Widespread geographic distribution of Aedes aegypti (Diptera: Culicidae) kdr variants in Panama

Abstract

We searched for evidence of knockdown resistance (kdr) mutations in the voltage-gated sodium channel gene of Aedes aegypti (Linnaeus) (Diptera: Culicidae) and Aedes albopictus (Skuse) (Diptera: Culicidae) mosquitoes from Panama. Conventional PCR was performed on 469 Ae. aegypti and 349 Ae. albopictus. We did not discover kdr mutations in Ae. albopictus, but 2 nonsynonymous kdr mutations, V1016I (found in 101 mosquitoes) and F1534C (found in 29 of the mosquitoes with the V1016I), were detected in Ae. aegypti. These kdr mutations were present in all specimens that were successfully sequenced for both IIS5-S6 and IIIS6 regions, which included samples collected from 8 of the 10 provinces of Panama. No other kdr mutations were found in Ae. aegypti, including V1016G, which has already been reported in Panama. Findings suggest that the V1016I-F1534C variant is prevalent in Panama, which might be related to the introduction and passive movement of mosquitoes as part of the used-tire trade. However, we cannot rule out the possibility that selection on de novo replacement of kdr mutations also partially explains the widespread distribution pattern of these mutations. These 2 ecological and evolutionary processes are not mutually exclusive, though, as they can occur in tandem. Research in Panama needs to calculate the genotypic and allelic frequencies of kdr alleles in local Ae. aegypti populations and to test whether some combinations confer phenotypic resistance or not. Finally, future studies will have to track the introduction and spreading of new kdr mutations in both Aedes species.

Introduction

Invasive Aedes aegypti and Aedes albopictus mosquitoes are the biological vectors of arthropod-borne viruses (arboviruses) that infect humans, including yellow fever, dengue, Mayaro, chikungunya, and Zika, among others (Benedict et al. 2007). Chemical control targeting populations of these mosquitoes is the most commonly used way of controlling epidemics of these arboviruses. Insecticide resistance is an inherited trait that confers increased tolerance to toxic chemical agents, and it poses a major obstacle to Aedes control (WHO 1992, Moyes et al. 2017).

Behavioral, physiological, and molecular mechanisms can lead to insecticide resistance in Aedes mosquitoes. Multiple resistance occurs when a mosquito species uses various strategies to combat insecticides with different modes of action, whereas cross-resistance occurs when the same mosquito species tolerates a wide range of insecticides with analogous modes of action (Ranson et al. 2011, Montella et al. 2012). One of the most widespread cross-resistance mechanisms in Aedes mosquitoes is target-site resistance at the voltage-gated sodium channel (VGSC) gene, also known as knockdown resistance (kdr). The selective entry of sodium ions through the VGSC is a key factor in the formation of action potentials in excitable cells. These channels are large, integral membrane proteins that are expressed by a single gene in insects. The alpha subunit of eukaryotic VGSC is a single polypeptide chain consisting of 4 homologous repeat domains (I–IV), each with 6 transmembrane segments (Itokawa et al. 2021). Organochlorine insecticides such as DDT and pyrethroids such as deltamethrin, cyfuthrin, and permethrin prevent the VGSC from closing, resulting in the disruption of the mosquito neural system, paralysis, and death. However, nonsynonymous mutations in the genomic region encoding some segments of particular domains of the VGSC gene result in conformational changes that make these chemicals incapable of binding to the VGSC while preserving function, leading to greater tolerance to these insecticides (Dong et al. 2014, Du et al. 2016). To date, twelve kdr mutations have been identified in populations of Ae. aegypti from Asia, Europe, and the Americas, yet just a few have been linked with insecticide resistance (Atencia et al. 2016, Fan et al. 2020, Melo Costa et al. 2020, Endersby-Harshman et al. 2020). In contrast, only 4 kdr mutations have been detected in the VGSC gene of Ae. albopictus from Asia (i.e., China), Europe (i.e., Italy), and the Americas (i.e., Brazil, USA) (Kushwah et al. 2015, Chen et al. 2016, Moyes et al. 2017, Rath et al. 2017, Auteri et al. 2018).

Knockdown resistance mutations in Ae. aegypti have been identified in the second domain, segment 6 (IIS6) of the VGSC gene, at codon positions 989 (linker connecting), 1011, and 1016, and also in the third domain, segment 6 (IIIS6), at codon position 1534 (Carvalho and Moreira 2017, Moyes et al. 2017, Melo Costa et al. 2020, Hamid et al. 2020). The kdr mutation F1534C in the IIIS6 region depicts a high frequency of occurrence and global geographic distribution in populations of Ae. aegypti (Moyes et al. 2017, Costa et al. 2020). This mutation has been associated with cross-resistance to the organochlorine DDT and to the pyrethroid permethrin (Brengues et al. 2003, Dong et al. 2014). Similarly, the kdr mutations V1016I and V1016G in the IIS6 region have been associated with cross-resistance to DDT and both type I and type II pyrethroids in populations of Ae. aegypti (Carvalho and Moreira 2017, Hamid et al. 2020). Both the V1016G and V1016I have been reported from different geographic regions around the world, with V1016G most commonly reported in Asia while V1016I is commonly found in the Americas but also reported in Africa. No spatial overlap has been reported thus far between these 2 mutations.

