Abstract
Matrix metalloproteinases (MMPs) play a critical role in the blood–brain barrier permeability and in invasion of the leukocytes into the central nervous system during multiple sclerosis (MS). In this respect, in the present study, we have evaluated the possible role of MMP‐9 and MMP‐2 on the expression of soluble CD154 (sCD154) and membrane‐bound isoform of the CD154 in Iranian MS patients. The expressions of the aforementioned protein‐related genes were analyzed at the levels of messenger RNA and proteins by real‐time reverse transcription polymerase chain reaction, enzyme‐linked immunosorbent assay, and Western blotting. The results showed a high expression of CD154 isoforms, MMP‐9 and MMP‐2, in MS patients in contrast to controls (p < 0.001). We found an increase in sCD154 concentration (i.e., >3‐fold) in patients with a higher MMPs/tissue inhibitor of metalloproteinase 1 (TIMP‐1) ratio. Furthermore, secondary‐progressive MS patients with exacerbate period showed higher positive correlation between increasing sCD154 concentration and overexpression of MMP‐2 (p < 0.001). Our data demonstrate that following the exacerbation period, sCD154 concentration is increased in patients, which is mutually related to the MMPs/TIMP‐1 ratio. This relationship may represent a new link between sCD154 concentration and the MMPs/TIMP‐1 ratio with prognostic implications.
Keywords: Matrix metalloproteinase‐2 and matrix metalloproteinase‐9, Multiple sclerosis, Soluble CD40 ligand, Tissue inhibitors of metalloproteinase 1
Introduction
Matrix metalloproteinases (MMPs) are essential enzymes in many aspects of human development and tissue remodeling. These enzymes play several important functional roles in the pathogenesis of neuroinflammatory disorders such as multiple sclerosis (MS) [[1], [2]]. Recent evidence suggests that MMPs are the major participants in disruption of the blood–brain barrier (BBB) in MS [[3], [4]]. Previous studies have reported a close association of rising levels of MMPs, especially MMP‐9 (gelatinase B), prior to an onset of exacerbations in humans and in the animal model of MS [[5], [6]]. The activity of MMPs was affected by factors known as tissue inhibitors of metalloproteinases (TIMPs) [7]. These inhibitors are widely expressed in the extracellular milieus, which reduce the activity of MMPs through the formation of complexes with either activated MMPs or with their preforms after their secretion [7]. Changes in the fine balance of TIMPs and their target regulate extracellular matrix turnover and may be critical in inflammatory processes.
CD154 (CD40 ligand, gp39, T–B cell activation molecules) is a glycoprotein belonging to the tumor necrosis factor ligand superfamily. Recently, two isoforms of CD154 have been identified, which includes the membrane‐bound (mCD154) form and the soluble (sCD154) form of the protein. The mCD154 is a 33‐kDa glycoprotein, which is expressed predominantly by activated leukocytes and platelets [8], whereas sCD154 is a 31‐kDa and/or 18‐kDa glycoprotein, which can be secreted or shed from activated cells [9]. Both isoforms of the CD154 protein are expressed at a low level in the resting cells of myeloid and are able to activate CD40, a 45–50‐kDa type I membrane glycoprotein from the tumor necrosis factor receptor superfamily [[10], [11]]. The CD154 is also expressed on the surface of nonimmune cells such as endothelial, epithelial, mesenchymal, platelets, and malignant tumor cells [[12], [13], [14]]. Elevated levels of sCD154 have been found in a variety of diseases in which sCD154 has been thought to initiate or potentiate inflammation [[15], [16], [17], [18], [19], [20], [21], [22]]. The CD40/CD154 interactions are likely to play a significant role in the development of autoimmune diseases by antibodies class switching and production of proinflammatory cytokines and costimulatory molecules [[23], [24], [25]]. Given the importance of these interactions, several anti‐CD154 monoclonal antibodies, which block the CD40/CD154 interactions, have been developed for therapeutic applications recently [[26], [27]].
The roles of the CD40/CD154 dyad in several autoimmune diseases have been studied by several independent groups [[12], [15], [18], [21], [24]], whereas the role of these interactions in MS remains largely unknown. In the present matched case–control study, we attempted to focus on the relation between the expression of MMP‐9, MMP‐2, and TIMP‐1 and change in the concentrations of both isoforms of CD154 in MS patients and healthy controls. In this research, for the first time, we used a wide spectrum of clinical techniques for evaluation of MMPs and CD154 isoforms balances in MS courses, and to define the predictive and prognostic value of serum sCD40L.
Materials and methods
Study population
The study, approved by the Zabol University Multiple Institutional Review Board, was conducted with all clinical samples from MS patients who were treated at the Department of Neurology in the Ali Ebne Abitaleb Hospital (Zahedan, Iran) and from healthy blood donors. The samples from volunteers were submitted for research at the Central Medical Laboratory of Zahedan from December 2009 to November 2011. The MS patients (in the southeast of Iran) who had been diagnosed with magnetic resonance imaging and McDonald criteria were recruited for the study [28]. We analyzed 110 different samples, including 55 patients [30 relapsing‐remitting MS (RRMS), 15 secondary‐progressive MS (SPMS), and 10 primary‐progressive MS (PPMS)] and 55 age‐ and gender‐matched people as the healthy control group. Both the groups comprised 20 men and 35 women (mean age: 29.4 years; age range: 16–52 years). The Expanded Disability Status Scale score for all patients at the time of inclusion was below the scale of 5.0, except for three individuals with SPMS (scale 6.5) and five with RRMS (scale 5.0). All patients had an annual relapse rate of at least 1, during 2 years prior to inclusion in the study. Samples from 11 patients with RRMS and six patients with SPMS (17 samples in total) were obtained during periods of disease exacerbation. Patients did not receive any kind of drug treatment for at least 1 week prior to sampling.
