Skip to main content
The Kaohsiung Journal of Medical Sciences logoLink to The Kaohsiung Journal of Medical Sciences
. 2013 May 7;29(6):289–298. doi: 10.1016/j.kjms.2012.10.006

Propofol inhibits hypoxia/reoxygenation‐induced human gastric epithelial cell injury by suppressing the Toll‐like receptor 4 pathway

Jiao‐Li Zhang 1,2, Su‐Juan Fei 2, Xia Qin 1,3, Hui‐Hui Ye 1,2, He‐Xia Liu 1,2, Xiao‐Jing Dai 1, Yong‐Mei Zhang 1,2,3,
PMCID: PMC11916607  PMID: 23684133

Abstract

This study aimed to investigate the role of the Toll‐like receptor 4 (TLR4) pathway in normal human gastric epithelial (GES‐1) cells under hypoxia/reoxygenation (H/R) in vitro, and the effect of propofol on injured GES‐1 cells as well as its possible mechanism. Before H/R induction, GES‐1 cells were preconditioned with fat emulsion, propofol, or epigallocatechin gallate. Then cell viability, cell apoptosis, and related molecules in the cells were analyzed under experimental conditions. We found that propofol 50 μmol/L markedly inhibited the H/R injury under hypoxia 1.5 h/reoxygenation 2 hours by promoting GES‐1 cell viability and decreasing cell apoptosis. The TLR4 signal may be involved in the protective effect of propofol against H/R injury. The malondialdehyde contents and superoxide dismutase activities were recovered under propofol preconditioning. In summary, propofol preconditioning may exert a protective effect on H/R injury in GES‐1 cells and the mechanism may be via inhibition of the activated TLR4 signal under H/R conditions.

Keywords: Gastric epithelial (GES‐1) cells, Hypoxia/reoxygenation, Propofol, Toll‐like receptor 4 (TLR4)

Introduction

Lots of stressors, such as trauma [1] and surgery, can lead to tissue ischemia. So‐called gastric mucosa ischemice‐reperfusion injury (I/RI) is that it was injured when blood flow was restored [2]. However, there are few desirable treatments for gastric I/RI in the clinic. Recently, ischemic preconditioning and postconditioning have been considered to be significant methods in endogenous protection, which can significantly reduce I/RI [3].

Most recent studies on TLRs have focused on immune cells known to be involved in innate immunity, such as dendritic cells (DCs), monocytes, granulocytes and their inflammatory reactions [4]. Toll‐like receptor 4 (TLR4), one of the TLR family members, has been shown to be expressed in many tissues, including gastric endothelial cells [4] and cardiomyocytes [5]. Studies have suggested that the TLR4 signal can be mediated through myeloid differentiation protein 88 (MyD88)‐dependent and MyD88‐independent pathways [6]. Classically, the MyD88‐dependent pathway derives from the Toll/interleukin‐1 receptor domain. The activated Toll/interleukin‐1 receptor facilitates nuclear factor‐kappa B (NF‐κB) translocation into the nucleus and controls the phosphorylation of inhibitory protein of NF‐κB (IκB‐α) [7]. The TLR4 signal was restricted to the MyD88‐dependent pathway in endothelial cells lacking of some adaptors, such as the Toll/interleukin‐1receptor domain‐containing adaptor protein inducing interferon‐β [4].

Previous studies have suggested that TLR4 plays a critical role in multiple organs' I/RI, such as the lungs [8], heart [9] and hepar [10]. Meanwhile, however, whether or not the TLR4 signal is involved in human gastric epithelial cell injury induced by hypoxia/reoxygenation (H/R) remains unclear. In this study, Western blotting was used to detect TLR4 as well as downstream molecule expression. Epigallocatechin gallate (EGCG), an inhibitor of TLR4 [11], was used to further define the role of TLR4 in human gastric epithelial (GES‐1) cell injury induced by H/R by detecting cell viability.

It is well known that oxidative stress plays a critical role in I/RI. Malondialdehyde (MDA) is an end product of 1ipid peroxidation, whose level is a marker of the severity of cells being attacked by oxygen free radical (OFR). Superoxide dismutase (SOD) is a major endogenous anti‐oxidant in cells, whose activity reflects the ability of OFR scavenging. Therefore, the amount of MDA and level SOD activities in GES‐1 cells under H/R conditions were measured.

Propofol is a widely used anesthetic agent for the induction and maintenance of anesthesia, not only during surgical operations, but also for sedation in patients who are seriously ill. In recent years, propofol has increasingly been used in painless gastroscopy. It has been reported that propofol is an immunomodulatory drug [12]. Furthermore, propofol has been indicated to have protective effects against I/RI in the heart [[13], [14]] and brain [[15], [16]]. Whether propofol has a protective effect on H/R‐induced injury in gastric epithelial cells in vitro and its possible mechanism of action, however, are not clear. Thus, we measured cell viability, cell apoptosis, apoptotic‐related proteins (Bax/Bcl‐2) and proteins involved in TLR4 signaling to determine the effect of propofol in H/R injury in GES‐1 cells [17] and elucidate the underlying mechanism. Studies have indicated that propofol has antioxidant activity [[18], [19]], so colorimetry was used to detect the change in the amount of MDA and level of SOD activities in injured GES‐1 cells under propofol preconditioning.

