Skip to main content
Springer logoLink to Springer
. 2025 Mar 19;184(4):260. doi: 10.1007/s00431-025-06089-6

The MNK-SYNGAP1 axis in specific learning disorder: gene expression pattern and new perspectives

Cansu Mercan Isik 1,✉, Elif Burcu Tuzemen Bayyurt 2, Nil Ozbilum Sahin 3
PMCID: PMC11922980  PMID: 40108041

Abstract

Specific learning disorder (SLD) is a neurodevelopmental disorder that significantly affects children’s academic performance. This study aimed to investigate the expression levels of the MAP Kinase Interacting Serine/Threonine Kinase 1–2 (MNK1, MNK2), Synaptic Ras GTPase Activating Protein 1 (SYNGAP1) genes, and the long non-coding RNA Synaptic Ras GTPase Activating Protein 1-Anti Sense1 (SYNGAP1-AS1), which are believed to play a key role in neurodevelopmental pathways, in children with SLD. Understanding the role of these genes in synaptic plasticity and cognitive function may provide insights into the molecular mechanisms underlying SLD. This study included 38 children diagnosed with SLD and 35 healthy controls aged 6 to 16. RNA was isolated from blood samples, and gene expression levels were measured using quantitative polymerase chain reaction (qPCR). The statistical analysis was conducted to compare the expression levels between the SLD and control groups and within SLD subgroups based on severity and sex. MNK1 and SYNGAP1 expression levels were significantly upregulated in the SLD group compared to the control group (8.33-fold and 16.52-fold increase, respectively; p < 0.001). lncSYNGAP1-AS1 showed a 26.58-fold increase, while MNK2 was downregulated by 2.2-fold, although these changes were not statistically significant. No significant differences were observed between sexes or between the severity subgroups of SLD.

Conclusion: he upregulation of MNK1 and SYNGAP1 in children with SLD suggests their involvement in the neurodevelopmental pathways associated with cognitive processes such as learning and memory. These findings provide a foundation for future research into the molecular basis and potential therapeutic targets of SLD.

What is known:

• SYNGAP1 is a key regulator of synaptic plasticity and learning, primarily functioning through Ras signaling inhibition. Its deficiency impairs long-term potentiation (LTP) and is associated with neurodevelopmental disorders (NDDs) such as autism spectrum disorder (ASD) and intellectual disability.

• The MAPK/ERK pathway plays a crucial role in learning and memory, and its dysregulation has been linked to several neurological conditions. MNK1/2 interacts with SYNGAP1 in synaptic signaling.

What is new:

• This study is the first to demonstrate significant upregulation of SYNGAP1 and MKNK1 in children with SLD.

• Understanding the role of the MKNK-SYNGAP1 axis may guide the development of targeted therapies aimed at enhancing synaptic plasticity to improve learning and memory outcomes in children with SLD.

Keywords: SLD, MNK1, SYNGAP1, Gene expression, QPCR

Introduction

Neurodevelopmental disorders (NDDs) are a diverse group of psychiatric conditions marked by early-onset abnormalities in brain and central nervous system development. These include intellectual disability, attention deficit/hyperactivity disorder, specific learning disorder (SLD), and autism spectrum disorder [1]. SLD is characterized by significant difficulties in learning and using academic skills, such as reading, writing, and math, which are below expectations for a person’s age and education. According to the Diagnostic and Statistical Manual of Mental Disorders-5 (DSM-5), SLD affects 5–15% of school-aged children and 4% of adults. While the exact causes of SLD remain unclear, genetic factors, central nervous system dysfunctions, and information processing issues (e.g., input, integration, and memory problems) are considered key contributors [2].

Synaptic plasticity is a fundamental mechanism for learning and memory formation. The formation of new memories requires both structural and functional remodeling of synapses [3]. The long-term increase or decrease of synaptic strengthening, known as long-term potentiation (LTP) or long-term depression (LTD), forms the cellular basis of memory formation [4]. These processes occur by triggering neuronal activation, modification of molecules, and new protein synthesis through intracellular signaling pathways [5]. Researches have revealed that epigenetic regulation plays a critical role in synaptic plasticity and memory [3, 6–10].

The Synaptic Ras GTPase-Activating Protein 1 (SYNGAP-1) gene, which is particularly important for learning and memory plays a complex role in neurodevelopment and ongoing neurological function [11, 12]. SYNGAP encodes a GTPase-activating protein that is selectively expressed in the brain and plays critical roles in neuronal function and brain development by regulating biochemical signaling in neurons. SYNGAP is a negative regulator of small GTPases such as Ras and Rap and is required for synaptic development, structure, function, and plasticity. SYNGAP is expressed by the frontal cortex and is found at particularly high levels in the hippocampus [11]. Mutations in SYNGAP1, which encodes the SYNGAP protein, have been identified in patients with intellectual disability, autism spectrum disorder (ASD), severe epilepsy, and schizophrenia [13]. Long non-coding RNAs (lncRNAs) constitute a large and diverse group of non-protein coding RNAs, defined as transcripts consisting of more than 200 nucleotides. LncRNAs regulate gene expression through various mechanisms, including transcriptional interference, chromatin remodeling, interaction with antisense transcripts, generation of small RNAs, binding to specific proteins to modulate their activity, participating RNA–protein complexes, and influencing protein localization within the cell [14]. Specifically, lncSYNGAP1-AS1, an antisense lncRNA transcribed from the SYNGAP1 gene, may regulate SYNGAP1 expression through epigenetic mechanisms, thereby affecting neuronal function and synaptic plasticity. MKNK1 encodes serine/threonine kinase 1 (MNK1), a key regulator of protein synthesis and synaptic function, which is activated by ERK in the extracellular signal-regulated MAPK pathway. MNK1 is the predominant MNK isoform in the brain [15]. MNK1 phosphorylates the eukaryotic initiation factor eIF4E and regulates translation initiation, thereby enhancing protein synthesis at synaptic sites to support the long-term synaptic changes required for memory formation [16]. SYNGAP reduces redundant (noise) signals by suppressing Ras-ERK signaling at rest. During synaptic activation (learning), SYNGAP is phosphorylated and inhibited, leading to an increased signal [17]. The relationship among SYNGAP1, SYNGAP1-AS1, and MNK1 is illustrated in Fig. 1.

