Chemiluminescent Substrate (Pierce, IL, USA) and exposed to X‐ray films.

Immunofluorescence assay

Intestine tissues were fixed in 4% paraformaldehyde and blocked with 5% bovine serum albumin for 30 min, then treated with antibody for occludin or claudin‐1 (Santa Cruz Biotech, CA, USA) overnight. FITC‐labeled IgG (Sigma, St. Louis, MO, USA) was used as the secondary antibody. Sections were then stained with 4′,6‐diamidino‐2‐phenylindole (Sigma, St. Louis, MO, USA) for 1 min to visualize the nuclei. The sections were analyzed using a laser scanning confocal microscope TCS SP2 (Leica, Wetzlar, Germany).

ELISA

The serum was collected from the rats and the concentrations of interleukin‐6 (IL‐6), interleukin‐10 (IL‐10), tumor necrosis factor (TNFα), ICAM‐1, intestinal fatty acid binding protein (I‐FABP), diamine oxidase (DAO) and myeloperoxidase (MPO) were measured by ELISA kits (Biyuntian Biotech, Nanjing, China) according to the manufacturer's instructions.

Statistical analysis

Statistical analyses were performed using SPSS 18.0 software (SPSS Inc., Chicago, IL, USA). Data were presented as mean ± SD. One way‐ANOVA was used to examine the differences among multiple groups. P value of <0.05 was considered significant difference.

Results

Ultrastructural changes in intestine after IRI

Electron microscopy showed that in sham group, the microvilli of intestinal mucosal cells were dense, the intercellular junctions were closely connected and intracellular organelles showed normal morphologies. The nuclei were regular and the chromatin distribution was uniform. However, the microvilli in IRI group were sparse and showed disorder, partial lodging, shedding, and the organelles were swollen. In addition, the tight junction among epithelial cells was widened. The nuclei and heterochromatin were condensed. The mitochondria ruptured and endoplasmic reticulum showed disorder and swelling (Fig. 1A–E).

Figure 1.

Ultrastructural and pathological changes of intestinal epithelium after IRI. A–E. Ultrastructural changes observed by transmission electron microscopy. A. Sham group. High density of lanthanum granules were observed on microvilli surface, tight junction was closed and there was no granule deposition in the basement membrane. B. IRI1h group. The tight junction was closed but there was few granule deposition in the basement membrane. C. IRI3h group. The tight junction was open and there was some granule deposition in the basement membrane. D. IRI6h group. The tight junction was wide open and there was dense granule deposition in the basement membrane. E. IRI12h group. The tight junction was open and there was some granule deposition in the basement membrane. F–J. Pathological changes observed by hematoxylin and eosin staining (magnification ×400). F. Sham group. Normal morphology of intestinal epithelium. G. IRI1h group. Intestinal epithelial mucous was thin and the number of villi decreased. H. IRI3h group. Intestinal epithelial mucous was thin and the number of villi decreased. There was inflammatory cell infiltration. I. IRI6h group. Intestinal epithelial mucous was thin and the number of villi decreased. There was significant inflammatory cell infiltration. J. IRI12h group. K. Chiu score in each group. Data were expressed as mean ± SD (n = 8). *P < 0.05 compared to other groups.

Pathological changes in intestine after IRI

H&E staining showed that in sham group only few lymphocyte infiltration was observed in the lower intestinal mucosa. Intestinal mucosa was normal, the thickness was uniform, the villi was arranged, and the epithelium was intact. In IRI injury of 6 h and 12 h groups, intestinal villus epithelium and the lamina were separated, intestinal villus ruptured with bleeding and ulcers. There were inflammatory cells in lamina propria and necrosis of mucosal layer. In IRI injury of 1 h and 3 h groups, we observed intestinal villus rupture, lamina bleeding and inflammatory cell infiltration (Fig. 1F–J). Chiu score increased with the prolongation of IRI injury (Fig. 1K).