In summary, the role of the TLR4 signal pathway in gastric epithelial cell injury under H/R and the novel pharmacological effect of propofol on the injured cells were investigated in our study.

Materials and methods

Reagents

The following reagents were used:

  • phenol red‐free Dulbecco's modified Eagle's medium (DMEM) (GIBCO Co., State of California, USA);

  • propofol (Astra Zeneca, Basiglio, Italy);

  • fat emulsion (Huarui Pharmaceuticals Co. Ltd, Wuxi, China);

  • EGCG (Shanghai Yuanye Biotechnology Co. Ltd., China);

  • RPMI‐1640 and Hoechst 33258 (Sigma‐Aldrich Co., State of Missouri, USA);

  • fetal bovine serum (FBS) (Zhejiang Tianhang Biological Manufacture Co. Ltd., China);

  • 3‐(4, 5‐dimethylthazol‐ 2‐yl)‐2, 5‐diphenyl tetrazolium bromide (MTT) (Amresco, Solon, OH, USA).

The MDA and SOD detection kits were produced by the Nanjing Jiancheng Bioengineering Institute, China, and the annexin fluorescein isothiocyanate (V‐FITC) cell apoptosis detection kit was produced by Beijing Baosai Biotechnology Co. Ltd., China.

The following products from Santa Cruz Biotechnology (USA) were also used:

  • goat polyclonal anti‐TLR4 (sc‐16240);

  • rabbit polyclonal anti‐MyD88 (sc‐11356);

  • mouse monoclonal anti‐NF‐κB P65 (sc‐8008);

  • rabbit polyclonal anti‐IκB‐α (sc‐371);

  • mouse monoclonal anti‐p‐IκB‐α (sc‐8404);

  • rabbit polyclonal anti‐Bax (sc‐526); and

  • rabbit polyclonal anti‐Bcl‐2 (sc‐492).

The following products from ZSGB‐BIO (China) were also used:

  • mouse anti‐beta actin monoclonal antibody (TA‐09);

  • alkaline phosphatase goat anti‐rabbit IgG (ZB‐2308);

  • alkaline phosphatase horse anti‐mouse IgG (ZB‐2310); and

  • alkaline phosphatase rabbit anti‐goat IgG (ZB‐2311).

The cDNA was provided by Shanghai Bioengineering Co. Ltd. (China).

Cell culture

The normal human GES‐1 cell line was obtained from Beijing Cancer Hospital. Cells were maintained in DMEM containing 10% FBS and placed in a humid incubator with 95% air and 5% CO2 at 37 °C.

Experimental protocol

The complete medium was replaced with DMEM containing 1% FBS 1 day before the experiment to synchronize the cells. The cells were randomly divided into different groups and treated as follows:

  • cells in the normal group (N) were kept under normoxic culture;

  • in the hypoxia/reoxygenation (H/R) group, the DMEM was replaced with RPMI‐1640 medium before hypoxia induction, cells were transferred into a humid atmosphere equilibrated with 94% N2 + 1% O2 + 5% CO2 (for hypoxia), then the medium was replaced with complete medium to simulate reoxygenation in normoxic culture;

  • in the propofol preconditioning (P) group, DMEM was replaced with RPMI‐1640 medium containing propofol, and the other procedures were same as the H/R group;

  • in the fat emulsion group (F), the DMEM was replaced with RPMI‐1640 medium containing fat emulsion, and the other procedures were same as the H/R group;

  • in the EGCG preconditioning group (E) and EGCG plus propofol preconditioning group, DMEM was replaced with RPMI‐1640 medium containing EGCG (1 μmol/L) and EGCG 1 μmol/L plus propofol 50 μmol/L respectively. Other procedures were same as the H/R group.

Cell viability

GES‐1 cells (1 × 104 cells/mL) were cultured in 96‐well plates. Following the experiment, the cells were treated with 25 μL MTT (5 g/L) and incubated for 4 hours in darkness at 37 °C. After removing the medium, the MTT‐formazan crystals were dissolved in DMSO (200 μL/well) and maintained for 10 minutes. Cell viability was determined as a percentage using the following relationship:(ODA570nm in experimental group/ODA570nm in normal control group) × 100%.

Hoechst 33258 staining assay

GES‐1 cells (1 × 104 cells/mL) were incubated in six‐well plates. After the experiment, the supernatants were discarded and the cells were fixed with paraform, and then the cells were washed with PBS (3 minutes × 2), followed by staining with Hoechst 33258 (0.5 mL/well). The proportion of apoptotic GES‐1 cells was determined by manually counting the number of pyknotic nuclei under fluorescence microscopy.

Flow cytometric analysis

The experimental GES‐1 cells (1 × 104 cells/mL) were cultured in six‐well plates. Following the experiments, the cells were harvested and washed with cold PBS three or four times, and the cells were resuspended in 200 μL binding buffer. Then 10 μL of annexin V‐FITC was added to the cell suspensions and incubated at room temperature for 15 minutes in darkness. Next, 300 μL binding buffer and 5 μL propidium iodide were added into the cell suspensions, mixed gently and the samples were kept on ice. The stained cells were analyzed using flow cytometry (Becton Dickinson, USA) to determine the percentage of apoptotic cells.