Fig. 1.

Fig. 1

A schematic diagram illustrating the MKNK-SYNGAP1 Axis and its associated proteins/elements. SYNGAP reduces redundant (noise) signals by suppressing Ras-ERK signaling at rest. During synaptic activation (learning), SYNGAP is phosphorylated and suppressed, effectively increasing this signal

Changes in gene expression are widely studied to characterize various diseases and are used to understand molecular and cellular processes in complex diseases [18]. In many countries, the number of children diagnosed with neurodevelopmental disorders has been reported to increase by approximately 10,000 cases annually [19]. However, this increase is unlikely to be solely the result of genetic factors, as there is no reason to suspect that mutation rates have increased significantly in recent years. Instead, a more likely explanation is that epigenetic processes contribute to this trend [20]. In addition, molecular evidence is gaining important for objective diagnosis and effective treatment. Gene expression is critical for identifying potential biomarkers for neurodevelopmental disorders and elucidating their etiology [21].

For these reasons, our study aims to examine the expression levels of MNK1, MNK2, and SYNGAP1 genes, which are strongly implicated in neurodevelopmental disorders, as well as SYNGAP1-AS, a related lncRNA, in children with SLD. To the best of our knowledge, there is no such study in the literature.

Material and methods

Participants and sample collection

This study was conducted in collaboration with the Departments of Child Psychiatry, Medical Biology, and Molecular Biology and Genetics at Sivas Cumhuriyet University Faculty of Medicine. The initial ethical approval for participant recruitment and blood collection was granted by the Clinical Research Ethics Committee of Sivas Cumhuriyet University on 28 March 2023 (Decision No: 2023-03/10). A subsequent approval from the Non-Interventional Clinical Research Ethics Committee of Sivas Cumhuriyet University on 21 December 2023 (Decision No: 2023-12/53) permitted the use of the same blood samples for the present study.

G*Power (3.1) program was used for power calculation. The sample size was determined by the Biostatistics Department, with a test power calculation of p = 0.90718 (α = 0.05, β = 0.10, and (1-β) = 0.90), resulting in the inclusion of 73 participants: 38 children diagnosed with specific learning disorder (SLD) and 35 healthy controls. The severity and diagnosis of specific learning disorder (SLD) were made clinically using DSM-5 diagnostic criteria, taking into account factors such as the degree of impairment in the individual’s academic skills (by applying reading, writing, and math tests), its impact on daily life, and response to intervention [2]. Children with SLD exhibited combined symptoms of dyslexia, dysgraphia, and dyscalculia.

Inclusion criteria

  • Children aged 6–16 diagnosed with pure SLD

  • No history of special education

  • Matched control group based on age, gender, IQ, and socio-cultural factors

Exclusion criteria

  • Presence of other psychiatric disorders

  • Chronic medical conditions, auditory or visual impairments, or current medication use for treatments

  • Comorbid Autism Spectrum Disorder (ASD) or ADHD (based on Conners’ Parent Rating Scale-Revised Short Form (CPRS-RS) and DSM-5 criteria)

  • Severe intellectual disability, psychosocial deprivation, or inadequate education

  • All participants and their legal guardians provided written and verbal informed consent, and the study adhered to the principles of the Declaration of Helsinki.

Blood sample collection and RNA isolation

Blood samples were collected in RNA Stabilizer Tubes (NucleoGene, NG20200803, Turkey/Istanbul) to preserve RNA integrity at room temperature. Samples were stored at − 20 °C until RNA isolation was performed in the Medical Biology Department. Total RNA was extracted using the Hybrid-R RNA isolation kit (GeneAll, Cat. No.: 305–101, South Korea) following the manufacturer’s protocol.

Neuropsychological and clinical assessments

A sociodemographic data form was used to collect participant details. Psychiatric evaluations were conducted using the Turkish version of the Schedule for Affective Disorders and Schizophrenia for School-Age Children-Present and Lifetime (K-SADS-PL) [22, 23]. The Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV) was administered to assess cognitive abilities [24]. Additionally, the revised short form of CPRS-RS was used to rule out ADHD, which could coexist with SLD [25]. Each child completed assessments including reading, writing, and mathematics tests to evaluate these academic skills in detail. Additionally, the clock-drawing and right-left discrimination tests were administered to measure visual perception and hand–eye coordination and to determine the specific SLD subgroup [26].