Knockdown resistance mutations in Ae. albopictus have been identified in the third domain, segment 6 (IIIS6), at codon positions 1532 and 1534 (Moyes et al. 2017). Other mutations have also been found in the second domain, segment 6 (IIS6) of this species, at codon positions 989, 1000, 1011, and 1016 (Zhou et al., 2019). The most frequent kdr mutations in Ae. albopictus are Fl534C and FI534L, which have been associated with cross-resistance to DDT and type I and type II pyrethroids. Reports of Fl534C have come mainly from China and Singapore, whereas reports of FI534L have come from Brazil and the United States (Kushwah et al. 2015, Chen et al. 2016, Auteri et al. 2018, Rath et al. 2018). Additional kdr mutations have been recently reported in Ae. albopictus; I1532T was detected in samples from Italy either alone or in conjunction with the FI534L (Auteri et al. 2018), whilst V1016G was detected for the first time in samples from Beijing, China (Zhou et al. 2019).

Prior research in Panama detected for the first time in the Americas the V1016G mutation in one individual Ae. aegypti gathered from the Nuevo Chorrillo locality near Panama City (Murcia et al. 2019). In addition, previous studies in Panama and neighboring Costa Rica reported the absence of kdr mutations in field-collected samples of Ae. albopictus (Chaves et al. 2015, Valderrama et al. 2016). Despite prior efforts to understand the landscape of kdr alleles in Panama (Valderrama et al. 2016, Murcia et al. 2019), no comprehensive survey has been conducted thus far to assess the geographic distribution of kdr mutations in Ae. aegypti, including the recently reported V1016G, which could have been introduced into Panama from Asian countries and could be expanding its distribution (Eskildsen et al. 2018, Schmidt et al. 2019, Endersby-Harshman et al. 2020). Also, no confirmatory assessment about the lack of kdr mutations in Ae. albopictus has been conducted in Panama, despite the fact that this vector has expanded across the country since its initial confirmed report in 2002 and is likely both subject to evolutionary pressures for the emergence and/or introduction via migration of kdr mutations conferring insecticide resistance (Miller and Loaiza 2015, Eskildsen et al. 2018).

The goal of this study was to investigate the occurrence and geographic distribution of kdr mutations in invasive Aedes mosquitoes in Panama. This type of information can assist Panamanian health authorities in maintaining the efficacy and sustainability of conventional vector control strategies by guiding recommendations for insecticide use based on the frequency of kdr variants and phenotypic resistance of Aedes populations across the country. Regional information on the prevalence of kdr mutations in Aedes mosquitoes may also improve the accuracy of estimating the risk of epidemics in addition to the general surveillance of vectors and arboviruses (Whiteman et al. 2019). Findings may also aid in adapting novel vector control strategies, such as transgenic mosquitoes and endosymbiont-based Wolbachia biological control, to the local insecticide resistance backdrop of Aedes populations.

Materials and Methods

Specimen Collection

Mosquitoes were collected between 2015 and 2016 from 42 locations across Panama, chosen based on the co-distribution pattern of Ae. aegypti and Ae. albopictus in the country, as determined elsewhere (Bennett et al. 2021). Three oviposition traps, situated at least 50 meters apart from each other, were set up at each location (i.e., house or used-tire trading garage) and reviewed after 5 days to sample eggs from gravid females. Active surveillance of eggs, larvae, and pupae was also done at each house or garage for 25 min per day during the first and last days of collection. Upon completing the aquatic developmental cycle in the laboratory, mosquitoes were identified taxonomically based on adult morphological characters (Rueda 2004).

PCR Amplification and Sequencing of the VGSC Gene

The DNA extraction procedure has been described elsewhere (Bennett et al. 2019, 2021). PCR was used to amplify the genomic region encoding the second domain, segments 5 and 6 (IIS5-S6) of the VGSC in Ae. aegypti using primers and conditions reported previously (Al Nazawi et al. 2017). PCR was also used to amplify the genomic region encoding the third domain, segment 6 (IIIS6) of a subset of the same above-mentioned individuals to increase the probability of finding molecular variation in the VGSC, as suggested by previous research (Carvalho and Moreira 2017). More specifically, we targeted codon positions 989, 1011, and 1016 of the IIS5-S6 region as well as positions 1532 and 1534 of the IIIS6 region for the same Ae. aegypti individuals to detect the presence of the V016I/F1534C and/or V1016G/F1534C variants in Panama (Table 1). In addition, PCR was performed to amplify segment 6 of the second and third domains (IIS6 and IIIS6) of the VGSC gene of Ae. albopictus using primers and conditions described previously (Kawada et al. 2014, Chaves et al. 2015). We targeted specifically codon positions 989, 1000, and 1016 of the IIS6 region and positions 1532 and 1534 of the IIIS6 region (Table 1) to investigate the presence of kdr mutations in this invasive vector species, which have been detected previously in Europe and Asia (Moyes et al. 2017, Auteri et al. 2018).

Table 1.