Western blotting analysis

GES‐1 cells were plated in flasks and incubated for 24 hours. After the experiment, the cells were washed with cold PBS for twice before the mixture of radioimmunoprecipitation assay (RIPA) lysis buffer and phenylmethyl sulfonylfluoride (PMSF) (100:1, 200 μL) were added into the flasks and placed on ice for 30 minutes to split the cells. The cell fragments were harvested and centrifuged for supernatant collection (total proteins). The nuclear pellets were dissolved in lysis buffer (50 μL) again and recentrifuged for supernatant collection (nuclear proteins). The protein concentrations were determined by bicinchoninic acid (BCA) assay. Lysates were boiled in sample buffer for 5 minutes and then the proteins were subjected to sodium dodecyl sulfate polyacrylamide gel electrophoresis and transferred to nitrocellulose (NC) membrane using a semi‐dry electroblotting system. After blocking the nonspecific antigen with blocking buffer, the membranes were incubated with (1:200) primary antibodies at 4 °C overnight followed by incubation with (1:500) corresponding alkaline phosphatase‐conjugated secondary antibodies at room temperature for 2 hours. Protein expression was analyzed quantitatively by densitometry with Photoshop (version 8.1).

Quantitative real‐time polymerase chain reaction

GES‐1 cells (5 × 104 cells/mL) were cultured in six‐well dishes. At the end of experiment, the total mRNA was extracted from cells for real‐time polymerase chain reaction. The amount of β‐actin transcript present was quantified as an internal mRNA control. Quantitative values were obtained from the threshold cycle value (annealing temperature, 55 °C). The primers used for β‐actin were 5′‐TGACGTGGACATCCGCAAAG‐3′ and 5′‐CTGGAAGGTGGACAGCGAGG‐3′; and for TLR4 were 5′‐TTCCCAGAACTGCAGGTGCT‐3′ and 5′‐GATGTCCAATGGGGAAGTTCTC T‐3′.

Measurement of MDA content and SOD activity

MDA was measured with thiobarbituric acid chromatometry. After the experiment, the GES‐1 cells were harvested and centrifuged for supernatant collection. The supernatant concentrations were determined by the BCA assay, and then the reagents involved were added and mixed together. The suspension was placed in boiling water for 40 minutes and was immediately cooled in ice‐cold water. After centrifugation at 4000 g for 10 minutes, the intensity of absorbance of the upper phase was measured by spectrophotometery (723N, Shanghai Precision & Scientific Instrument Co. Ltd., China) at 532 nm. The MDA level was expressed as nmol/mg protein.

SOD activity was assessed based on the inhibition of nitro blue tetrazolium reduction by the xanthine oxidase system as a superoxide generator. We obtained the SOD samples using the same method as for measuring MDA. The reagents involved were added to the supernatant and mixed together. The suspension was placed in a water bath (37 °C) for 40 minutes. A color reagent was then added to the suspension to react with the nitro blue tetrazolium. The intensity of absorbance of the mixture was also determined by spectrophotometer at 550 nm. The SOD activity was expressed as U/mg protein.

Statistical data analysis

Data were shown as mean ± standard deviation (SD). One‐way analysis of variance was performed to analyze the data using SPSS 13.0. Differences between the experimental groups were determined by the Fisher Student Neuman Keuls test. A p value of <0.05 was considered as statistically significant.

Results

The effect of propofol on GES‐1 cell viability under H/R conditions

Cell viability was detected by MTT. We observed that propofol (5, 10, 50, and 100 μmol/L) promoted GES‐1 cell viability in conditions of hypoxia 3 hours/reoxygenation 12 hours (p < 0.05) and that propofol 50 μmol/L was the optimal protective dose (p < 0.01) (Fig. 1A). We therefore chose this concentration of propofol for analysis in the subsequent experiments. The effects of propofol on cell viability at different time points indicated that propofol could promote cell viability under hypoxia (1.5, 3, and 6 hours)/reoxygenation 12 hours (p < 0.05), and the most obviously protective effect was under hypoxia 1.5 hours/reoxygenation 12 hours (p < 0.05) (Fig. 1B). Propofol was able to promote cell viability under hypoxia 1.5 hours/reoxygenation 2, 4, 6, 8, and 12 hours (p < 0.05), and the most striking protective effect was under hypoxia 1.5 hours/reoxygenation 2 hours (p < 0.05) (Fig. 1C). Fat emulsion did not affect cell viability under H/R conditions (Fig. 1D). These data indicated that propofol 50 μmol/L attenuated GES‐1 cell injury induced by hypoxia 1.5 hours/reoxygenation 2 hours, therefore, this model was used in the following experiments.

Figure 1.