Quantitative polymerase chain reaction (qPCR)

Complementary DNA (cDNA) was synthesized using the ABT cDNA synthesis kit (Cat: C03-01–20, Lot: W4F0123-C5, Turkey/Ankara) in a thermal cycler (TECHNE, TC-5000, Maryland/US). RNA concentrations were equalized before synthesis using nuclease-free water. QPCR (LightCycler 96, Roche, Switzerland) was conducted using validated primers for MNK1, MNK2, SYNGAP1, and SYNGAP1-AS1, with GAPDH as the endogenous control for normalization. SYBR Green dye (ABT, Cat: Q03-01–05, Lot: W2C0223-Q9, Turkey/Ankara) was used for fluorescence-based detection. Primer sequences are provided in Table 1.

Table 1.

Primer sequences in the study

Oligo name Sequence 5′−3′
MKNK1-f CGAGAGGTGGAGACGCTGTA
MKNK1-r TGGTTGGTATGGGGGTA
MKNK2-f TTTTCAGGGTAGGTGGAGATG
MKNK2-r GGTGGAGTAGGGGAGCAGT
SYNGAP1-f CTGCCTCCATCTTTCATAGC
SYNGAP1-r TGGCTGAGACTTGCCCTCTT
SYNGAP1-AS1-f CTCACCTGCGAATGGATGC
SYNGAP1-AS1-r AACAAACGCAGCAAATCCTGA

f forward, r reverse

Statistical analysis

Statistical analyses were performed using SPSS 23.0. Data normality was assessed with using the Kolmogorov–Smirnov test. Since the data met parametric assumptions, an independent samples t-test was used for group comparisons, while the chi-square test was applied for categorical variables. The significance level was set at 0.05. Quantification of gene expression changes was conducted using the 2^ − ΔΔCt method [27]. Data processing was performed using the GeneGlobe Data Analysis Center (https://geneglobe.qiagen.com/us/analyze). Fold change (FC) values for MNK1, MNK2, SYNGAP1, and lncSYNGAP1-AS1 expression were calculated relative to the control group, normalized to a reference gene. FC > 1 indicates upregulation, FC < 1 indicates downregulation, and FC = 1 shows no change. Statistical significance (p < 0.05) was determined using Student’s t-test. Figures were generated with GraphPad Prism (version 10.0.0 GraphPad Software, Boston, MA, USA) and BioRender.

Results

Clinical characteristics and demographic variables of the participants

A total of 38 children with SLD and 35 controls were included in the study. No significant differences were observed between the groups regarding age, sex, place of residence, family income level, parental education level, maternal pregnancy history, gestational age at birth, mode of delivery, delivery complications, or parental psychiatric history (p ≥ 0.05 for all). Data were homogeneously distributed in both groups. The mean clinical characteristics and demographic variables of the participants are presented in Table 2.

Table 2.

Socio-demographic and clinical characteristics of participants

Variables Control
N = 35
SLD
N = 38
p
Sex (n, %)
Male 18 23 0.434
51.4% 60.53%
Female 17 15
48.6% 39.47%
Age (mean-years ± SD) 10.34 ± 2.6 10.26 ± 2.6 0.892a
Severity (n, %)
Severe 21
55.3%
Mild 17
44.8%
Living (n, %)
Province 29 29 0.237
82.86% 76.32%
District 6 6
17.14% 15.79%
Village 0 3
0.0% 7.89%
Mental illness in sibling (n, %)
No 32 29 0.082
91.43% 76.32%
Yes 3 9
8.57% 23.68%
Family structure (n, %)
Core 31 29 0.306
88.58% 76.32%
Large 2 4
5.71% 10.53%
Parents divorced 0 3
0.0% 7.89%
At least one of the parents is deceased 2 2
5.71% 5.26%
Socioeconomic level*(n, %)
Low 2 8 0.119
5.71% 21.05%
Middle 9 11
25.71% 28.95%
High 24 19
68.58% 50%
Disease during pregnancy (n, %)
No 34 36 0.605
97.14% 94.74%
Yes 1 2
2.86% 5.26%
34 36
Drug use during pregnancy (n, %)
No 35 36 0.169
100% 94.74%
Yes 0 2
0.0% 5.26%
Smoking during pregnancy (n, %)
No 26 33 0.173
74.29% 86.84%
Yes 9 5
25.71% 13.16%
Type of birth (n, %)
Normal vaginal birth 28 30 0.911
80.00% 78.95%
C/S 7 8
20.00% 21.05%
Time of birth (n, %)
Early 2 8 0.086
5.71% 21.05%
Mid 32 27
91.43% 71.05%
Late 1 3
2.86% 7.9%
Birth weight (n, %)
Under 2500 g 2 5 0.501
5.71% 13.16%
Between 2500 and 4000 g 31 30
88.58% 78.95%
Over 4000 g 2 3
5.71% 7.89%
Birth complications (n, %)
No 32 32 0.349
91.43% 84.21%
Yes 3 6
8.57% 15.79%
32 32
Receiving incubator care (n, %)
No 32 29 0.082
91.43% 76.31%
Yes 3 9
8.57% 23.68%
Mental illness in mother (n, %)
No 28 32 0.639
80.00% 84.21%
Yes 7 6
20.00% 15.79%
Mental illness in father (n, %)
No 30 31 0.634
85.71% 81.58%
Yes 5 7
14.29% 18.42%

SLD specific learning disorder, SD standard deviation

aIndependent t-test, χ2 test, and Fisher’s exact test were performed on categorical variables, Statistical significance: p ≤ 0.05

*The level of income was determined by the minimum wage value on the date of the study for the workers in our country

Results of qPCR analyses

Control vs. SLD

Comparison of gene expression levels between children with SLD and controls revealed statistically significant differences for MNK1 and SYNGAP1 expression (Fig. 2 and Table 3). MNK1 expression was 8.33-fold higher in children with SLD compared to controls (p < 0.001). SYNGAP1 expression was 16.52-fold higher in the SLD group (p < 0.05). lncSYNGAP1-AS1 expression was 26.58-fold higher, while MNK2 expression was 2.2-fold lower in children with SLD compared to controls; however, these differences were not statistically significant.