Changes in the expression of claudin‐1 and occludin after IRI

Fluorescence microscopy analysis showed that claudin‐1 was strongly expressed on the surface of intestinal villus, and the distribution was continuous and dense in sham group. However, with the prolongation of IRI, claudin‐1 expression decreased gradually (Fig. 2A). Similarly, occludin was strongly expressed on the surface of intestinal villus, and the distribution was continuous and dense in sham group. However, with the prolongation of IRI, occludin expression decreased gradually (Fig. 2B). Western blot analysis confirmed the gradually decreased expression of claudin‐1 and occludin in the groups with prolonged IRI (Fig. 2C and D).

Figure 2.

IRI reduces the expression of tight junction proteins. A. Immunofluorescence detection of claudin‐1. B. Immunofluorescence detection of occludin. A'. Sham group. B'. IRI1h group. C'. IRI3h group. D'. IRI6h group. E'. IRI12h group. Green indicated the staining of occludin and claudin‐1, and blue indicated nuclear staining. C. The expression of occludin and claudin‐1 was detected by Western blot analysis. β‐actin was loading control. D. Densitometry analysis of occludin and claudin‐1 expression. Data were expressed as mean ± SD (n = 8). *P < 0.05 compared to other groups.

IRI increases the apoptosis of intestinal epithelium and decreases TER

By TUNEL assay we found that compared to sham group, the number of apoptotic cells in intestinal mucosa increased gradually in groups with increased duration after IRI (Fig. 3A–E). Quantitative analysis showed that apoptotic index was significantly higher in IRI groups than in sham group (Fig. 3F). Consistent with increased apoptosis of intestinal epithelium, TER gradually decreased in IRI groups compared to sham group (Fig. 3G).

Figure 3.

IRI induces the apoptosis of epithelial cells and decreases TER. A–E. Apoptotic cells were stained brown by TUNEL assay. A. Sham group. B. IRI1h group. C. IRI3h group. D. IRI6h group. E. IRI12h group. F. Apoptotic index in intestine epithelium of each group. G. TER of each group. Data were expressed as mean ± SD (n = 8). *P < 0.05 compared to other groups.

Changes in the secretion of inflammatory factors and after IRI

ELISA assay showed that serum levels of TNF‐α, IL‐6 and ICAM‐1 significantly increased after IRI up to 6 h compared to sham group (p < 0.05), and then decreased at 12 h after IRI. In contrast, serum IL‐10 levels in serum significantly decreased after IRI up to 6 h compared to sham group (p < 0.05), and then increased at 12 h after IRI (Fig. 4A–D). These data indicate that IRI induced inflammation reaches the peak at 6 h after IRI.

Figure 4.

IRI induces inflammation, damages intestinal barrier and regulates miR‐21 expression. Serum was collected from each group of rats and serum concentrations of TNFα (A), IL‐6 (B), IL‐10 (C), ICAM‐1 (D), DAO (E), iFABP (F) and MPO (G) were detected by ELISA. H. miR‐21 levels in intestine tissues were detected by PCR. Data were expressed as mean ± SD (n = 8). *P < 0.05 compared to other groups.

Changes in the markers of intestinal barrier integrity after IRI

ELISA assay showed that DAO, iFABP and MPO levels in serum significantly increased after IRI up to 6 h compared to sham group (p < 0.05), and then decreased at 12 h after IRI (Fig. 4E–G). These data indicate that IRI induced damage of intestinal barrier integrity reaches the peak at 6 h after IRI.

Changes in the expression of miR‐21 after IRI

PCR analysis showed that miR‐21 levels in intestine tissues significantly increased after IRI up to 6 h compared to sham group (p < 0.05), and then decreased at 12 h after IRI (Fig. 4H). These data indicate that miR‐21 expression was correlated with the secretion of inflammatory factors and the damage of intestinal barrier integrity during IRI.