Figure 1

Effects of propofol preconditioning on GES‐1 cell viability under H/R conditions. (A) normoxic culture for 15 hours; H/R, hypoxia 3 hours/reoxygenation 12 hours; and propofol (1, 5, 10, 25, 50 and 100 μmol/L) preconditioning under hypoxia 3 hours/reoxygenation 12 hours. (B) Hypoxia (0.75, 1.5, 3, 6, 9 and 12 hours)/reoxygenation 12 hours, with propofol at 50 μmol/L. (C) Hypoxia 1.5 hours/reoxygenation (1, 2, 4, 6, 8 and 12 hours) with propofol at 50 μmol/L. (D) Normoxic culture (N) for 3.5 hours; H/R, fat emulsion 50 μmol/L preconditioning (F) and propofol 50 μmol/L preconditioning (P) groups subjected to hypoxia 1.5 hours/reoxygenation 2 hours. Means ± standard deviation, n = 6. *p < 0.05 vs. N group. # p < 0.05. ## p < 0.01 vs. H/R group.

Effects of propofol on apoptosis and necrosis in GES‐1 cells under H/R conditions

Next, the apoptotic GES‐1 cells were assayed by Hoechst 33258 staining. The number of apoptotic cells with karyopyknosis significantly increased in the H/R group (p < 0.01). Pretreatment with propofol inhibited GES‐1 cell apoptosis and the apoptotic cells in the P group were decreased compared to the H/R group (p < 0.01) (Fig. 2A and B).

Figure 2.

Figure 2

Effects of propofol preconditioning on GES‐1 cell apoptosis induced by H/R. (A, B) Hoechst 33258 was used to stain the apoptosis cells; each value represents the mean ± standard deviation (n = 3). **p < 0.01 vs. N group. ## p < 0.01 vs. H/R group. Scale bar represents 50 μm. (C) Flow cytometric assay was used to detect the percentage of apoptotic and necrotic cells in the N, H/R, F and P groups, respectively.

Moreover, flow cytometry was used to detect the percentage of apoptotic cells, apoptotic cells plus necrotic cells and necrotic cells in the N, H/R, F and P groups respectively (Fig. 2C and Table 1). Compared to the N group, the number of apoptotic cells, apoptotic cells plus necrotic cells and necrotic cells were all increased in the H/R and F groups (p < 0.01). In the P group, there were fewer apoptotic cells, apoptotic cells plus necrotic cells and necrotic cells in comparison with the H/R group (p < 0.01).

Table 1.

The percentage of apoptotic cells, apoptotic plus necrotic cells, and necrotic GES‐1 cells detected by flow cytometric assay in normal, hypoxia/reoxygenation, fat emulsion preconditioning and propofol preconditioning groups respectively (n = 3).

Apoptosis Apoptosis + necrosis Necrosis
N 12.30% ± 0.82% 8.53% ± 0.74% 1.17% ± 0.26%
H/R 34.52% ± 0.65%∗∗ 23.34% ± 0.76%∗∗ 7.30% ± 0.38%∗∗
F 33.76% ± 0.73% 23.01% ± 0.39% 7.19% ± 0.64%
P 25.62% ± 0.53%## 12.73% ± 0.76%## 4.64% ± 0.57%##

**p < 0.01 vs. N group. ## p < 0.01 vs. H/R group.

F = fat emulsion (50 μmol/L) preconditioning under hypoxia 1.5 hours/reoxygenation 2 hours; H/R = hypoxia 1.5 hours/reoxygenation 2 hours; N = normoxic culture for 3.5 hours; P = propofol (50 μmol/L) preconditioning under hypoxia 1.5 hours/reoxygenation 2 hours.

In order to further understand the effect of propofol on cell apoptosis at a molecular level, Bcl‐2 and Bax protein expressions were measured (Fig. 3). The results indicated that protein levels of Bax (Fig. 3A) increased (p < 0.01) and Bcl‐2 (Fig. 3B) levels decreased significantly in the H/R group compared to the N group (p < 0.01). Propofol pretreatment inhibited the increased expression of Bax, enhanced Bcl‐2 expression, and depressed the ratio of Bax/Bcl‐2 (Fig. 3C) compared with the H/R group (p < 0.01).

Figure 3.

Figure 3

Effects of propofol preconditioning on the protein expression of (A) Bax, (B) Bcl‐2 and(C) Bax/Bcl‐2 ratio. Each value represents the mean ± standard deviation (n = 6). *p < 0.05. **p < 0.01 vs. N group. # p < 0.05 vs. H/R group.

The role of TLR4 in H/R injury and the effects of propofol on TLR4 signal‐related protein expression of GES‐1 cells under H/R conditions

To determine whether TLR4 was involved in the protective effect of propofol on GES‐1 cell H/R injury, an inhibitor of TLR4, EGCG, was used to detect cell viability. Results indicated that, compared to the H/R group, EGCG preconditioning enhanced cell viability (p < 0.01). In comparison with the P and E groups, EGCG combined with propofol preconditioning further improved cell viability (p < 0.05) (Fig. 4A). Moreover, the protein (Fig. 4B) and mRNA expression (Fig. 4C) of TLR4 were assayed by Western blotting and quantitative real‐time polymerase chain reaction, respectively. The results indicated that, compared with the N group, the protein and mRNA expression of TLR4 were significantly increased in the H/R and F groups (p < 0.01), while propofol down‐regulated the increased expression of the protein and mRNA (p < 0.01).

Figure 4.