Fig. 2.

Fig. 2

Fold changes and fold regulations resulting from genes expression in groups. SLD, specific learning disorder; FC, fold change; FR, fold regulation. (a, b) p ≤ 0.001 compared to controls. (c, d) p ≤ 0.05 compared to controls. SLD (n = 38), controls (n = 35)

Table 3.

Fold changes and fold regulations resulting from genes expression in groups

Group comparison Gene FC FR p value
SLD (n = 38) vs. control (n = 35)
MKNK-1 8.33 8.33, upregulated  < 0.001*
MKNK-2 0.45  − 2.20, downregulated 0.29
SYNGAP-1 16.52 16.52, upregulated 0.02*
SYNGAP1-AS-1 26.58 26.58, upregulated 0.207
Severe (n = 21) vs. mild (n = 17)
MKNK-1 1.95 1.95, upregulated 0.22
MKNK-2 1.22 1.22, upregulated 0.46
SYNGAP-1 1.58 1.58, upregulated 0.49
SYNGAP1-AS-1 2.42 2.42, upregulated 0.52
Male (n = 23) vs. female (n = 15)
MKNK-1 0.58  − 1.74, downregulated 0.06
MKNK-2 1.60 1.60, upregulated 0.76
SYNGAP-1 0.29  − 3.40, downregulated 0.86
SYNGAP1-AS-1 1.04 1.04, upregulated 0.27

p value was calculated according to Student’s t-test for each gene examined in comparison of all groups.*p ≤ 0.05

SLD specific learning disorder, FC fold change, FR fold regulation

Non-severe vs. mild

When we compared the severe and mild groups of children with SLD according to disease severity, there was no significant difference between the groups in MNK-1, MNK-2, SYNGAP-1, and lncSYNGAP1-AS1 gene expression (Fig. 3 and Table 3).

Fig. 3.

Fig. 3

Comparison of fold change and fold regulation values between disease severity in the SLD group. The columns show the increases and decreases in the severe disease group compared to the mild disease group. There was no statistical difference between genders in FC and FR values of genes. FC, fold change; FR, fold regulation. p ≤ 0.05. Severe (n = 21), mild (n = 17)

Male vs. female

When we evaluated the gene expression of these genes according to gender in the SLD group, there was no significant difference between MKNK-1, MKNK-2, SYNGAP-1, and lncSYNGAP1-AS1 gene expression (Fig. 4 and Table 3).

Fig. 4.

Fig. 4

Comparison of fold change and fold regulation values between genders in the SLD group. The columns show the increases and decreases in male gender compared to female gender. There was no statistical difference between genders in FC and FR values of genes. FC, fold change; FR, fold regulation. p ≤ 0.05. Male (n = 23), female (n = 17)

Heatmap with hierarchical clustering, representing the expression levels of genes

A heatmap with hierarchical clustering was generated to visualize the expression patterns of MNK1, MNK2, SYNGAP1, and lncSYNGAP1-AS1 in control and SLD samples (Fig. 5). The color gradient represents relative gene expression levels: Green indicates low expression, black represents average expression, and red denotes high expression. Genes that are upregulated appear in red, while downregulated genes are shown in green, relative to the average baseline. Children with SLD exhibited upregulated expression of MNK1, SYNGAP1, and lncSYNGAP1-AS1 compared to controls, whereas MNK2 expression was lower.

Fig. 5.

Fig. 5

a Heatmap showing the expression levels of MKNK1, MKNK2, SYNGAP1, and SYNGAP1-AS1 genes in samples from control and SLD children. b Heatmap showing the expression levels of genes across the severity of SLD. c Heatmap showing the expression levels of genes across sexes in the SLD group. The color scale, ranging from green to red, reflects the gene expression levels from low to high

Discussion

Our results in our study investigating the expression of SYNGAP1, lncSYNGAP1-AS1, and MNK1-2 in children with SLD are in line with recent discoveries regarding the role of these genes in cognitive and synaptic plasticity pathways. The upregulation of these genes in our study may provide a foundation for investigating their influence neurodevelopmental disorders, suggesting an important link between learning disabilities.

LTP is recognized as one of the fundamental cellular mechanisms involved in learning and memory. Studies on the MAPK pathway and learning have been conducted for many years [28–30]. These findings emphasize the interconnected roles of ERK activation, LTP, and learning and memory processes. Furthermore, MAPK/ERK pathway dysfunction has been associated with many neurological pathologies, including ASD [31–33]. In a study conducted in patients with ASD in 2019, increased activity of MAPK pathways, which are key regulators of synaptogenesis and protein synthesis, was determined [34]. In particular, it was suggested that p-MNK1 expression could distinguish patients according to their clinical diagnoses and could constitute a molecular signature of clinical severity in autism spectrum disorder [34].