Sampling
Serum and peripheral blood mononuclear cells (PBMCs) were collected by standard methods described previously [29]. These PBMCs were then mixed with 1 mL TRIzol (Invitrogen, Carlsbad, CA, USA) and stored for RNA extraction. The aliquot samples were then stored at −80°C until further analysis. When multiple specimens were submitted for one patient, all of them were tested more than once and their mean value was used for analysis.
Enzyme‐linked immunosorbent assay
The CD154 isoforms, MMP‐9, MMP‐2, and TIMP‐1 were analyzed using a specific sandwich enzyme‐linked immunosorbent assay (ELISA) kit (R&D Systems, Minneapolis, MN, USA), according to the manufacturer's instructions. In brief, wells of the ELISA plate were first coated with antibodies that captured sCD154, MMP‐2, MMP‐9, and TIMP‐1, following which the specimens were added to the wells [30]. Biotinylated secondary antibodies and streptavidin‐labeled horseradish peroxidase (HRP) were then added to the wells. A substrate solution [1:1 mixture of Color Reagent A (H2O2) and Color Reagent B (tetramethylbenzidine or TMB)] was used for visualization. Reactions were stopped by adding 2N H2SO4. Optical density values were read at 450 nm. The presented data were the means of triplicate determinations.
Western blotting
PBMCs were homogenized in a homogenizer, and the homogenate was dissolved in a specific lysis buffer as previously described [30]. Protein extracts were quantified using the Bradford assay (Bio‐Rad Laboratories, Hercules, CA, USA). Equal amounts of total protein (20 μg) were then boiled in sodium dodecyl sulfate (SDS)‐polyacrylamide gel electrophoresis sample buffer for 10 minutes and loaded per lane and segregated by 12.5% SDS‐polyacrylamide gels at 150 V. The resolved proteins were transferred to polyvinylidene difluoride membrane using tank blotting. The membranes were washed three times in phosphate‐buffered saline (PBS) containing 0.05% (vol/vol) Tween‐20, and then blocked in 2% PBS–bovine serum albumin (wt/vol) for 2 hours. The membranes were incubated for 12 hours with primary (mouse antihuman CD154 monoclonal antibodies) and for 2 hours in secondary (rabbit antimouse immunoglobulin G, HRP conjugated) antibodies (R&D Systems) after washing five times in each step. Finally, the blots were exposed to HRP substrate solution (TMB and H2O2) for detection of target antigens. After staining, band intensities were quantified using NIH Image 1.61 software (National Institute of Health, Springfield, VA, USA).
Total RNA extraction and complementary DNA synthesis
The frozen PBMCs were taken out of the refrigerator and thawed at room temperature for 5 minutes. The total RNA was isolated from cells using TRIzol reagent (Gibco‐BRL) according to the manufacturer's protocol. Traces of genomic DNA were eliminated by treating the RNA with DNase I for 15 minutes at 37°C. The resulting RNA pellet was dissolved in diethyl pyrocarbonate‐treated water and quantitated by spectroscopy. The RNA product of 5 μL was chosen for spectrophotometer determination. Absorbance (A) values of RNA at 260 nm and 280 nm were determined, and then the ratio of A 260/A 280 was calculated. For reverse transcription polymerase chain reaction (RT‐PCR), 2 μg of total RNA was converted into complementary DNA (cDNA) using first‐strand cDNA synthesis kit (Fermentas) by strictly following the manufacturer's instructions. The productive cDNA was stored at −20°C for spare use.
Real‐time RT‐PCR
Message levels for CD154, TIMP‐1, and MMPs, as well as for β‐actin as internal control, were determined by incorporation of SYBR green (Takara Bio Inc, Otsu, Shiga, Japan) as detected by real‐time PCR (Corbett Research, Sydney, Australia). Specific sequences of oligonucleotide primers used for detection are as follows: for CD154, 5′‐CCAGGTGCTTCGGTGTTTGT‐3′ (sense), 5′‐ATGGCTCACTTGGCTTGGAT‐3′ (antisense); for MMP‐2, 5′‐CTATTCTGTCAGCACTTTGG‐3′ (sense), 5′‐CAGACTTTGGTTCTCCAACTT‐3′ (antisense); for MMP‐9, 5′‐AAATGTGGGTGTACACAGGC‐3′ (sense), 5′‐TCCTTGGGGCTCTCAATTTC‐3′ (antisense); for TIMP‐1, 5′‐GACCACCTTATACCAGCGTT‐3′ (sense), 5′‐GTCACTCTCCAGTTTGCAAG‐3′ (antisense); and for β‐actin, 5′‐GACCTTCAACACCCCAGCCA‐3′ (sense), 5′‐GTCACGCACGATTTCCCTCTC‐3′ (antisense). The Corbett Rotor‐Gene 300 was used for the gene‐expression analysis, making use of the standard protocol for relative quantitative PCR. The 25‐μL reaction system included 2× Premix Ex Tag 12.5 μL, forward and reverse primers (0.5 μL for each), 2 μL cDNA, and 9.5 μL dH2O. The PCR protocol was as follows: predenaturation at 95°C for 3 minutes, denaturation at 95°C for 3 seconds, reannealing at 56°C for 30 seconds, extension at 72°C for 20 seconds, with 35 cycles, followed by the final extension at 78°C for 1 minute. Calculations of C t , preparation of a standard curve, and quantification of messenger RNA (mRNA) in each sample were performed by Rotor‐Gene Operating Software, version 1.8 (Corbett Research).