Figure 4

The role of TLR4 in the H/R injury and effect of propofol preconditioning on the protein and mRNA expression of TLR4. (A) Cell viability was detected in H/R, E, P and E + P groups under hypoxia 1.5 hours/reoxygenation 2 hours. Each value represents the mean ± standard deviation (n = 6). a p < 0.01, ## p < 0.01 vs. H/R group. b p < 0.05 vs. E group. c p < 0.05 vs. P group. (B) The protein expression of TLR4 was determined by Western blotting analyses. Each value represents the mean ± standard deviation (n = 6). **p < 0.01 vs. N group. ## p < 0.01 vs. H/R group. (C) The mRNA expression of TLR4 was determined by quantitative real‐time polymerase chain reaction. Each value represents the mean ± standard deviation (n = 3). **p < 0.01 vs. N group. ## p < 0.01 vs. H/R group.

In order to further understand the effect of propofol on downstream molecules in the TLR4 signal pathway, Western blotting was used. The results indicated that the protein expressions of MyD88, p‐IκB‐α and NF‐κB p65 in the nucleus were significantly increased in the H/R and F groups in comparison with the N group (p < 0.05). Meanwhile, propofol preconditioning decreased the expressions of these proteins; IκB‐α demonstrated an inverse profile compared to both p‐IκB‐α and NF‐κB p65 in the nucleus, with propofol increasing IκB‐α levels (p < 0.01) (Fig. 5).

Figure 5.

Figure 5

Effects of propofol preconditioning on the protein expression of MyD88, IκB‐α, p‐ IκB‐α and NF‐κB p65 in the nucleus of GES‐1 cells under H/R conditions. The expression of β‐actin was measured as an internal standard. (A) MyD88; (B) IκB‐α; (C) p‐IκB‐α; and (D) NF‐κB p65 in the nucleus. Each value represents the mean ± standard deviation (n = 6). *p < 0.05. ** p < 0.01 vs. N group. # p < 0.05. ## p < 0.01 vs. H/R group.

Effects of propofol on the MDA contents and SOD activities of GES‐1 cells under H/R conditions

Finally, to determine whether propofol attenuated GES‐1 cell injury following H/R related to the production of oxygen free radicals, we measured the MDA contents and SOD activities of GES‐1 cells. MDA contents were significantly elevated in the H/R and F groups in comparison with the N group (p < 0.01). Pretreatment with propofol significantly decreased the MDA contents (p < 0.01) (Fig. 6A) and increased the enzymatic activities of SOD of in comparison with the H/R group (p < 0.05) (Fig. 6B).

Figure 6.

Figure 6

Effects of propofol preconditioning on GES‐1 cells' (A) malondialdehyde (MDA) contents and (B) superoxide dismutase (SOD) under H/R conditions. Each value represents the mean ± standard deviation (n = 6). *p < 0.05. **p < 0.01 vs. N group. # p < 0.05. ## p < 0.01 vs. H/R group.

Discussion

In the present study, H/R injury in GES‐1 cells led to a reduction in cell viability, an increase cell apoptosis, an increase in MDA content and a decrease in SOD activity. H/R injury in GES‐1 cells not only increased TLR4 expression but also increased MyD88, p‐IκB‐α and nucleus NF‐κB p65 expression, while it decreased IκB‐α expression. Furthermore, propofol preconditioning enhanced cell viability, decreased cell apoptosis, inhibited TLR4 signal pathway activation, reduced MDA contents, and made SOD activities recovered to normal levels gradually.

One important finding in the study was that the TLR4 signal could be activated in GES‐1 cells under H/R injury through a MyD88‐dependent pathway. et al. [20] reported that TLR4 played a critical role in heart I/RI. MyD88, which is one of the TLR4 adaptor molecules, has been reported to be expressed throughout the gut [21], and was sequentially recruited when a TLR4‐mediated signal occurred [22]. Li et al. [23] reported that TLR4 mediated the proximal tubule epithelial cell H/R injury mainly via a MyD88 dependent‐pathway, underlining the important role of MyD88‐dependent mechanisms in renal tubular I/RI. However, whether TLR4 is involved in H/R injury in GES‐1 cells is unclear. In our study, the expression of TLR4 and MyD88 was increased under H/R conditions. EGCG, an inhibitor of TLR4, enhanced cell viability under H/R conditions. These data suggest that the TLR4 signal may be involved in GES‐1 cell injury induced by H/R via the MyD88‐dependent pathway.

In various cell types, NF‐κB exists constitutively in a latent, inactive form in the cell cytosol. A lot of stress could induce the phosphorylation of IκB‐α, followed by the ubiquitination and degradation of IκB‐α [24] and induce NF‐κB transfer into the nucleus [25]. TLR4 activation is a premise for TLR4‐mediated NF‐κB activation via the MyD88‐dependent pathway. A study has reported that NF‐κB plays an important role in the gastric I/RI of the Sprague Dawley rat [26]. Our study indicated that TLR4 downstream molecules were involved in GES‐1 cell H/R injury, with an increase of the protein expression of NF‐κB p65 and p‐IκB‐α in the nucleus and a decrease of IκB‐α expression, confirming our supposition that TLR4 signaling may be involved in H/R injury in GES‐1 cells via the MyD88‐dependent pathway.