A large number of NDDs are caused by loss of postsynaptic density (PSD) proteins, including SYNGAP1. SYNGAP1 is a key regulator of synaptic plasticity and learning, primarily functioning at excitatory synapses through Ras signaling inhibition [12, 35]. Importantly, SYNGAP1 deficiency impairs LTP, the cellular mechanism underlying memory formation, underscoring its fundamental role in synaptic plasticity. MNK1/2 and SYNGAP1 intersect in the regulation of synaptic plasticity and memory formation. SYNGAP1 modulates synaptic signaling through RAS-MAPK/ERK. In this pathway, SYNGAP1 controls excessive synaptic signaling by suppressing Ras activity, optimizing the signal-to-noise ratio during synaptic activation. SYNGAP1 deficiency leads to impairments in hippocampal LTP, resulting in learning disorders and memory issues [36]. In mouse models, SYNGAP1 heterozygous mutations are known to impair spatial learning and contextual memory consolidation [37]. A study in patients with ASD identified the MNK-SYNGAP1 axis and found strong evidence that the genetic ASD risk factor Syngap1 regulates mTORC1 signaling and protein synthesis and that the MNK- SYNGAP1 axis is crucial for ASD-associated behaviors such as social interaction, learning, and memory [18]. Although classified as a synaptic protein, several lines of evidence suggest a potential role for SYNGAP1 in the early stages of cortical neurogenesis. In one study, embryonic mice lacking the SYNGAP1 gene were found to be negatively affected developmentally at an early stage [38]. In humans, proper SYNGAP1 expression is essential for the development of cognitive abilities [39]. SYNGAP1 loss-of-function variants have been shown to be causally associated with intellectual disability, severe epilepsy, ASD, and schizophrenia [40, 41].

SYNGAP1 deficiency is linked to cognitive impairments in animal models [42, 43]. Heterozygous SYNGAP1 knockout mice exhibit deficits in spatial learning, working memory, social memory, and contextual memory consolidation [43].

Considering the 16.52-fold increase in SYNGAP1 expression and 8.33-fold increase in MNK1 expression in children with SLD compared to controls, our study suggests a compensatory mechanism aimed at overcoming deficits in synaptic plasticity and learning abilities. Upregulation of SYNGAP1 and MNK1 may attempt to enhance synaptic connections and promote learning. On the other hand, SYNGAP1 upregulation could indicate an imbalance in excitatory-inhibitory synaptic transmission, a hallmark of many neurodevelopmental disorders. In this context, the upregulation of MNK1 and SYNGAP1 might reflect an adaptive response to early-life stressors or environmental factors that influence neurodevelopment. Additionally, the upregulation of these genes could be a consequence of disrupted feedback mechanisms within the MAPK/ERK pathway. In normal conditions, SYNGAP1 acts as a negative regulator of Ras signaling, ensuring balanced synaptic activity. However, in neurodevelopmental disorders, dysregulation of this feedback loop could lead to aberrant gene expression patterns, including the upregulation of MNK1 and SYNGAP1. Further studies are needed to explore these alternative explanations and clarify the precise mechanisms driving the upregulation of these genes in SLD.

SYNGAP1-AS1, the antisense transcript of SYNGAP1, is a lncRNA. Due to the wide variety of possible functions of lncRNAs, they have been identified and described to be involved in numerous biological processes, including human embryonic development and neurodevelopment. SYNGAP1-AS1 may regulate SYNGAP1 expression and function through epigenetic or post-transcriptional mechanisms, but the literature on the function of SYNGAP1-AS1 remains limited. However, one study suggests that SYNGAP1-AS1 may negatively regulate SYNGAP1 expression. Based on this finding, it can be hypothesized that the upregulation of SYNGAP1-AS1 may serve to downregulate SYNGAP1 expression, as increased SYNGAP1 levels could disrupt the signal-to-noise ratio within the pathway, thereby impairing LTP [44]. Additionally, one of the main interpretations of epigenetic mechanisms is that they serve to store information in the central nervous system. According to this view, epigenetic mechanism can alter gene expression and induce functional changes in synaptic plasticity [45]. In our study, lncSYNGAP1-AS1 expression was upregulated (approximately 26-fold) in children with SLD compared to controls. However, this finding did not reach statistical significance, which may be attributed to the small sample size or the high variability in lncRNA expression levels [46]. Another interpretation of the results is that SYNGAP upregulation may disrupt the signal-to-noise ratio in synapses and cause loss of function in the MAP/ERK pathway. Therefore, upregulation of SYNGAP1-AS1 may be aimed at regulating SYNGAP regulation. Our results provide preliminary evidence for the involvement of lncSYNGAP1-AS1 in SLD; therefore, they should be interpreted more detailed with further functional studies.

In our study, MNK1 and SYNGAP1 upregulation did not significantly differ across SLD severity levels. This may reflect the heterogeneous nature of SLD, where gene expression is influenced by individual variability, compensatory mechanisms, or environmental factors rather than severity alone. Epigenetic modifications post-transcriptional regulation could also contribute to this outcome. Alternatively, other molecular pathways may play a greater role in severe cases.