Statistical analysis
SPSS (version 20; SPSS Inc., Chicago, IL, USA) was used for statistical analysis. Measured data were expressed as mean ± standard deviation. Differences between multiple groups were analyzed by analysis of variance, whereas that between the two groups were analyzed by t test. A p value < 0.05 was taken to be significant.
Ethical considerations
The study conformed to the Helsinki Declaration and was reviewed and approved by the local Research Committee; written informed consent was obtained from all participants.
Results
Expression of CD154 isoforms (sCD154 and mCD154)
Results showed that serum concentrations of sCD154 in MS patients were higher than healthy controls (Table 1). Among the different MS subtypes, SPMS patients had higher concentration of sCD154 than other subtypes (Table 2), whereas no significant difference was found between the levels of sCD154 in PPMS patients and the healthy controls (Tables 1 and 2). The serum concentration of sCD154 in the SPMS patients was approximately twofold higher than that in the healthy controls (Tables 1 and 2). The concentrations of mCD154 in the PBMCs of patient groups and healthy controls were significantly different (p < 0.001; Fig. 1), whereas no significant difference was found between the levels of mCD154 in the PBMCs of patient group. Interestingly, patients with developmental stages of the disease (SPMS and RRMS) showed relatively lower concentration of mCD154 in their PBMCs (Fig. 1). The mRNA concentration of CD154 in PBMCs in patients was significantly higher than the control samples (p < 0.001; Fig. 2). In the patient group, SPMS expressed significantly higher concentration of CD154‐mRNA in their PBMCs than other patients.
Table 1.
Concentrations of MMPs, TIMP‐1, and sCD154 among controls and MS patients. Serum concentrations of these molecules were measured in an automated instrument, according to the manufacturer's instructions as described previously.
| Patients (n = 55) | Controls (n = 55) | Significance (two tailed) | |
|---|---|---|---|
| MMP‐2 | 821.9 ± 178.7 (798.1/561.1–1200.7) | 695.4 ± 192.2 (757.3/200.9–990.3) | p = 0.0005* |
| MMP‐9 | 799.4 ± 230.8 (790.3/289.3–1271.4) | 576.5 ± 149.8 (567.6/318.5–818.5) | p < 0.0001* |
| TIMP‐1 | 932.2 ± 142.0 (958.3/428.5–1200.4) | 1041.3 ± 126.5 (1018.5/818.4–1367.6) | p < 0.0001* |
| sCD154 | 5.1 ± 1.3 (5.1/2.1–8.5) | 3.7 ± 0.9 (3.5/2.1–5.9) | p < 0.0001* |
Data are presented as mean (ng/mL) ± SD (median/range).
*Significant values.
MMP = matrix metalloproteinase; MS = multiple sclerosis; sCD154 = soluble CD154; SD = standard deviation; TIMP‐1 = tissue inhibitor of metalloproteinase 1.
Table 2.
Concentration of MMPs, TIMP‐1, and sCD154 among different subtypes of MS. Serum concentrations of these molecules were measured in an automated instrument, according to the manufacturer's instructions as described previously.
| MS (n = 55) | MMP‐2 | MMP‐9 | TIMP‐1 | sCD154 | |
|---|---|---|---|---|---|
| RRMS (n = 30) | 614.1 ± 151.6 (611.5/318.5–818.5) | 714.1 ± 208.2 (745.5/289.3–1118.5) | 975.9 ± 89.2 (990.3/814.5–1098.1) | 4.6 ± 1.2 (4.5/2.0–7.6) | |
| SPMS (n = 15) | 945.5 ± 148.2 (958.8/632.4–1200.7) | 933.0 ± 227.1 (957.3/517.6–1271.4) | 822.8 ± 200.2 (867.6/428.5–1200.4) | 6.1 ± 1.5 (6.4/3.2–8.5) | |
| PPMS (n = 10) | 760.1 ± 167.5 (723.8/567.6–1018.5) | 854.9 ± 205.6 (889.6/511.3–1068.5) | 1005.3 ± 93.4 (978.9/9011.3–1223.0) | 3.6 ± 0.4 (3.5/3.3–6.4) | |
| Significance (two tailed) | Subtypes (RRMS and SPMS) | p < 0.001* | p < 0.01* | p < 0.01* | p < 0.001* |
| Subtypes (RRMS and PPMS) | p < 0.05* | NS | NS | NS | |
| Subtypes (SPMS and PPMS) | p < 0.05* | NS | p < 0.05* | p < 0.001* | |
Data are presented as mean (ng/mL) ± SD (median/range).