Discussion

In present study, we established rat IRI model to investigate the role of miR‐21 in the regulation of intestinal barrier function. Our results showed that miR‐21 expression was correlated with the secretion of inflammatory factors and the damage of intestinal barrier integrity during IRI, suggesting that miR‐21 plays an important role in the regulation of intestinal barrier function.

Intestinal barrier integrity is important to the homeostasis of the host. IRI is known to damage barrier function of the gut and increase intestinal permeability and susceptibility to infection [11]. In addition, gut derived toxic substances would enter mesenteric lymph and the blood to cause remote organ injury. Indeed, IRI is an important cause of systemic inflammatory response and MODS [12].

Tight junction of intestine epithelial cells is crucial to the maintenance of intestinal barrier integrity and it is a multifunctional complex consisting of many proteins including claudin and occludin [13]. In this study, fluorescence microscopy and Western blot analysis showed that claudin‐1 and occludin expression was very strong on the surface of intestinal villus of sham group, but claudin‐1 and occludin expression decreased gradually with the prolongation of duration after IRI. Notably, decreased expression of tight junction proteins was correlated with increased apoptosis of intestinal epithelium and decreased TER in IRI groups. These data indicate that IRI would damage intestinal barrier integrity and increase intestinal permeability.

To verify that IRI increased intestinal permeability, we examined serum levels of DAO and iFABP. Diamine oxidase and iFABP are important indicators of intestinal barrier integrity [14]. In normal condition, these proteins are limited to the intestine. However, upon damage to the intestine, intestinal permeability increases and these proteins are released into the blood. Therefore, increased serum levels of DAO and iFABP confirm IRI induced intestinal barrier dysfunction.

Furthermore, we detected serum levels of inflammatory factors. We found that serum levels of pro‐inflammatory cytokines TNF‐α and IL‐6 significantly increased after IRI up to 6 h, while serum levels of anti‐inflammatory factor IL‐10 levels significantly decreased after IRI up to 6 h. In addition, serum levels of ICMA‐1 and MPO, both of which are the markers of inflammation, significantly increased after IRI up to 6 h. These results demonstrate that IRI induced inflammation and the time frame of inflammation is consistent with that of intestinal barrier dysfunction.

miR‐21 has been shown to enhance cell proliferation and promote cancer invasion and metastasis [[15], [16]]. Interestingly, miR‐21 can be induced by inflammatory factors such as Interferon and IL‐6 [[17], [18]]. It was reported that miR‐21 level increased in ulcerative colitis patients compared to healthy controls [19]. Moreover, our recent in vitro study suggested that miR‐21 may regulate intestinal epithelial tight junction permeability through PTEN/PI3K/Akt pathway [20]. However, the clinical significance of miR‐21 in IRI induced intestinal barrier dysfunction has not been investigated. In this study, using rat IRI model we found that miR‐21 levels in intestine tissues was upregulated after IRI up to 6 h. These data indicate that miR‐21 expression level is correlated with the progression of inflammation and intestinal barrier dysfunction during IRI. It is likely that IRI causes inflammation, and inflammatory factors promote the upregulation of miR‐21. miR‐21 may in turn regulate the expression of proteins involved in tight junction and intestinal barrier integrity. Further studies are needed to determine whether miR‐21 upregulation is the cause or consequence of intestinal barrier dysfunction.

In conclusion, using rat IRI model we demonstrated that IRI induces intestinal barrier dysfunction and this is correlated with the progression of inflammation and the upregulation of miR‐21 expression. Therefore, miR‐21 may play an important role in the regulation of intestinal barrier function during intestinal injury.

Acknowledgements

This study was supported by a grant for the Science and Technology Commission of Shanghai Municipality (No. 11ZR1405700) and a grant for Key Clinical Discipline Construction of Shanghai Municipality (No. ZK2012B20) and Shanghai Municipal Commission of Health and Family planning (No. 20144Y0193) and Science and Technology Commission in Jinshan district (No. 2014‐3‐18).