Although our study ensured homogeneity in terms of age, gender, and socio-cultural factors, it is important to acknowledge that SLD is a multifactorial condition influenced by epigenetic, cultural, and environmental factors. Consequently, the generalizability of our findings to broader and more diverse populations remains uncertain. Future research should aim to include larger and more heterogeneous cohorts and consider integrating analyses of environmental exposures and epigenetic modifications. In this study, we used easily accessible blood samples to examine the expression of neurodevelopmental genes. However, this is a limitation of the study, as blood samples may not fully reflect brain-specific gene expression. Since brain tissue-based data are not available in SLD studies, it is important to use samples more closely related to the brain in this field. In future research, the use of alternatives such as neurons derived from induced pluripotent stem cells or cerebrospinal fluid may allow a better understanding of the molecular basis of SLD. Another limitation of our study, although it provides valuable insights into the altered RNA expression of neurodevelopmental genes in children with SLD, is the lack of protein-level validation. Future studies should include protein assays such as Western blotting or ELISA to confirm whether the observed upregulation of MNK1 and SYNGAP1 at the transcript level translates into increased protein expression.

Conclusion

Our findings regarding the upregulation of MNK1, SYNGAP1, and lncSYNGAP1-AS1 in children with SLD highlight their potential as biomarkers for early diagnosis and therapeutic targets. The involvement of the MAPK/ERK pathway and SYNGAP1 in synaptic plasticity suggests that modulating these pathways could improve cognitive function in SLD, paving the way for personalized interventions, including targeted educational strategies or pharmacological treatments. However, to confirm the generalizability and robustness of these results, replication in larger, independent, and more diverse cohorts is essential. Such efforts will strengthen the translational relevance of our findings and help advance the development of targeted diagnostic and therapeutic strategies.

Acknowledgements

The authors extend their gratitude to the participants and their families for their involvement in the study. This research was supported by Cumhuriyet University Headquarters of Scientific Research Projects Commission under grant/project number T-2024-1031. The authors declare no conflicts of interest. Data supporting the results of this study can be obtained from the corresponding author upon request, as the data are subject to privacy and ethical restrictions.

Authors’ contributions

The study was designed by CMI, BB, and NOS, who also participated in data collection, analysis, and interpretation. BB and NOS prepared the initial draft of the manuscript and made revisions, while CMI approved the final version for publication. All authors contributed to the review of the manuscript.

Funding

Open access funding provided by the Scientific and Technological Research Council of Türkiye (TÜBİTAK). This research was supported by Cumhuriyet University Headquarters of Scientific Research Projects Commission under grant/project number T-2024–1031.

Data availability

No datasets were generated or analysed during the current study.

Declarations

Competing interests

The authors declare no competing interests.

Footnotes

The original online version of this article was revised to correct the ethical statement in the Materials and Methods section.

Publisher's Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

12/3/2025

The original online version of this article was revised to correct the ethical statement in the Materials and Methods section.