*Significant values.
MMP = matrix metalloproteinase; MS = multiple sclerosis; NS = not significant; PPMS = primary‐progressive MS; RRMS = relapsing‐remitting MS; sCD154 = soluble CD154; SD = standard deviation; SPMS = secondary‐progressive MS; TIMP‐1 = tissue inhibitor of metalloproteinase 1.
Figure 1.
Western blot analysis of mCD40L protein in PBMCs isolated from controls and different MS subtypes (PPMS, SPMS, and RRMS). mCD40L = membrane‐bound CD40 ligand; MS = multiple sclerosis; PBMCs = peripheral blood mononuclear cells; PPMS = primary‐progressive multiple sclerosis; RRMS = relapsing‐remitting multiple sclerosis; SPMS = secondary‐progressive multiple sclerosis.
Figure 2.
Expression of mCD40L‐mRNA in PBMCs isolated from controls, MS patients with subtypes (SPMS and RRMS) with and without exacerbation (EC). mCD40L = membrane‐bound CD40 ligand; mRNA = messenger RNA; MMP = matrix metalloproteinase; MS = multiple sclerosis; PBMCs = peripheral blood mononuclear cells; RRMS = relapsing‐remitting multiple sclerosis; SPMS = secondary‐progressive multiple sclerosis; TIMP‐1 = tissue inhibitor of metalloproteinase 1.
Expression of MMP‐2, MMP‐9, and TIMP‐1
The mean serum concentrations of MMP‐2, MMP‐9, and TIMP‐1 in each group are presented in Table 2. The mean serum concentrations of MMP‐2 and MMP‐9 in the patients were significantly higher than healthy controls (p < 0.05; Fig. 1). Among the different MS subtypes, PPMS patients had lower concentrations of MMP‐2 and MMP‐9 when compared with other subtypes (Table 2), whereas SPMS patients had lower concentrations of TIMP‐1 than other subtypes (Table 2). Serum levels of MMP‐2 and MMP‐9 in the SPMS patients were higher than other subtypes (Table 2). The mRNA concentration of TIMP‐1 in PBMCs of both groups was relatively similar (Fig. 2). In the patient group, SPMS patients in exacerbation period expressed significantly higher concentration of MMP‐2‐mRNA in their PBMCs than other patients (Table 3).
Table 3.
Concentration of MMPs, TIMP‐1, and sCD154 among different subtypes of MS with exacerbation (EC). Serum concentrations of these molecules were measured with an automated instrument, according to the manufacturer's instructions as described previously.
| MMP‐2 | MMP‐9 | TIMP‐1 | sCD154 | |
|---|---|---|---|---|
| RRMS with EC (n = 11) | 698.3 ± 165.3 | 684.2 ± 247.4 | 958.7 ± 111.5 | 4.7 ± 0.6 |
| SPMS with EC (n = 6) | 923.2 ± 109.8 | 967.4 ± 131.2 | 847.2 ± 285.2 | 6.1 ± 1.1 |
| Total patients with EC (n = 17) | 848.3 ± 123.5 | 784.2 ± 251.2 | 919.3 ± 190.3 | 5.2 ± 1.0 |
| Patients without EC (n = 38) | 810.2 ± 198.8 | 806.3 ± 224.3 | 938.0 ± 116.8 | 5.1 ± 1.5 |
| Significance (RRMS and SPMS; two tailed) | p = 0.0095* | p = 0.0206* | NS | p = 0.0037 * |
| Significance (total patients with EC and patients without EC; two tailed) | NS | NS | NS | NS |
Data are presented as mean (ng/mL) ± SD.
*Significant values.
EC = exacerbation; MMP = matrix metalloproteinase; MS = multiple sclerosis; NS = not significant; RRMS = relapsing‐remitting MS; sCD154 = soluble CD154; SD = standard deviation; SPMS = secondary‐progressive MS; TIMP‐1 = tissue inhibitor of metalloproteinase 1.
MMP‐2/TIMP‐1 and MMP‐9/TIMP‐1 ratios
The controls had significantly lower MMP‐2/TIMP‐1 and MMP‐9/TIMP‐1 ratios than the study patients (Table 4). In different MS subtypes, SPMS patients showed higher ratios of both MMP‐2/TIMP‐1 and MMP‐9/TIMP‐1 in comparison with other subtypes even in the exacerbation period (Table 4). The MMP‐2/TIMP‐1 ratio was relatively higher in patients in the exacerbation period than the MMP‐9/TIMP‐1 ratio (Table 4).
Table 4.
MMP‐9/TIMP‐1 and MMP‐2/TIMP‐1 ratio in different subtypes of MS and patients with exacerbation (EC).
| MMP‐2/TMP‐1 | MMP‐9/TIMP‐1 | ||
|---|---|---|---|
| RRMS (n = 30) | 0.8 ± 0.2 | 0.7 ± 0.2 | |
| SPMS (n = 15) | 1.2 ± 0.4 | 1.2 ± 0.4 | |
| PPMS (n = 10) | 0.7 ± 0.1 | 0.8 ± 0.2 | |
| Patients (n = 55) | 0.9 ± 0.3 | 0.8 ± 0.3 | |
| Patients with EC (n = 17) | 1.0 ± 0.4 | 0.9 ± 0.4 | |
| Controls (n = 55) | 0.6 ± 0.2 | 0.5 ± 0.1 | |
| Significance (two tailed) | p (RRMS and controls) | 0.0002* | <0.0001* |
| p (SPMS and controls) | <0.0001* | <0.0001* | |
| p (PPMS and controls) | 0.0213* | <0.0001* | |
| p (patients and controls) | <0.0001* | <0.0001* | |
| p (patients with EC and controls) | <0.0001* | <0.0001* | |
Data are presented as mean (ng/mL) ± SD
*Significant values.