Primers used for PCR amplification and sequencing of various regions within the VGSC gene of both Aedes aegypti and Aedes albopictus mosquitoes from Panama. The kdr mutations expected for each region of the VGSC gene are also shown along with information on the rate of successful PCR amplification per mosquito species

Mosquito species	Primer pairs (5′-3′)	VGSC region	Targeted kdr mutations	N	PCR success rate
Ae. aegypti	IIS5-6F ATCGCTTCCCGGACAAAGAC IIS5-6R GTTGGCGATGTTCGACTTGA	IIS5-S6	V1016G/I; I1011M/V; S989P; G923V; L928W	325	66.5%
Ae. aegypti	AaSCF7 GAGAACTCGCCGATGAACTT AaSCR7 GACGACGAAATCGAACAGGT	IIIS6	F1534C/L; T1520I	144	25.0%
Ae. albopictus	IIS6F ACAATGTGGATCGCTTCCC IIS6R TGGACAAAAGCAAGGCTAAG	IIS6	V1016G/I; S989P; I1011V/M; L1014F	192	65.1%
Ae. albopictus	AaSCF7 GAGAACTCGCCGATGAACTT AaSCR7 GACGACGAAATCGAACAGGT	IIIS6	F1534C/S/L; I1532T	157	71.9%

Data Analysis

We employed 2 strategies to detect the presence of kdr mutations in Aedes mosquitoes from Panama. First, we prepared a genetic library of homologous DNA sequences from GenBank, which included representatives of the countries and continents from where kdr mutations were first described in Ae. aegypti and Ae. albopictus (Supplementary Table S1). Geneious Prime (Version 2019.2.3) was used to edit and trim the forward and reverse chromatograms of the sequences obtained in this study from samples in Panama into consensus sequences (https://geneious.com). We translated both the GenBank and Panamanian nucleotide sequences of Ae. aegypti and Ae. albopictus into amino acid sequences and aligned them with and without introns using the Clustal and Muscle algorithms. Changes in amino acid sequences indicative of the presence of kdr mutations were visualized on the corresponding sequence alignment. Second, we performed neighbor-joining (NJ) phylogenetic analyses (Saitou and Nei 1987) in MEGA v.6.0 (Tamura et al. 2013) to assess the degree of molecular relatedness based on pairwise genetic distances between the DNA sequences obtained from Ae. aegypti and Ae. albopictus in Panama and those from the GenBank genetic library of homologous DNA sequences of these species. We included representative GenBank sequences of the wildtype as well as genetic variants harboring kdr mutations from each vector species. The Tamura-Nei substitution model and 1,000 bootstrap replicates were used to perform the phylogenetic analyses. The GenBank accession numbers of our VGSC gene sequences are PP831810–PP831820 (IIS5-S6) and PP831821–PP831831 (IIIS6).

We mapped the geographical positions of Aedes samples gathered from across Panama using the tools in ESRI ArcGIS Pro, v.3.2.2. The data in the Excel sheet (i.e., locality, type, presence of kdr mutations) was converted to a geodatabase feature class in ArcGIS Pro point data type, using the XY Table To Point tool and then classified by multiple attributes with the Unique Values method using discrete attributes from the data table: sampling site (garage or house), and kdr mutations. Each value was assigned a unique symbol by color to indicate the variation of each mosquito sample. The number of mosquito samples tested for the presence of kdr mutations at each sampling site was also labeled. The geographical support layers of the provinces of the country of Panama and the primary highways and secondary roads of Panama, according to the OSM (Open Street Map), classified by inter-American and other main roads, were added. Both geographic data are available on the STRI Data Portal (https://strimaps.si.edu), published by the STRI GIS Laboratory.

Results

A total of 818 Aedes samples were analyzed in order to identify kdr mutations in 2 domains of the VGSC gene. The number of specimens examined by species, domain or segment, sampling location, and date are shown in Supplementary Tables S2 (IIS5-S6 region) and Supplementary Tables S3 (IIIS6 region) for Ae. aegypti, and in Supplementary Tables S4 (IIS6 region) and Supplementary Tables S5 (IIIS6 region) for Ae. albopictus. A total of 469 Ae. aegypti specimens underwent PCR targeting IIS5-S6 (n = 325 individuals from 42 localities) and IIIS6 regions (n = 144 individuals from 27 localities) (Supplementary Tables S2 and S3). Amplicons for the expected segments were obtained from 216 (IIS5-S6) and 36 (IIIS6) of the PCRs performed on Ae. aegypti, showing that 66.5% and 25.0% of the amplifications were effective, respectively (Table 1). Additionally, 349 Ae. albopictus specimens underwent PCR targeting the IIS6 (n = 192 individuals from 11 localities) and IIIS6 domains (n = 157 individuals from 12 localities) (Supplementary Tables S4 and S5). Aedes albopictus PCRs yielded amplicons for the expected segments in 125 (IIS6) and 113 (IIIS6) samples, indicating that 65.1% and 71.9% of the amplifications were successful (Table 1). A noteworthy percentage of PCR amplifications were unsuccessful in both mosquito species, which could be in part due to DNA degradation as the vast majority of our samples have been stored in 95% ethanol for more than 5 years but could also be due to primer template mismatches caused by point mutations at the targeted genome regions.