Change history

12/1/2025

A Correction to this paper has been published: 10.1007/s00431-025-06623-6

References

  • 1.Thapar A, Cooper M, Rutter M (2017) Neurodevelopmental disorders. Lancet Psychiatry 4(4):339–346. 10.1016/S2215-0366(16)30376-5 [DOI] [PubMed] [Google Scholar]
  • 2.American Psychiatric Association (2013) Diagnostic and statistical manual of mental disorders (5th ed.). Washington, DC: American Psychiatric Association. https://www.academia.edu/download/38718268/csl6820_21.pdf
  • 3.Yang Y, Sakimoto Y, Mitsushima D (2024) Postnatal development of synaptic plasticity at hippocampal CA1 synapses: correlation of learning performance with pathway-specific plasticity. Brain Sci 14(4):382. 10.3390/brainsci14040382 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 4.Caya-Bissonnette L, Béïque JC (2024) Half a century legacy of long-term potentiation. Curr Biol 34(13):R640–R662. 10.1016/j.cub.2024.05.017 [DOI] [PubMed] [Google Scholar]
  • 5.Dash PK, Moore AN, Kobori N, Runyan JD (2007) Molecular activity underlying working memory. Learn Mem 14(8):554–563. 10.1101/lm.619807 [DOI] [PubMed] [Google Scholar]
  • 6.Kofink D, Boks MPM, Timmers HTM, Kas MJ (2013) Epigenetic dynamics in psychiatric disorders: environmental programming of neurodevelopmental processes. Neurosci Biobehav Rev 37(5):831–845. 10.1016/j.neubiorev.2013.03.012 [DOI] [PubMed] [Google Scholar]
  • 7.Guan JS, Xie H, Ding X (2015) The role of epigenetic regulation in learning and memory. Exp Neurol 268:30–36. 10.1016/j.expneurol.2014.07.002 [DOI] [PubMed] [Google Scholar]
  • 8.Kaas GA, Zhong C, Eason DE, Ross DL, Vachhani RV, Ming GL, Sweatt JD (2013) TET1 controls CNS 5-methylcytosine hydroxylation, active DNA demethylation, gene transcription, and memory formation. Neuron 79(6):1086–1093. 10.1016/j.neuron.2013.07.003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 9.Stabile F, Torromino G, Rajendran S, Del Vecchio G, Presutti C, Mannironi C et al (2024) Short-term memory deficit associates with miR-153-3p upregulation in the hippocampus of middle-aged mice. Mol Neurobiol 61(5):3031–3041. 10.1007/s12035-024-03600-8 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 10.Mattei AL, Bailly N, Meissner A (2022) DNA methylation: a historical perspective. Trends Genet 38(7):676–707. 10.1016/j.tig.2022.04.008 [DOI] [PubMed] [Google Scholar]
  • 11.Gamache TR, Araki Y, Huganir RL (2020) Twenty years of SynGAP research: from synapses to cognition. J Neurosci 40(8):1596–1605. 10.1523/JNEUROSCI.1760-19.2019 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 12.Komiyama NH, Watabe AM, Carlisle HJ, Porter K, Charlesworth P, Monti J et al (2002) SynGAP regulates ERK/MAPK signaling, synaptic plasticity, and learning in the complex with postsynaptic density 95 and NMDA receptor. J Neurosci 22(22):9721–9732. 10.1523/JNEUROSCI.22-22-09721.2002 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 13.Kilinc M, Creson T, Rojas C, Aceti M, Ellegood J, Vaissiere T et al (2018) Species-conserved SYNGAP1 phenotypes associated with neurodevelopmental disorders. Mol Cell Neurosci 91:140–150. 10.1016/j.mcn.2018.06.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 14.Barros II, Leão V, Santis JO, Rosa RCA, Brotto DB, Storti CB et al (2021) Non-syndromic intellectual disability and its pathways: a long noncoding RNA perspective. Non-Coding RNA 7(1):22. 10.3390/ncrna7010022 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 15.Genheden M, Kenney JW, Johnston HE, Manousopoulou A, Garbis SD, Proud CG (2015) BDNF stimulation of protein synthesis in cortical neurons requires the MAP kinase-interacting kinase MNK1. J Neurosci 35(3):972–984. 10.1523/JNEUROSCI.2641-14.2015 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 16.Panja D, Kenney JW, D’Andrea L, Zalfa F, Vedeler A, Wibrand K et al (2014) Two-stage translational control of dentate gyrus LTP consolidation is mediated by sustained BDNF-TrkB signaling to MNK. Cell Rep 9(4):1430–1445. 10.1016/j.celrep.2014.10.041 [DOI] [PubMed] [Google Scholar]
  • 17.Creson TK, Rojas C, Hwaun E, Vaissiere T, Kilinc M, Jimenez-Gomez A et al (2019) Re-expression of SynGAP protein in adulthood improves translatable measures of brain function and behavior. eLife 8:e46752 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 18.Chalkiadaki K, Hooshmandi M, Lach G, Statoulla E, Simbriger K, Amorim IS et al (2023) Mnk1/2 kinases regulate memory and autism-related behaviors via Syngap1. Brain 146(5):2175–2190. 10.1093/brain/awad097 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 19.Yang Y, Zhao S, Zhang M, Xiang M, Zhao J, Chen S et al (2022) Prevalence of neurodevelopmental disorders among US children and adolescents in 2019 and 2020. Front Psychol. 10.3389/fpsyg.2022.997648 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 20.Kubota T, Takae H, Miyake K (2012) Epigenetic mechanisms and therapeutic perspectives for neurodevelopmental disorders. Pharmaceuticals 5(4):369–383 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 21.Ahmad A, Imran M, Ahsan H (2023) Biomarkers as biomedical bioindicators: approaches and techniques for the detection, analysis, and validation of novel biomarkers of diseases. Pharmaceutics 15(6):1630 (https://www.ncbi.nlm.nih.gov/pmc/articles/PMC10303887/) [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 22.Kaufman J, Birmaher B, Brent D, Rao U, Flynn C, Moreci P et al (1997) Schedule for affective disorders and schizophrenia for school-age children-present and lifetime version (K-SADS-PL): initial reliability and validity data. J Am Acad Child Adolesc Psychiatry 36(7):980–988. 10.1097/00004583-199707000-00021 [DOI] [PubMed] [Google Scholar]
  • 23.Ünal , Öktem F, Çetin Çuhadaroğlu F, Çengel Kültür SE, Akdemi D, Foto Özdemir et al (2019) Reliability and validity of the schedule for affective disorders and schizophrenia for school-age children-present and lifetime version, DSM-5 November 2016-Turkish adaptation (K-SADS-PL-DSM-5-T). Turk J Psychiatry 30(1) [PubMed]