MMP = matrix metalloproteinase; MS = multiple sclerosis; PPMS = primary‐progressive MS; RRMS = relapsing‐remitting MS; SD = standard deviation; SPMS = secondary‐progressive MS; TIMP‐1 = tissue inhibitor of metalloproteinase 1.
Discussion
According to this finding, it has been postulated that the MMPs levels are in accordance with MS stages and the severity of complications. Our findings are similar to previous studies reporting that the period of peak signs in experimental autoimmune encephalomyelitis (EAE), an animal model of MS, and the transcripts encoding the majority of MMPs, was elevated [31]. Specially, MMP‐9 is a proteinase establishing various disease‐promoting feedback loops in autoimmune diseases. Experimental results have shown that the MMP‐2 null mice are more susceptive to EAE because of the compensatory increase in MMP‐9 in these animals [32]. In this animal model, the increase in the level of MMP‐9 promotes the development and progression of the disease whereas changes in the level of MMP‐2 have a role in its resolution [33]. These data suggested that the different MMPs enzymes might have distinct roles in EAE development, as the experiments have proven that the double MMP‐2 and MMP‐9 knockout mice are resistant to EAE development [34].
In a number of animal models, the CD154 has been shown to be involved in the onset of inflammatory disease, including EAE, collagen‐induced arthritis, thyroiditis, uveitis, inflammatory bowel disease, and diabetes [[35], [36], [37], [38], [39]]. Because CD40 has been demonstrated to be expressed on activated T cells and acted as costimulatory molecules, the CD154/CD40 pathway is now thought to be important for the pathogenesis and development of autoimmune diseases, influencing not only the cognitive activation of antigen‐presenting cells (APCs) but also that of T cells [40]. Most CD154+ cells found in the brains of MS patients are CD4+ T cells, and MS patients have a higher frequency of CD154+ T cells than healthy controls, which decrease following treatment with interferon‐β [41]. In EAE, CD40 is expressed in the spinal cord during acute disease and relapse, whereas CD154 is expressed highly only during relapse, and CD154−/− mice do not develop EAE [42]. Administration of an antagonistic anti‐CD154 monoclonal antibody at the time of EAE induction prevents disease and if treatment is given at the peak of acute disease, mice have fewer relapses of shorter duration, correlating with decreased Th1 cell differentiation and fewer inflammatory cells within the central nervous system [[43], [44]]. In other studies, however, anti‐CD154 treatment is ineffective at alleviating EAE if given less than 7 days postimmunizations [45]. Thus, CD40 signals appear to be more critical during the priming stage of EAE than during established stages of the disease. Importantly, the cleaved form of sCD154 retains its ability to bind CD40 in activated target cells, acting in a signaling manner relating to soluble cytokines [46]. Platelet CD154 can make endothelial cells activated to produce the chemokines interleukin‐8 (IL‐8) and monocyte chemotactic protein‐1 (MCP‐1), which can subsequently recruit leukocytes to areas of vascular inflammation. Once recruited, the CD154‐induced upregulation of endothelial cell adhesion molecules E‐selectin, vascular cell adhesion molecule, and intercellular adhesion molecule 1 allows polymorphonuclear leukocytes to bind to and potentially extravasate across the endothelium [47]. In the context of a mouse ischemia‐reperfusion model, Ishikawa et al. [48] showed that CD40–CD154 signaling played an integral role in vascular permeability and compromised the function of BBB function. Platelet‐derived sCD154 was specifically shown to induce IL‐6 synthesis and cyclooxygenase‐2 expression followed by downstream prostaglandin E2 production in human lung fibroblasts [49]. Lastly, the recombinant CD154 as well as serum with elevated levels of sCD154 was able to cause an increased release of MCP‐1 from mononuclear cells [50].
Nevertheless, there has been no report on the effect of MMPs/TIMPs ratios on the expression pattern of the sCD154 in MS patients. With this novel sight, we developed our study and detected high levels of sCD154 in MS patients, especially in the exacerbation stage. We also demonstrated the increase in MMP‐2 and the MMP‐9/TIMP‐1 ratios promotes expression of sCD154 in SPMS more than other patients. Here, we showed that the serum concentration of MMPs and TIMP‐1 in patients with the exacerbation and developmental stages of MS had a direct relationship with sCD154 concentration.
In conclusion, our study showed that MMP‐2, MMP‐9, and the MMPs/TIMP‐1 ratios may mediate the formation of exacerbation stage directly or as a positive feedback loop through the sCD154 pathway. High concentration of sCD154 was observed in SPMS patients, suggesting a probable link to disease progression and providing a basis for targeting CD154 in the future interventions. We also recommend that there is a special signaling pathway between CD154–CD40 interaction and MMP‐2 and MMP‐9 expressions. Otherwise, it is possible that unbalanced MMPs/TIMPs expression toward excessive gelatinolytic activity may contribute to increased concentration of sCD154 and establish CD154‐dependent neuronal damage in exacerbating patients with MS. The relationship between the markers examined in our study and the presence of disease exacerbation requires further elucidation.