The Presence of Nonsynonymous kdr Mutations in the VGSC Gene of Aedes aegypti

A total of 124 consensus DNA sequences of the VGSC gene were obtained from Ae. aegypti samples collected in Panama. Of these, 101 sequences were in the IIS5-S6 region, which measured 410–566 bp, and 23 sequences were in the IIIS6 region, which measured 528–613 bp. The rate of sequencing success in Ae. aegypti was slightly higher than in Ae. albopictus, but still low in both domains, ranging from 35.0% (23/66) for IIIS6 to 53.0% (101/188 samples) for IIS5-S6. The sequences of Ae. aegypti from Panama showed no variation in intron size among individuals (250 bp for IIS5-S6). A substitution was observed between the amino acids valine (Val) and isoleucine (Ile) in codon 1016 of the IIS5-S6 VGSC gene region of Ae. aegypti (Supplementary Figure S2). This change corresponds to a transversion in the codon’s first nucleotide position. The ATA-mutated codon revealed the presence of the V1016I mutation, while its absence indicated the occurrence of the wildtype (Supplementary Figure S2). A substitution was also observed between the amino acid phenylalanine (Phe) and the amino acid cysteine (Cys) in codon 1534 of the IIIS6 VGSC gene region of Ae. aegypti (Supplementary Figure S3). This change corresponds to a transversion in the second nucleotide position of this codon. The mutated TTC codon revealed the presence of the F1534C mutation, while its absence indicated the occurrence of the wildtype (Supplementary Figure S3). Figure 1A shows the NJ phylogenetic tree comprising Ae. aegypti sequences from Panama for the IIS5-S6 region plus homologous sequences from GenBank. Bootstrap support for the branches in the phylogenetic tree was usually higher than 71.0%. The Panamanian sequences of Ae. aegypti grouped closely together with one sequence from Mexico (MT250049.1), which shared the presence of the V1016I mutation (Fig. 1A). These sequences showed low intra-specific genetic divergence values of less than 0.002 and were separated from a second molecular grouping formed by GenBank sequences that did not contain the V1016I mutation from Brazil (KY747529.1), Mexico (MT250048.1), Thailand (MN365031.1), Taiwan (EU399179.1), China (AY663385.1), and Singapore (AB909019.1) (Fig. 1A). The rest of the sequences in the NJ phylogenetic tree formed separate molecular groupings comprising GenBank representatives that did not contain the V1016I mutation but harbored other kdr mutations not found in the Panamanian samples of Ae. aegypti, including V1016G from Taiwan (EU399181.1), S989P + V1016G from Thailand (EU792890.1), and I1011M from Brazil (FJ479612.1) (Fig. 1A).

Fig. 1.

Neighbor-joining phylogenetic trees showing the genetic distance between DNA sequences of the VGSC gene for domains and segments IIS5-S6 Panel A) and IIIS6 Panel B) of Aedes aegypti from Panama and homologous sequences from GenBank (https://www.ncbi.nlm.nih.gov/nucleotide/). Panel A) Green circles or green triangles represent Aedes aegypti samples carrying the V1016I mutation that were gathered either from houses in rural communities or garages that trade used tires in the main highways of Panama, respectively. Squares of different colors other than green represent GenBank sequences with or without kdr mutations that were formerly obtained from mosquitoes in Mexico (V1016I—MT250049.1), Taiwan (V1016G—EU399181.1), Thailand (S989P + V1016G—EU792890.1), Brazil (I1011M—FJ479612.1), Brazil (Wildtype—KY747529.1), Mexico (Wildtype—MT250048.1), Thailand (Wildtype—MN365031.1), Taiwan (Wildtype—EU399179.1), China (Wildtype—AY663385.1), and Singapore (i.e., Wildtype—AB909019.1). Panel B) Red circles or red triangles represent Aedes aegypti samples carrying the F1534C mutation that was gathered either from houses in rural communities or garages that trade used tires in the main highways of Panama, respectively.

Figure 1B shows the NJ phylogenetic tree comprising sequences of Ae. aegypti from Panama for the IIIS6 region plus homologous sequences from GenBank. Bootstrap support for the branches in the phylogenetic tree was normally higher than 80.0%. Sequences of Ae. aegypti from Panama showed low intra-specific genetic divergence values of 0.002 and grouped closely together with other sequences from Malaysia (MK005556.1), Brazil (KF527414.1), Saudi Arabia (MN997363.1), India (KM677267.1), and Pakistan (ON838301.1), which shared the presence of the F1534C mutation. A second molecular grouping was formed by 2 GenBank sequences that contained the F1534C mutation plus additional kdr mutations not detected in the Panamanian samples of Ae. aegypti, including T1520I + F1534C from India (KM677271.1) and 1532I + F1534C from Pakistan (ON838304.1) (Fig. 1B). The rest of the sequences in the NJ phylogenetic tree formed separate molecular groupings comprising GenBank representatives that did not contain the F1534C mutation from Thailand (EU792890.1), Taiwan (EU399181.1), Saudi Arabia (KY046237.1), Indonesia (KY078303.1), India (KM677255.1), Malaysia (MK005555.1), Singapore (AB909019.1), and China (AY663385.1) (Fig. 1B).

The V1016I mutation was present in every Ae. aegypti specimen that was successfully sequenced for the IIS5-S6 region. This mutation demonstrated a wide geographic distribution with 27 locations identified, including houses from 8 different rural communities and 19 used-tire trading garages distributed along the country’s main highway system (Fig. 2; Table 2). Furthermore, the F1534C mutation was present in every Ae. aegypti specimen that was successfully sequenced for the IIIS6 region. This mutation was always found in combination with the V1016I. The F1534C mutation exhibited a wide geographic distribution as well, showing up in houses from 6 different communities and 9 different used-tire trading garages across the country (Fig. 2; Table 2).