Is there an interaction between oxidative stress and the TLR4 signal? It has been well established that the generation of reactive oxygen species by Kupffer cells directly increases the activity of NF‐κB and then facilitates nuclear translocation [27]. Furthermore, a pattern recognition receptor located on Kupffer cells is required to activate transcriptional elements, including NF‐κB. The activated NF‐κB then induces the release of kinds of proinflammatory cytokines, and these cytokines induce the feedback activation of TLR4 resulting in the infiltration of neutrophils and injury [28]. The oxidation–reduction system may therefore be involved in the activation of the TLR4 signal as follows: reactive oxygen species promoted the activation of the TLR4 signal, while SOD inhibited the activation of the TLR4 signal through NF‐κB. The data in our study also indicate that MDA, as a sign of lipid peroxidation, was increased under H/R conditions, while SOD activity decreased.

Although many studies have focused on H/R injury in cells, an agent that could effectively protect against the cell injury remains unclear. According to a review on the protective effects of propofol on organ I/RI, the key factors for the effects include the preservation of ATP levels and remission the oxidative stress‐induced inflammatory injury [29]. It has been documented that propofol has anti‐inflammatory effects against lipopolysaccharide (LPS)‐induced alveolar type II epithelial cell injury by down‐regulating the protein expression of TLR4 [30]. Moreover, propofol may inhibit the phosphorylation and degradation of IκB‐α, resulting in NF‐κB inactivation in hepatocytes [31]. Placing our work within the context of these findings, we found that propofol 50 μmol/L significantly promoted GES‐1 cell viability under hypoxia 1.5 hours/reoxygenation 2 hours. While studies have reported that blood concentration of propofol is 5–30 μmol/L [32] in clinics. Inappropriate treatment with propofol can lead to propofol infusion syndrome [[33], [34]], so the effect of propofol on gastric I/RI in vivo is of particular interest.

Pretreatment with propofol could decrease the percentage of apoptotic cells in the study. Bcl‐2, a kind of anti‐apoptotic protein, can inhibit the apoptotic process via direct interaction with proapoptotic proteins (Bax/Bak) [35]. The results in our study showed the increased ratio of Bax/Bcl‐2 expression under propofol preconditioning, suggesting that preconditioning with propofol might inhibit cell apoptosis as well.

We also observed that the protective and antiapoptotic effects of propofol correlated with decreased protein levels of key components in the TLR4 pathway, including TLR4, MyD88, and NF‐κB. These results support the idea that propofol inhibits H/R‐induced injury in GES‐1 cells by suppressing the TLR4 signal.

Because of the antioxidative effect of propofol, preconditioning with this drug decreased the MDA content and enhanced SOD activity in GES‐1 cells under H/R injury. The relationship between the TLR4 signal and SOD activity, elaborated above, means that all of the results in our study indicate that propofol may exert a protective effect against H/R injury in GES‐1 cells by directly and indirectly suppressing TLR4 signal.

Fat emulsion, a kind of solvent of propofol, was used clinically as a kind of nutritional support. Dogan et al. [36] reported that propofol exerted a protective effect against renal I/RI that was irrelevant to fat emulsion. Our study indicates that fat emulsion does not affect the GES‐1 cell injury under H/R, which further confirms our hypothesis that propofol may exert a protective effect against H/R injury in GES‐1 cell by suppressing the TLR4 signal.

Conclusion

Our study confirmed that propofol exerted a protective effect against GES‐1 cell injury induced by H/R in vitro, accompanied by decreased GES‐1 cell apoptosis and increased cell viability. Consequently, the administration of propofol may clinically benefit patients subjected to gastric I/RI. Moreover, these data also indicate that the TLR4 signal pathway may be a potential therapeutic target in gastric mucosal I/RI in vivo. However, this study is restricted to human gastric epithelial cells in vitro under H/R and further studies are needed to elaborate the feasibility and efficacy of propofol in a clinical setting.

Acknowledgments

This project was supported by grants from the National Natural Science of China (81171041), the Natural Science foundation of Jiangsu Province (BK2011197), the Social Development Science and Technology Project of Xuzhou City (xzzd1051), the University Graduate Student Science and Technology Innovation Project of Jiangsu Province (cxzz110752) and a project funded by the Priority Academic Program Development of Jiangsu Higher Education Institutions of Jiangsu Province.