Acknowledgments
This research was financially supported by Zabol University, Zabol, Iran. We appreciate Dr Ali Moghtaderi for his helpful efforts in sample collection.
Conflicts of interest: All authors declare no conflicts of interest.
References
- [1]. Waubant E., Goodkin D.E., Gee L., Bacchetti P., Sloan R., Stewart T., et al. Serum MMP‐9 and TIMP‐1 levels are related to MRI activity in relapsing multiple sclerosis. Neurology. 1999; 53: 1397–1401. [DOI] [PubMed] [Google Scholar]
- [2]. Avolio C., Ruggieri M., Giuliani F., Liuzzi G.M., Leante R., Riccio P., et al. Serum MMP‐2 and MMP‐9 are elevated in different multiple sclerosis subtypes. J Neuroimmunol. 2003; 136: 46–53. [DOI] [PubMed] [Google Scholar]
- [3]. Waubant E.. Biomarkers indicative of blood‐brain barrier disruption in multiple sclerosis. Dis Markers. 2006; 22: 235–244. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [4]. Yong V.W., Power C., Forsyth P., Edwards D.R.. Metalloproteinases in biology and pathology of the nervous system. Nat Rev Neurosci. 2001; 2: 502–513. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [5]. Leppert D., Lindberg R.L., Kappos L., Leib S.L.. Matrix metalloproteinases: multifunctional effectors of inflammation in multiple sclerosis and bacterial meningitis. Brain Res Brain Res Rev. 2001; 36: 249–257. [DOI] [PubMed] [Google Scholar]
- [6]. Yong V.W., Zabad R.K., Agrawal S., Goncalves Dasilva A., Metz L.M.. Elevation of matrix metalloproteinases (MMPs) in multiple sclerosis and impact of immunomodulators. J Neurol Sci. 2007; 259: 79–84. [DOI] [PubMed] [Google Scholar]
- [7]. Handsley M.M., Edwards D.R.. Metalloproteinases and their inhibitors in tumor angiogenesis. Int J Cancer. 2005; 115: 849–860. [DOI] [PubMed] [Google Scholar]
- [8]. Li N.. Platelet‐lymphocyte cross‐talk. J Leukoc Biol. 2008; 83: 1069–1078. [DOI] [PubMed] [Google Scholar]
- [9]. Harnett M.M.. CD40: a growing cytoplasmic tale. Sci STKE. 2004; 2004: pe25. [DOI] [PubMed] [Google Scholar]
- [10]. Geldart T., Illidge T.. Anti‐CD 40 monoclonal antibody. Leuk Lymphoma. 2005; 46: 1105–1113. [DOI] [PubMed] [Google Scholar]
- [11]. Pluvinet R., Olivar R., Krupinski J., Herrero‐Fresneda I., Luque A., Torras J., et al. CD40: an upstream master switch for endothelial cell activation uncovered by RNAi‐coupled transcriptional profiling. Blood. 2008; 112: 3624–3637. [DOI] [PubMed] [Google Scholar]
- [12]. Alaaeddine N., Hassan G.S., Yacoub D., Mourad W.. CD154: an immunoinflammatory mediator in systemic lupus erythematosus and rheumatoid arthritis. Clin Dev Immunol. 2012; 2012: 490148. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [13]. Benveniste E.N., Nguyen V.T., Wesemann D.R.. Molecular regulation of CD40 gene expression in macrophages and microglia. Brain Behav Immun. 2004; 18: 7–12. [DOI] [PubMed] [Google Scholar]
- [14]. Wischhusen J., Schneider D., Mittelbronn M., Meyermann R., Engelmann H., Jung G., et al. Death receptor‐mediated apoptosis in human malignant glioma cells: modulation by the CD40/CD40L system. J Neuroimmunol. 2005; 162: 28–42. [DOI] [PubMed] [Google Scholar]
- [15]. Ramirez S.H., Fan S., Dykstra H., Reichenbach N., Del Valle L., Potula R., et al. Dyad of CD40/CD40 ligand fosters neuroinflammation at the blood‐brain barrier and is regulated via JNK signaling: implications for HIV‐1 encephalitis. J Neurosci. 2010; 30: 9454–9464. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [16]. Tousoulis D., Androulakis E., Papageorgiou N., Briasoulis A., Siasos G., Antoniades C., et al. From atherosclerosis to acute coronary syndromes: the role of soluble CD40 ligand. Trends Cardiovasc Med. 2010; 20: 153–164. [DOI] [PubMed] [Google Scholar]
- [17]. Donhauser N., Pritschet K., Helm M., Harrer T., Schuster P., Ries M., et al. Chronic immune activation in HIV‐1 infection contributes to reduced interferon alpha production via enhanced CD40:CD40 ligand interaction. PLoS One. 2012; 7: e33925. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [18]. Xu X., Huang H., Cai M., Qian Y., Li Z., Bai H., et al. Combination of IL‐1 receptor antagonist, IL‐20 and CD40 ligand for the prediction of acute cellular renal allograft rejection. J Clin Immunol. 2013; 33: 280–287. [DOI] [PubMed] [Google Scholar]