  • 24.Oktem F, Erden G, Gencoz T, Sezgin N, Uluc S (2016) Wechsler Çocuklar için Zeka Ölçeği-IV (WÇZÖ-IV) uygulama ve puanlama el kitabı Türkçe sürümü. Ankara: Türk Psikologlar Dernegi Yayinlari Pearson Assessments
  • 25.Kaner S, Büyüköztürk Ş, Işerı E (2013) Conners anababa dereceleme ölçeği-yenilenmiş kısa: Türkiye stardardizasyon çalışması
  • 26.Sarıpınar EG, Erden G (2010) Usability of tests measuring academic skills and sensory-motor functions in clinical settings: a literature review. Kuram ve Uygulamalı Eğitim Bilimleri 10(1):95–113 [Google Scholar]
  • 27.Livak KJ, Schmittgen TD (2001) Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 25(4):402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
  • 28.English JD, Sweatt JD (1997) A requirement for the mitogen-activated protein kinase cascade in hippocampal long-term potentiation. J Biol Chem 272(31):19103–19106. 10.1074/jbc.272.31.19103 [DOI] [PubMed] [Google Scholar]
  • 29.Gooney M, Messaoudi E, Maher FO, Bramham CR, Lynch MA (2004) BDNF-induced LTP in the dentate gyrus is impaired with age: analysis of changes in cell signaling events. Neurobiol Aging 25(10):1323–1331. 10.1016/j.neurobiolaging.2003.07.004 [DOI] [PubMed] [Google Scholar]
  • 30.Blum S, Moore AN, Adams F, Dash PK (1999) A mitogen-activated protein kinase cascade in the CA1/CA2 subfield of the dorsal hippocampus is essential for long-term spatial memory. J Neurosci 19(9):3535–3544. 10.1523/JNEUROSCI.19-09-03535.1999 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 31.Albert-Gascó H, Ros-Bernal F, Castillo-Gómez E, Olucha-Bordonau FE (2020) MAP/ERK signaling in developing cognitive and emotional function and its effect on pathological and neurodegenerative processes. Int J Mol Sci 21(12):4471. 10.3390/ijms21124471 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 32.Subramanian M, Timmerman CK, Schwartz JL, Pham DL, Meffert MK (2015) Characterizing autism spectrum disorders by key biochemical pathways. Front Neurosci 9:313. 10.3389/fnins.2015.00313 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 33.Vithayathil J, Pucilowska J, Landreth GE (2018) ERK/MAPK signaling and autism spectrum disorders. Prog Brain Res 241:63–112. 10.1016/bs.pbr.2018.08.004 [DOI] [PubMed] [Google Scholar]
  • 34.Rosina E, Battan B, Siracusano M, Di Criscio L, Hollis F, Pacini L et al (2019) Disruption of mTOR and MAPK pathways correlates with severity in idiopathic autism. Transl Psychiatry 9(1):1–10. 10.1038/s41398-019-0450-x [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 35.Fenton TA, Haouchine OY, Hallam EB, Smith EM, Jackson KC, Rahbarian D et al (2024) Hyperexcitability and translational phenotypes in a preclinical mouse model of SYNGAP1-related intellectual disability. Transl Psychiatry 14(1):1–11. 10.1038/s41398-024-0398-7 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 36.Araki Y, Rajkovich KE, Gerber E, Gamache TR, Johnson RC, Tran THN et al (2024) SynGAP regulates synaptic plasticity and cognition independently of its catalytic activity. Science 383(6686):eadk1291. 10.1126/science.adh1180 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 37.Jadhav V, Carreno-Munoz MI, Chehrazi P, Michaud JL, Chattopadhyaya B, Cristo GD (2024) Developmental Syngap1 haploinsufficiency in medial ganglionic eminence-derived interneurons impairs auditory cortex activity, social behavior, and extinction of fear memory. J Neurosci 10.1523/JNEUROSCI.0946-24.2024 [DOI] [PMC free article] [PubMed]
  • 38.Berryer MH, Chattopadhyaya B, Xing P, Riebe I, Bosoi C, Sanon N et al (2016) Decrease of SYNGAP1 in GABAergic cells impairs inhibitory synapse connectivity, synaptic inhibition, and cognitive function. Nat Commun 7:13340. 10.1038/ncomms13340 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 39.Kim JH, Lee HK, Takamiya K, Huganir RL (2003) The role of synaptic GTPase-activating protein in neuronal development and synaptic plasticity. J Neurosci 23(4):1119–1124. 10.1523/JNEUROSCI.23-04-01119.2003 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 40.Berryer MH, Hamdan FF, Klitten LL, Møller RS, Carmant L, Schwartzentruber J et al (2013) Mutations in SYNGAP1 cause intellectual disability, autism, and a specific form of epilepsy by inducing haploinsufficiency. Hum Mutat 34(2):385–394. 10.1002/humu.22209 [DOI] [PubMed] [Google Scholar]
  • 41.Mignot C, von Stülpnagel C, Nava C, Ville D, Sanlaville D, Lesca G et al (2016) Genetic and neurodevelopmental spectrum of SYNGAP1-associated intellectual disability and epilepsy. J Med Genet 53(8):511–522. 10.1136/jmedgenet-2016-103802 [DOI] [PubMed] [Google Scholar]
  • 42.Muhia M, Yee BK, Feldon J, Markopoulos F, Knuesel I (2010) Disruption of hippocampus-regulated behavioral and cognitive processes by heterozygous constitutive deletion of SynGAP. Eur J Neurosci 31(3):529–543. 10.1111/j.1460-9568.2010.07172.x [DOI] [PubMed] [Google Scholar]
  • 43.Ozkan ED, Creson TK, Kramár EA, Rojas C, Seese RR, Babyan AH et al (2014) Reduced cognition in Syngap1 mutants is caused by isolated damage within developing forebrain excitatory neurons. Neuron 82(6):1317–1333. 10.1016/j.neuron.2014.04.041 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 44.Velmeshev D, Magistri M, Faghihi MA (2013) Expression of non-protein-coding antisense RNAs in genomic regions related to autism spectrum disorders. Mol Autism 4(1):32. 10.1186/2040-2392-4-32 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 45.Kim S, Kaang BK (2017) Epigenetic regulation and chromatin remodeling in learning and memory. Exp Mol Med 49(1):e281. 10.1038/emm.2017.38 [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 46.Johnsson P, Ziegenhain C, Hartmanis L, Hendriks GJ, Hagemann-Jensen M, Reinius B et al (2022) Transcriptional kinetics and molecular functions of long noncoding RNAs. Nat Genet 54(3):306–317. 10.1038/s41588-022-00984-9 [DOI] [PMC free article] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Data Availability Statement

No datasets were generated or analysed during the current study.


Articles from European Journal of Pediatrics are provided here courtesy of Springer

RESOURCES