Fig. 2.

The map shows the geographical location of Aedes aegypti specimens that carry kdr mutations found in the IIS5-S6 and IIIS6 domains of the VGSC gene from across Panama. The V1016I-F1534C variant was documented both in houses from rural communities (red circles) and garages that trade used tires (red triangles) along the primary highway system of the country, which is highlighted by the dark blue line. Green circles or green triangles represent Aedes aegypti samples carrying exclusively the V1016I mutation that were gathered either from houses in rural communities or garages that trade used tires in the main highways of Panama, respectively. The size of circles or triangles illustrates the number of mosquitoes that were PCR-amplified from that particular locality. Inset map depicts the presence of kdr mutations in the metropolitan area of Panama City, including the V1016I-F1534C variant.

Table 2.

Metadata of Aedes aegypti samples containing nonsynonymous kdr mutations in codon positions 1,016, 1,534, and both (1,016-1,534) of the VGSC gene. The frequency of mosquitoes carrying singly the V1016I or F1534C and in combination (V1016I-F1534C) out of all the individuals that were sequenced for the IIS5-S6 and IIIS6 regions is displayed in the last 3 columns, respectively. Samples of Aedes aegypti for which we were unable to obtain high-quality sequences of the IIIS6 region are designated as not obtained

Province (Code)	Locality	Site	Latitude	Longitude	Year	V1016I	F1534C	V1016I + F1534C
Bocas del Toro (BT)	Changuinola	Garage	9.456300	−82.518540	2016	4/4	3/3	3
Bocas del Toro (BT)	Isla Colon	House	9.33949	−82.24311	2016	1/1	1/1	1
Chiriqui (CH)	Paso Canoas	Garage	8.527090	−82.835570	2016	16/16	2/2	2
Chiriqui (CH)	Concepción	Garage	8.517048	−82.626451	2016	14/14	1/1	1
Chiriqui (CH)	San Pablo Viejo Abajo	Garage	8.452250	−82.500750	2016	3/3	2/2	2
Chiriqui (CH)	Varital	Garage	8.494730	−82.586830	2016	11/11	1/1	1
Los Santos (LS)	Pedasi	House	7.532667	−80.029833	2016	2/2	2/2	2
Los Santos (LS)	La Villa	House	7.938333	−80.416944	2016	2/2	1/1	1
Cocle (CO)	Aguadulce	Garage	8.248160	−80.554600	2016	16/16	2/2	2
Panama Oeste (PO)	Chame	Garage	8.58670	−79.88520	2017	1/1	0/1	NO
Panama Oeste (PO)	Capira	Garage	8.74145	−79.88215	2017	1/1	0/1	NO
Panama Oeste (PO)	El Nance	Garage	8.467240	−79.966300	2016	1/1	1/1	1
Panama Oeste (PO)	La Chorrera	Garage	8.86938	−79.80207	2016	8/8	2	2
Panama Oeste (PO)	Princesa Mía	House	8.964444	−79.704167	2015	1/1	0/1	NO
Panama Oeste (PO)	Arraiiján	Garage	8.9290387	−79.7045903	2015	3/3	0/3	NO
Panama (PA)	Juan Diaz	Garage	9.03994	−79.46021	2015	2/2	0/2	NO
Panama (PA)	Monte Rico	Garage	9.10666	−79.36527	2015	3/3	0/3	NO
Panama (PA)	S. Punto Real	Garage	9.102667	−79.362028	2015	3/3	1/1	1
Panama (PA)	Via Transismica	Garage	9.00557	−79.52043	2016	2/2	0/2	NO
Panama (PA)	Felipillo	Garage	9.09888	−79.31	2015	2/2	0/3	NO
Panama (PA)	Río Abajo	Garage	9.01952	−79.49214	2016	1/1	0/1	NO
Panama (PA)	Don Bosco	Garage	9.062386	−79.422378	2016	1/1	0/1	NO
Colon (CN)	Cristobal	Garage	9.339139	−79.880007	2017	1/1	0/1	NO
Colon (CN)	Miguel de la Borda	House	9.152222	−80.306389	2016	3/3	5/5	5
Colon (CN)	Portobelo	House	9.55	−79.65	2016	1/1	2/2	2
Darien (DA)	Bajo Iglesias	House	8.39778	−78.00861	2016	1/1	0/1	NO
Darien (DA)	Meteti	House	8.50972	−77.98056	2016	4/4	3/3	3