- [19]. Wang J.H., Zhang Y.W., Zhang P., Deng B.Q., Ding S., Wang Z.K., et al. CD40 ligand as a potential biomarker for atherosclerotic instability. Neurol Res. 2013; 35: 693–700. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [20]. Sathawane D., Kharat R.S., Halder S., Roy S., Swami R., Patel R., et al. Monocyte CD40 expression in head and neck squamous cell carcinoma (HNSCC). Hum Immunol. 2013; 74: 1–5. [DOI] [PubMed] [Google Scholar]
- [21]. Azzam H., Abousamra N.K., Wafa A.A., Hafez M.M., El‐Gilany A.H.. Upregulation of CD40/CD40L system in rheumatic mitral stenosis with or without atrial fibrillation. Platelets. 2013; 24: 516–520. [DOI] [PubMed] [Google Scholar]
- [22]. Fernández Bello I., Álvarez M.T., López‐Longo F.J., Arias‐Salgado E.G., Martín M., Jiménez‐Yuste V., et al. Platelet soluble CD40L and matrix metalloproteinase 9 activity are proinflammatory mediators in Behçet disease patients. Thromb Haemost. 2012; 107: 88–98. [DOI] [PubMed] [Google Scholar]
- [23]. Meabed M.H., Taha G.M., Mohamed S.O., El‐Hadidy K.S.. Autoimmune thrombocytopenia: flow cytometric determination of platelet‐associated CD154/CD40L and CD40 on peripheral blood T and B lymphocytes. Hematology. 2007; 12: 301–307. [DOI] [PubMed] [Google Scholar]
- [24]. Quezada S.A., Jarvinen L.Z., Lind E.F., Noelle R.J.. CD40/CD154 interactions at the interface of tolerance and immunity. Annu Rev Immunol. 2004; 22: 307–328. [DOI] [PubMed] [Google Scholar]
- [25]. Howard L.M., Miller S.D.. Immunotherapy targeting the CD40/CD154 costimulatory pathway for treatment of autoimmune disease. Autoimmunity. 2004; 37: 411–418. [DOI] [PubMed] [Google Scholar]
- [26]. Kalunian K.C., Davis J.C. Jr., Merrill J.T., Totoritis M.C., Wofsy D., IDEC‐131 Lupus Study Group . Treatment of systemic lupus erythematosus by inhibition of T cell costimulation with anti‐CD154: a randomized, double‐blind, placebo‐controlled trial. Arthritis Rheum. 2002; 46: 3251–3258. [DOI] [PubMed] [Google Scholar]
- [27]. Boumpas D.T., Furie R., Manzi S., Illei G.G., Wallace D.J., Balow J.E., et al. A short course of BG9588 (anti‐CD40 ligand antibody) improves serologic activity and decreases hematuria in patients with proliferative lupus glomerulonephritis. Arthritis Rheum. 2003; 48: 719–727. [DOI] [PubMed] [Google Scholar]
- [28]. Polman C.H., Reingold S.C., Edan G., Filippi M., Hartung H.P., Kappos L., et al. Diagnostic criteria for multiple sclerosis: 2005 revisions to the “McDonald criteria”. Ann Neurol. 2005; 58: 840–846. [DOI] [PubMed] [Google Scholar]
- [29]. Sanadgol N., Ramroodi N., Ahmadi G.A., Komijani M., Moghtaderi A., Bouzari M., et al. Prevalence of cytomegalovirus infection and its role in total immunoglobulin pattern in Iranian patients with different subtypes of multiple sclerosis. New Microbiol. 2011; 34: 263–274. [PubMed] [Google Scholar]
- [30]. Sanadgol N., Mostafaie A., Bahrami G., Mansouri K., Ghanbari F., Bidmeshkipour A., et al. Elaidic acid sustains LPS and TNF‐alpha induced ICAM‐1 and VCAM‐I expression on human bone marrow endothelial cells (HBMEC). Clin Biochem. 2010; 43: 968–972. [DOI] [PubMed] [Google Scholar]
- [31]. Weaver A., Goncalves da Silva A., Nuttall R.K., Edwards D.R., Shapiro S.D., Rivest S., et al. An elevated matrix metalloproteinase (MMP) in an animal model of multiple sclerosis is protective by affecting Th1/Th2 polarization. FASEB J. 2005; 19: 1668–1670. [DOI] [PubMed] [Google Scholar]
- [32]. Esparza J., Kruse M., Lee J., Michaud M., Madri J.A.. MMP‐2 null mice exhibit an early onset and severe experimental autoimmune encephalomyelitis due to an increase in MMP‐9 expression and activity. FASEB J. 2004; 18: 1682–1691. [DOI] [PubMed] [Google Scholar]