References

  • [1]. Yao Y.M., Redl H., Bahrami S., Schlag G.. The inflammatory basis of trauma/shock‐ associated multiple organ failure. Inflamm Res. 1998; 47: 201–210. [DOI] [PubMed] [Google Scholar]
  • [2]. Liu M.J., Fei S.J., Qiao W.L., Du D.S., Zhang Y.M., Li Y., et al. The protective effect of 17β‐estradiol postconditioning against hypoxia/reoxygenation injury in human gastric epithelial cells. Eur J Pharmacol. 2010; 645 (1–3): 151–157. [DOI] [PubMed] [Google Scholar]
  • [3]. Cabeza J., Motilva V., Martín M.J., de la Lastra C.A.. Mechanisms involved in gastric protection of melatonin against oxidant stress by ischemia–reperfusion in rats. Life Sci. 2001; 68: 1405–1415. [DOI] [PubMed] [Google Scholar]
  • [4]. Wang Y., Zhang M.X., Meng X., Liu F.Q., Yu G.S., Zhang C., et al. Atorvastatin suppresses LPS‐induced rapid upregulation of Toll‐like receptor 4 and its signaling pathway in endothelial cells. Am J Physiol Heart Circ Physiol. 2011; 300: 1743–1752. [DOI] [PubMed] [Google Scholar]
  • [5]. Zhang Z., Li W., Sun D., Zhao L., Zhang R., Wang Y., et al. Toll‐like receptor 4 signaling in dysfunction of cardiac microvascular endothelial cells under hypoxia/reoxygenation. Inflamm Res. 2011; 60: 37–45. [DOI] [PubMed] [Google Scholar]
  • [6]. Thompson J.E., Phillips R.J., Erdjument‐Bromage H., Tempst P., Ghosh S.. I kappa B‐beta regulates the persistent response in a biphasic activation of NF‐kappa B. Cell. 1995; 80: 573–582. [DOI] [PubMed] [Google Scholar]
  • [7]. Ohara T., Kanoh Y., Yoshino K., Kitajima M.. Effects of lansoprazole on the lipopolysaccharide–stimulated toll‐like receptor 4 signal transduction systems: a study using the 293 hTLR4/MD2‐CD14 Cells. J Clin Biochem Nutr. 2009; 45: 241–247. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [8]. Kaczorowski D.J., Nakao A., Mollen K.P., Vallabhaneni R., Sugimoto R., Kohmoto J., et al. Toll‐like receptor 4 mediates the early inflammatory response after cold ischemia/reperfusion. Transplantation. 2007; 84: 1279–1287. [DOI] [PubMed] [Google Scholar]
  • [9]. Chao W.. Toll‐like receptor signaling: a critical modulator of cell survival and ischemic injury in the heart. Am J Physiol Heart Circ Physiol. 2009; 296: 1–12. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [10]. Zhai Y., Qiao B., Shen X.D., Gao F., Busuttil R.W., Cheng G., et al. Evidence for the pivotal role of endogenous Toll‐ like receptor 4 ligands in liver ischemia and reperfusion injury. Transplantation. 2008; 85: 1016. [DOI] [PubMed] [Google Scholar]
  • [11]. Kuang X., Huang Y., Gu H.F., Zu X.Y., Zou W.Y., Song Z.B., et al. Effects of intrathecal epigallocatechin gallate, an inhibitor of Toll‐like receptor 4, on chronic neuropathic pain in rats. Eur J Pharmacol. 2012; 676: 51–56. [DOI] [PubMed] [Google Scholar]
  • [12]. Jawan B., Kao Y.H., Goto S., Pan M.C., Lin Y.C., Hsu L.W., et al. Propofol pretreatment attenuates LPS‐induced granulocyte–macrophage colony‐ stimulating factor production in cultured hepatocytes by suppressing MAPK/ERK activity and NF‐κB translocation. Toxicol Appl Pharmacol. 2008; 229: 362–373. [DOI] [PubMed] [Google Scholar]
  • [13]. Kokita N., Hara A., Abiko Y., Arakawa J., Hashizume H., Namiki A.. Propofol improves functional and metabolic recovery in ischemic reperfused isolated rat hearts. Anesth Analg. 1998; 86: 252–258. [DOI] [PubMed] [Google Scholar]
  • [14]. Javadov S.A., Lim K.H., Kerr P.M., Suleiman M.S., Angelini G.D., Halestrap A.P.. Protection of hearts from reperfusion injury by propofol is associated with inhibition of the mitochondrial permeability transition. Cardiovasc Res. 2000; 45: 360–369. [DOI] [PubMed] [Google Scholar]
  • [15]. De La Cruz J.P., Villalobos M.A., Sedeño G., Sánchez De La Cuesta F.. Effect of propofol on oxidative stress in an in vitro model of anoxia‐reoxygenation in the rat brain. Brain Res. 1998; 800: 136–144. [DOI] [PubMed] [Google Scholar]
  • [16]. Yamaguchi S., Hamaguchi S., Mishio M., Okuda Y., Kitajima T.. Propofol prevents lipid peroxidation following transient forebrain ischemia in gerbils. Can J Anaesth. 2000; 47: 1025–1030. [DOI] [PubMed] [Google Scholar]
  • [17]. Hong J., Yi S.X., Huang Y., Lin Y.P., Du Y., Peng H., et al. Effect of plasma of healthy subjects undergoing moxibustion on ethanol‐injured human gastric epithelial GES‐1 cells in vitro and the involved mitochondrial apoptosis pathway. Zhen Ci Yan Jiu. 2011; 36: 157–163. [PubMed] [Google Scholar]