The Absence of Nonsynonymous kdr Mutations in the VGSC Gene of Aedes albopictus

A total of 53 consensus DNA sequences of the VGSC gene were obtained from Ae. albopictus specimens collected in Panama. Of these, 22 were from the IIS6 region, which measured 195–305 bp, and 31 were from the IIIS6 region, which measured 528–613 bp. The rate of sequencing success in this species was slightly lower than in Ae. aegypti in both domains, ranging from 33.0% (22/67 samples) for IIS6 to 45.0% (31/69) for IIIS6. The Panamanian sequences of Ae. albopictus showed no variation in intron size among individuals (91 bp for IIS6 and 84 bp for IIIS6). Figure 3A and B shows the NJ phylogenetic trees comprising sequences of Ae. albopictus from Panama for the IIS6 and IIIS6 regions, respectively, and homologous sequences from GenBank. The sequences of Ae. albopictus from Panama grouped together in both phylogenetic trees, constituting a distinct molecular group from other groups that included GenBank sequences (Fig. 3A and B). The genetic distance shown between the Panamanian sequences and the GenBank sequences of Ae. albopictus in both gene regions was caused by specifc kdr mutations that were present in the GenBank sequences but lacking in the Panamanian samples. Among the kdr mutations in the IIS6 region of Ae. albopictus that have been reported from other countries around the world, but were absent in Panama were S989T (MN956966.1—Italy), V1016G (MN956916.1—China), V1016G (MN956967.1—Italy), S1000Y (MK201611.1—China), and I1011V (MN956963.1—Italy) (Fig. 3A). Similarly, none of the kdr mutations that have been reported previously in the IIIS6 region of Ae. albopictus, including F1534S (MK201621.1; MN433857.1—China), L1532T + F1534F (MK201619.1—China), and L1532T + 1534S (MH384958.1—China) were found in the Panamanian Ae. albopictus (Fig. 3B). The absence of kdr mutations in both the IIS6 and IIIS6 regions of the VGSC gene of Ae. albopictus from Panama was confirmed by nucleotide sequence alignment with those from GenBank, which depicted the exclusive occurrence of the wildtype variant in Panama (Supplementary Figures S3 and S4).

Fig. 3.

Neighbor-joining phylogenetic trees showing the genetic distance between DNA sequences of the VGSC gene for domains and segments IIS6 Panel A) and IIIS6 Panel B) of Aedes albopictus from Panama and homologous sequences from GenBank (https://www.ncbi.nlm.nih.gov/nucleotide/). Black and gray squares symbolize GenBank sequences obtained from samples of Aedes albopictus collected in China and Italy, respectively, Panels A) and B). Blue triangles symbolize molecular sequences obtained from Panamanian samples of Aedes albopictus that depict the wildtype variant in both gene regions. The kdr mutations S989P, S989T, S989Y, I1011V, V1016G, and S1000Y in the IIS6 domain and F1534C, F1534L, F1534S, L1532T in the IIIS6 domain are present in some of the GenBank sequences but lacking from the Panamanian samples of Aedes albopictus, Panels A) and B).

Discussion

Earlier studies about insecticide resistance in Ae. aegypti from Panama have shown evidence of cross-resistance between organochlorine (i.e., DDT) and pyrethroid insecticides; however, most research conducted thus far in the country has focused on metabolic resistance, with little effort going toward understanding the occurrence and geographic distribution of kdr mutations (Cáceres et al. 2013, Tuñon et al. 2024). In this study, we employed conventional PCR and Sanger sequencing to search for nonsynonymous kdr mutations on the VGSC gene of Ae. aegypti and Ae. albopictus from across Panama. A notable number of our samples in both species were not selected for the fnal analysis due to either failures to amplify the targeted amplicons or because of a high proportion of low-quality DNA sequences with multiple peaks making sequence editing unattainable. Therefore, only good quality DNA sequences were used in our nucleotide alignments and phylogenetic analyses, which prevented us from estimating the allelic and genotypic frequencies of kdr mutations found in Ae. aegypti mosquitoes from Panama. Authors using methods similar to ours have reported analogous challenges (Murcia et al. 2019). The fact that every individual mosquito has multiple copies of VGSC IR substitutions and that our procedure did not involve cloning may help to partially explain this outcome (Kushwah et al. 2015, 2020). Despite the methodological difficulties, we recovered 124 VGSC gene sequences from Ae. aegypti and 53 from Ae. albopictus, which were collected in 27 and 12 different geographic locations, respectively, spanning 8 of 10 provinces across the entire country of Panama (Fig. 2).

We detected 2 nonsynonymous kdr mutations in the second and third domains of the VGSC gene of Ae. aegypti. The V1016I was present in all 124 Ae. aegypti specimens that were successfully sequenced for the IIS5-S6 region. These mosquitoes were gathered from independent houses in 8 discrete rural communities and 19 garages that trade used tires along Panama’s main highway system (Fig. 2; Table 2). Additionally, the V1016I and F1534C mutations were present in all 29 Ae. aegypti specimens gathered from 9 garages and 6 rural communities that were successfully sequenced for both the IIS5-S6 and IIIS6 regions (Fig. 2; Table 2).

The lower proportion of Ae. aegypti mosquitoes that carry both the V1016I and F1534C mutations in our data set compared to the total number analyzed is most likely underestimated since we were unable to obtain high-quality IIIS6 region sequences for the 101 mosquitoes that were initially sequenced for the IIS5-S6 region (Table 2). This could imply that an even higher percentage of specimens with both kdr mutations may be found throughout Panama. Notwithstanding this fact, the Ae. aegypti specimens carrying these 2 mutations were collected from all 8 provinces of the study, including 15 of 27 (55.0%) of the sampling locations. This confirms that the V1016I-F1534C kdr variant of Ae. aegypti, which has been linked to pyrethroid resistance in populations from Brazil, Mexico, and Costa Rica (Grossman et al. 2019, Costa et al. 2020, Zardkoohi et al. 2019), is widely distributed throughout Panama (Fig. 2; Table 2).