- [33]. Goncalves DaSilva A., Yong V.W.. Matrix metalloproteinase‐12 deficiency worsens relapsing‐remitting experimental autoimmune encephalomyelitis in association with cytokine and chemokine dysregulation. Am J Pathol. 2009; 174: 898–909. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [34]. Agrawal S., Anderson P., Durbeej M., van Rooijen N., Ivars F., Opdenakker G., et al. Dystroglycan is selectively cleaved at the parenchymal basement membrane at sites of leukocyte extravasation in experimental autoimmune encephalomyelitis. J Exp Med. 2006; 203: 1007–1019. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [35]. Gerritse K., Laman J.D., Noelle R.J., Aruffo A., Ledbetter J.A., Boersma W.J., et al. CD40‐CD40 ligand interactions in experimental allergic encephalomyelitis and multiple sclerosis. Proc Natl Acad Sci USA. 1996; 93: 2499–2504. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [36]. Bagenstose L.M., Agarwal R.K., Silver P.B., Harlan D.M., Hoffmann S.C., Kampen R.L., et al. Disruption of CD40/CD40‐ligand interactions in a retinal autoimmunity model results in protection without tolerance. J Immunol. 2005; 175: 124–130. [DOI] [PubMed] [Google Scholar]
- [37]. Namba K., Ogasawara K., Kitaichi N., Morohashi T., Sasamoto Y., Kotake S., et al. Amelioration of experimental autoimmune uveoretinitis by pretreatment with a pathogenic peptide in liposome and anti‐CD40 ligand monoclonal antibody. J Immunol. 2000; 165: 2962–2969. [DOI] [PubMed] [Google Scholar]
- [38]. Danese S., Sans M., Fiocchi C.. The CD40/CD40L costimulatory pathway in inflammatory bowel disease. Gut. 2004; 53: 1035–1043. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [39]. Balasa B., Krahl T., Patstone G., Lee J., Tisch R., McDevitt H.O., et al. CD40 ligand‐CD40 interactions are necessary for the initiation of insulitis and diabetes in nonobese diabetic mice. J Immunol. 1997; 159: 4620–4627. [PubMed] [Google Scholar]
- [40]. Munroe M.E., Arbiser J.L., Bishop G.A.. Honokiol, a natural plant product, inhibits inflammatory signals and alleviates inflammatory arthritis. J Immunol. 2007; 179: 753–763. [DOI] [PubMed] [Google Scholar]
- [41]. Teleshova N., Bao W., Kivisäkk P., Ozenci V., Mustafa M., Link H.. Elevated CD40 ligand expressing blood T‐cell levels in multiple sclerosis are reversed by interferon‐beta treatment. Scand J Immunol. 2000; 51: 312–320. [DOI] [PubMed] [Google Scholar]
- [42]. Grewal I.S., Foellmer H.G., Grewal K.D., Xu J., Hardardottir F., Baron J.L., et al. Requirement for CD40 ligand in costimulation induction, T cell activation, and experimental allergic encephalomyelitis. Science. 1996; 273: 1864–1867. [DOI] [PubMed] [Google Scholar]
- [43]. Howard L.M., Miga A.J., Vanderlugt C.L., Dal Canto M.C., Laman J.D., Noelle R.J., et al. Mechanisms of immunotherapeutic intervention by anti‐CD40L (CD154) antibody in an animal model of multiple sclerosis. J Clin Invest. 1999; 103: 281–290. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [44]. Howard L.M., Dal Canto M.C., Miller S.D.. Transient anti‐CD154‐mediated immunotherapy of ongoing relapsing experimental autoimmune encephalomyelitis induces long‐term inhibition of disease relapses. J Neuroimmunol. 2002; 129: 58–65. [DOI] [PubMed] [Google Scholar]
- [45]. Schaub M., Issazadeh S., Stadlbauer T.H., Peach R., Sayegh M.H., Khoury S.J.. Costimulatory signal blockade in murine relapsing experimental autoimmune encephalomyelitis. J Neuroimmunol. 1999; 96: 158–166. [DOI] [PubMed] [Google Scholar]
- [46]. van Kooten C., Banchereau J.. CD40‐CD40 ligand. J Leukoc Biol. 2000; 67: 2–17. [DOI] [PubMed] [Google Scholar]
- [47]. Hollenbaugh D., Mischel‐Petty N., Edwards C.P., Simon J.C., Denfeld R.W., Kiener P.A., et al. Expression of functional CD40 by vascular endothelial cells. J Exp Med. 1995; 182: 33–40. [DOI] [PMC free article] [PubMed] [Google Scholar]
- [48]. Ishikawa M., Vowinkel T., Stokes K.Y., Arumugam T.V., Yilmaz G., Nanda A., et al. CD40/CD40 ligand signaling in mouse cerebral microvasculature after focal ischemia/reperfusion. Circulation. 2005; 111: 1690–1696. [DOI] [PubMed] [Google Scholar]
- [49]. Kaufman J., Spinelli S.L., Schultz E., Blumberg N., Phipps R.P.. Release of biologically active CD154 during collection and storage of platelet concentrates prepared for transfusion. J Thromb Haemost. 2007; 5: 788–796. [DOI] [PubMed] [Google Scholar]
- [50]. Aukrust P., Müller F., Ueland T., Berget T., Aaser E., Brunsvig A., et al. Enhanced levels of soluble and membrane‐bound CD40 ligand in patients with unstable angina. Possible reflection of T lymphocyte and platelet involvement in the pathogenesis of acute coronary syndromes. Circulation. 1999; 100: 614–620. [DOI] [PubMed] [Google Scholar]