  • [18]. Ma J., Dong Z., Li Q.G., Wang J.R.. Protective effect of propofol against intracerebral hemorrhage injury in rats. Yao Xue Xue Bao. 2009; 44: 344–349. [PubMed] [Google Scholar]
  • [19]. Ozkan F., Senayli Y., Ozyurt H., Erkorkmaz U., Bostan B.. Antioxidant effects of propofol on tourniquet‐induced ischemia‐reperfusion injury: an experimental study. J Surg Res. 2012; 176: 601–607. [DOI] [PubMed] [Google Scholar]
  • [20]. Li Y., Si R., Feng Y., Chen H.H., Zou L., Wang E., et al. Myocardial ischemia activates an injurious innate immune signaling via cardiac heat shock protein 60 and Toll‐like receptor 4. J Biol Chem. 2011; 286: 31308–31319. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [21]. Ortega‐Cava C.F., Ishihara S., Rumi M.A., Kawashima K., Ishimura N., Kazumori H., et al. Strategic compartmentalization of Toll‐like receptor 4 in the mouse gut. J Immunol. 2003; 170: 3977–3985. [DOI] [PubMed] [Google Scholar]
  • [22]. Noman A.S., Koide N., Hassan F., I‐E‐Khuda I., Dagvadorj J., Tumurkhuu G., et al. Thalidomide inhibits lipopolysaccharide‐induced tumor necrosis factor‐alpha production via down‐regulation of MyD88 expression. Innate Immun. 2009; 15: 33–41. [DOI] [PubMed] [Google Scholar]
  • [23]. Li M., Khan A.M., Maderdrut J.L., Simon E.E., Batuman V.. The effect of PACAP38on MyD88‐mediated signal transduction in ischemia/hypoxia‐induced acute kidney injury. Am J Nephrol. 2010; 32: 522–532. [DOI] [PubMed] [Google Scholar]
  • [24]. Takeda K., Akira S.. Toll‐like receptors in innate immunity. Int Immunol. 2005; 17: 1–14. [DOI] [PubMed] [Google Scholar]
  • [25]. Nakamoto K., Wada K., Kitano M., Kishimoto Y., Ashida K., Kamisaki Y., et al. The role of endogenous acid in the development of acute gastric ulcer induced by ischemia‐reperfusion in the rat. Life Sci. 1998; 62: 63–69. [DOI] [PubMed] [Google Scholar]
  • [26]. Zhang Y.M., Wei E.Q., Hu X., Qiao W.L., Shi Y., Xu M., et al. The role of nuclear factor‐kappaB in the effect of angiotensin II in the paraventricular nucleus in protecting the gastric mucosa from ischemia‐reperfusion injury in rats. J Gastroenterol. 2008; 4: 687–698. [DOI] [PubMed] [Google Scholar]
  • [27]. Yao Xiao‐min, Chen Hui, Li Yan. Protective effect of bicyclol on liver injury induced by hepatic warm ischemia/reperfusion in rats. Hepatol Res. 2009; 39: 833–842. [DOI] [PubMed] [Google Scholar]
  • [28]. Maloney E., Sweet I.R., Hockenbery D.M., Pham M., Rizzo N.O., Tateya S., et al. Activation of NF‐kB by palmitate in endothelial cells: a key role for NADPH oxidase‐derived superoxide in response to TLR4 activation. Arterioscler Thromb Vasc Biol. 2009; 29: 1370–1375. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • [29]. Ross S., Foex P.. Protective effects of anaesthetics in reversible and irreversible ischaemia‐reperfusion injury. Br J Anaesth. 1999; 82: 622–632. [DOI] [PubMed] [Google Scholar]
  • [30]. Ma L., Wu X., Chen W., Fujino Y.. Propofol has anti‐inflammatory effects on alveolar type II epithelial cells. Acta Anaesthesiol Scand. 2010; 54: 362–369. [DOI] [PubMed] [Google Scholar]
  • [31]. Brasil L.J., San‐Miguel B., Kretzmann N.A., Amaral J.L., Zettler C.G., Marroni N., et al. Halothane induces oxidative stress and NF‐kappaB activation in rat liver: protective effect of propofol. Toxicology. 2006; 227: 53–61. [DOI] [PubMed] [Google Scholar]
  • [32]. Gepts E., Camu F., Cockshott I.D., Douglas E.J.. Disposition of propofol administered as constant rate intravenous infusions in humans. Anesth Analg. 1987; 66: 1256–1263. [PubMed] [Google Scholar]
  • [33]. Vasile B., Rasulo F., Candiani A., Latronico N.. The pathophysiology of Propofol infusion syndrome: a simple name for a complex syndrome. Intensive Care Med. 2003; 29: 1417–1425. [DOI] [PubMed] [Google Scholar]
  • [34]. Fudickar A., Bein B.. Propofol infusion syndrome: update of clinical manifestation and pathophysiology. Minerva Anestesiol. 2009; 75: 339–344. [PubMed] [Google Scholar]
  • [35]. Noh H.S., Shin I.W., Ha J.H., Hah Y.S., Baek S.M., Kim D.R.. Propofol protects the autophagic cell death induced by the ischemia/reperfusion injury in rats. Mol Cells. 2010; 30: 455–460. [DOI] [PubMed] [Google Scholar]
  • [36]. Dogan Z., Yuzbasioglu M.F., Kurutas E.B., Yildiz H., Coskuner I., Senoglu N., et al. Thiopental improves renal ischemia‐reperfusion injury. Ren Fail. 2010; 32: 391–395. [DOI] [PubMed] [Google Scholar]

Articles from The Kaohsiung Journal of Medical Sciences are provided here courtesy of Kaohsiung Medical University and John Wiley & Sons Australia, Ltd

RESOURCES