Our results largely agree with past studies that have detected the V1016I-F1534C variant at high frequencies in Ae. aegypti from the Americas but failed to detect the V1016G mutation (Moyes et al. 2017, Saavedra-Rodriguez et al. 2018, Kandel et al. 2019, Zardkoohi et al. 2019). López (2018) and Zardkoohi et al. (2019) revealed the existence of nonsynonymous kdr mutations in the VGSC gene of Ae. aegypti samples from Central America. The V1016I and F1534C mutations were found at medium and high frequencies, respectively, in field gathered mosquitoes from Guatemala, Costa Rica, and Panama exposed to permethrin and deltamethrin in experimental bioassays. These 2 mutations though were detected only from a limited number of localities within these countries, including just one site from western Panama City, and no further efforts were made to delineate their local or regional geographic distributions. Moreover, 2 novel kdr mutations (i.e., I1011M and V1016G) were detected by (Murcia 2017, 2019) in a single Ae. aegypti specimen gathered from the Panama City metropolitan area. Nonetheless, samples of Ae. aegypti that we sequenced from the same region of Panama did not contain either of these 2 mutations. We were unable to use the Ae. aegypti sequence that was reported by Murcia et al. (2019) to compare with our samples because this sequence was not available in GenBank. The V1016G mutation has been reported at a high frequency in Ae. aegypti from Asian countries (Schmidt et al. 2019, Endersby-Harshman et al. 2020). However, the V1016I mutation is the most common and widely distributed mutation at position 1016 of the VGSC gene in the Americas, whereas the V1016G mutation has not yet spread throughout the continent (Moyes et al. 2017, Saavedra-Rodriguez et al. 2018, Kandel et al. 2019).

Aedes aegypti can develop resistance to all existing insecticide types, with geographical patterns of resistance determined by local environmental factors, vector control tactics, and the active and passive movement of mosquitoes (Carvalho and Moreira 2017, Costa et al. 2020, Endersby-Harshman et al. 2020). Local populations of Ae. aegypti may develop insecticide resistance after years of continuous selection pressure brought on by the extensive use of chemicals, as has occurred historically in Panama City (Cáceres et al. 2013, Tuñon et al. 2024). Alternatively, resistance can be introduced when mosquitoes carrying genetic traits linked to resistance are imported from abroad (Schmidt et al. 2019, Endersby-Harshman et al. 2020). This last scenario makes mosquito invasion and local dispersal crucial mechanisms that may reduce the effectiveness of vector control approaches based on synthetic insecticides (Schmidt et al. 2019, Endersby-Harshman et al. 2020, Love et al. 2023). However, public health policies to monitor insecticide resistance across space, and in particular the movement of kdr variants, are typically underutilized in countries where Aedes mosquitoes are prevalent. Routine insecticide resistance monitoring and the use of insecticide resistance management strategies can mitigate the spread of resistance and promote longer-term effectiveness of traditional vector control methods (Tuñon et al. 2024).

Our findings demonstrate the broad spatial occurrence of the V1016I-F1534C variant of Ae. aegypti, are in line with the strong spatial linkage pattern that is anticipated for populations of Ae. aegypti and Ae. albopictus in Panama. Earlier studies supported the notion that garages trading used tires on the main highways of Panama have enabled the passive mobility of Aedes species through human-assisted transport (Miller and Loaiza 2015, Eskildsen et al. 2018, Bennett et al. 2019). The high percentage of Aedes infestations in these garages confirmed the importance of the local transportation network and the used tire industry as a shared habitat for the proliferation of both Aedes species, with trade providing ample opportunities for geographical dissemination (Bennett et al. 2019). Arguably, this mode of passive dispersion could have contributed to the widespread geographic distribution of the kdr mutations observed in populations of Ae. aegypti across Panama. For example, since insecticide treatment is applied as a reactive tactic to reduce vector density when epidemics of dengue occur in Panama City, rather than being applied consistently and systematically throughout the entire country (Whiteman et al. 2019), we posit that our outcomes cannot be easily explained by the independent evolution of kdr mutation in spatially segregated populations throughout Panama. Instead, more plausible is the notion that these mutations have been imported along with invasive populations of Ae. aegypti and shuffled around into rural communities across the country via the transport of goods carrying mosquitoes, including primarily used tires (Miller and Loaiza 2015, Eskildsen et al. 2018, Bennett et al. 2019).

The contrasting hypotheses of kdr mutations emerging independently as a result of heterogeneous insecticide pressure and de novo evolution in local Ae. aegypti populations against the possibility of long-distance dispersal among populations as the conduit facilitating the invasion of these mutations were tested in the Indo-Pacific region (Schmidt et al. 2019, Endersby-Harshman et al. 2020). Findings from these studies demonstrated that genome-wide single nucleotide polymorphism (SNP) variation was shaped by the mosquito country of origin, while SNP variation within the VGSC gene was shaped by the mosquito resistance profile. These results further indicated that molecular variation near kdr mutations has been shuffled between populations via linked selection, confirming that genetic invasions have contributed to the widespread distribution of VGSC alleles in this vector (Schmidt et al. 2019, Endersby-Harshman et al. 2020). Based on these outcomes, we argue here that the international importation and further dissemination of used tires carrying mosquitoes with kdr mutations from the ports of Balboa and Limon, located in the cities of Panama and Colon, respectively, to distributor garages for the resale of used tires along the Transisthmian and Pan-American highways is a highly plausible scenario explaining the widespread geographic distribution of Ae. aegypti’s kdr variants in Panama.

Although the phenotypic resistance of mosquitoes harboring kdr variants was not determined in this study using the CDC glass bottle bioassay or the WHO standard insecticide tube test as in prior work (Zardkoohi et al. 2019), the widespread geographic distribution of the V1016I-F1534C Ae. aegypti variant in Panama could potentially limit the effectiveness of chemical control nationwide if these populations are also phenotypically resistant (Eskildsen et al. 2018; Zardkoohi et al. 2019). Furthermore, in preparation for the deployment of Wolbachia-transinfected Ae. aegypti or transgenic RIDL Aedes aegypti mosquitoes in Panama, local health authorities need to consider the impact that the occurrence of the V1016I-F1534C variant could potentially have on these 2 modern vector control strategies. For example, local Ae. aegypti populations might have a higher fitness due to their acquired resilience to insecticide treatment than recently introduced ones; thus, further adjustments to the population replacement and reduction strategies, respectively, will need to be made to guarantee that they remain efficient, cost-effective, and sustainable in the longer term to reduce arbovirus transmission.

Findings highlight the potential significance of human-assisted dispersal in the dissemination of genetic traits that may confer insecticide resistance in Aedes mosquitoes (Schmidt et al. 2019, Endersby-Harshman et al. 2020, Love et al. 2023). They also emphasize the importance of a surveillance system that can monitor the invasion and spread of Aedes mosquitoes in Panama as well as the introduction and dissemination of nonsynonymous kdr mutations in mosquitoes from the ports surrounding the Panama Canal and near the main highways of the country. A new surveillance strategy, for example, may aid in detecting the initial incursion of Aedes vittatus (Bigot) (Diptera: Culicidae) in Panama, an African arbovirus vector that was recently identified in the Caribbean and may also be resistant to chemical treatment (Pagac et al. 2021). In brief, monitoring the entry of novel kdr mutations into the country and controlling the passive transit of Aedes along Panama’s roadways will be essential to ensuring the effectiveness and sustainability of MINSA’s chemical control methods in the long term (Schmidt et al. 2019, Tuñon et al. 2024).

In agreement with previous research efforts, we did not detect the presence of nonsynonymous kdr mutations in Panamanian samples of Ae. albopictus. According to preliminary research by Valderrama et al. (2016), Ae. albopictus specimens from Tocumen and Chepo in the province of Panama and from Arco Iris in the province of Colon did not have kdr mutations, although this study did not specify the number of mosquitoes analyzed. Similarly, between 2017 and 2019, Murcia and collaborators (Murcia 2017, Murcia et al. 2019) found no kdr mutations in 71 Ae. albopictus from 4 locations in the province of Panama (Bethania, Garzas de Pacora, Nuevo Chorrillo, and Lluvia de Oro). The lack of kdr mutations in invasive Ae. albopictus could be a regional phenomenon because Chaves et al. (2015) did not detect nonsynonymous kdr mutations in 56 specimens of Ae. albopictus gathered from Sarapiquí, where this species was first reported in Costa Rica. The fact that Ae. albopictus invaded Panama and Costa Rica more recently than it did the United States or Brazil (Miller and Loaiza 2015) may help to explain why populations from lower Mesoamerica do not have nonsynonymous kdr mutations. In the United States and Brazil, the vector’s earlier incursion may have favored the introduction of these mutations through multiple invasion events or as a result of greater insecticide exposure over time (Eskildsen et al. 2018). Future studies should monitor the incursion of the S989P, S989T, S989Y, S1000Y, I1011V, V1016G, 1532T, 1534C, 1534S, and 1534L mutations in populations of Ae. albopictus from Panama and also elsewhere in Mesoamerica (Kushwah et al. 2015, Chen et al. 2016, Moyes et al. 2017, Auteri et al. 2018, Rath et al. 2018, Zhou et al. 2019).

Conclusion

We have conducted the first comprehensive study of nonsynonymous kdr mutations in Aedes mosquitoes from Panama. We have confirmed the presence of the V016I-F1534C variant in Panamanian populations of Ae. aegypti. This variant was seen across a large geographic area, including 6 rural communities and 9 used-tire trading garages along the nation’s primary highway network. The wide geographic distribution of the V1016I-F1534C variant in Panama could be associated with the introduction of Ae. aegypti carrying these mutations and their subsequent spread throughout the country, which could be due to passive dispersal that is facilitated by the trade of used tires along the nation’s major highways. This is a more plausible scenario than the independent occurrence of these mutations in different parts of the country due to a general lack of routine Aedes control with insecticides. Nonetheless, selection on de novo substitution of kdr mutations and the introduction and passive movement of kdr mutations into new areas of Panama are not mutually exclusive evolutionary and ecological processes; they can occur in juxtaposition. Selection of resistance mutations will take place regardless of whether the mutations are de novo substitutions or have spread by gene flow, and it will generally favor the resistant alleles where insecticide use is high but disfavor them where insecticides are not frequently being used. No additional kdr mutations were found in the samples of Ae. aegypti or Ae. albopictus from Panama, including V1016G, which was reported previously in one individual Ae. aegypti from the province of Panama. Future research should monitor the introduction of additional kdr mutations such as I1011M and V1016G in local Ae. aegypti populations in addition to kdr mutations in Ae. albopictus. To achieve this aim, molecular surveillance as part of insecticide resistance monitoring and mitigation strategy is warranted.