Anticancer effects of purple carrot extract via induction of apoptotic genes on human breast cancer cells

Abstract

This study investigated the anticancer effects of purple carrot extract (PCE) and its key bioactive substance, chlorogenic acid (CHA), on MDA-MB-231 cells and elucidated the mechanisms of apoptosis and anticancer activity. The effects of CHA treatment on the growth of HEK-293 and MDA-MB-231 cells were assessed, and CHA selectively inhibited the growth of MDA-MB-231, indicating specific inhibitory effect on breast cancer. When PCE and CHA were treated to MDA-MB-231 cells, an increase in in the expression of apoptosis-related genes and proteins, including Bcl-2-associated x (Bax), and caspase-9, while the expression of B-cell lymphoma-2 (Bcl-2) decreased (p < 0.05). In conclusion, the study substantiates the potential of CHA, a key bioactive substance in PCE, as a potent anticancer agent, highlighting its superior efficacy in inhibiting breast cancer cell growth through the regulation of apoptosis-related genes and protein expression.

Introduction

According to the World Health Organization (WHO), breast cancer is a commonly diagnosed malignancy among women worldwide, with approximately 2.3 million cases of breast cancer and 680,000 associated deaths recorded in 2020 (Mattiuzzi and Lippi, 2020). These statistics emphasize the substantial global impact of breast cancer on women's health, highlighting the urgent need for effective prevention and treatment strategies. Age constitutes critical aspect in the development breast cancer, as exposure to various risk factors accumulates over time, elevating the likelihood of genetic mutations and, consequently, the risk of developing breast cancer (Feng et al., 2018). An individual's habits, smoking, excessive alcohol consumption and, physical inactivity, can compound the risk factors associated with this disease, emphasizing the intricate nature of breast cancer's etiology (Taha and Eltom, 2018). Breast tissue is composed of lobules, ducts, and connective tissue, and when the proliferation and growth of breast cells increases abnormally, cancer cells can rapidly divide, leading to the development of breast cancer (Sun, 2021). In the initial stages, breast cancer typically lacks symptoms, and self-diagnosis and early detection remains challenging; nonetheless, if left untreated, it can progress to invasive breast cancer that can metastasize to bones, lungs, liver, and other organs via blood and lymphatic vessels (Chen et al., 2021). Therefore, there is growing need for research on the early detection and treatment of breast cancer, emphasizing the importance of discovering various natural therapeutic materials and inducing apoptosis through the regulation of key oncogenes to prevent and treat cancer (Darvish et al., 2023).

Apoptosis is the process of spontaneous cell death triggered by internal or external changes or stress, which is induced through the mitogen-activated protein kinase (MAPK) pathway (Haykal et al., 2019). In situations of cellular stress, the MAPK pathway transmits signals that induce apoptosis through the phosphorylation of p53, a protein present in the cytoplasm, and the facilitation of its movement into the nucleus (Whitaker and Cook, 2021). Located within the cell's nucleus, the p53 plays a crucial role in apoptosis induction by binding to the gene promoters initiating programmed cell death (Almeida et al., 2021). This binding triggers a series of events within the cell, which interact with B-cell lymphoma 2 (Bcl-2) located in the mitochondrial outer membrane, leading to accumulation of Bcl-2-related x (Bax) and activation of the apoptotic pathway. The Bax, operating primarily within the intrinsic apoptosis pathway, binds to the outer mitochondrial membrane, increasing its permeability (Aslam et al., 2021). This action induces the release of cytochrome-C, which, in turn, activates caspase-9, leading to the formation of apoptotic bodies (Santucci et al., 2019). As caspase-9 becomes active, it initiates a series of enzymatic reactions, resulting in the formation of apoptotic bodies, generated as a result of Bax-mediated mitochondrial permeability and cytochrome-C release, ultimately leading to the orderly and controlled process of cell death, known as apoptosis (Che and Lin, 2022).

Etoposide, paclitaxel, and doxorubicin are anticancer drugs used for the treatment of various types of cancer, including lung cancer, breast cancer, ovarian cancer, and leukemia, by inhibiting or destroying the growth of cancer cells based on inducing cell apoptosis (Ghafouri-Fard et al., 2021). Each drug has a specific mechanism of action that effectively targets different cancer types, including inhibition of DNA topoisomerase enzymes, stabilization of microtubule, interaction with DNA, and generation of reactive oxygen species (ROS) to inhibit carcinoma growth (Das et al., 2022). However, the use of these anticancer agents can cause side effects, including leukopenia and thrombocytopenia, damage to blood and reproductive cells, hematological disorders, renal damage, auditory impairment, nausea, and hair follicle damage (Basak et al., 2022). Thus, the increasing demand for nature-derived anticancer agents is driven by the need to find compounds that have potent anticancer properties with reduced side effects that are commonly associated with synthetic drugs.

In the realm of plant classification, purple carrots, classified as Daucus carota. Sativus, are edible, underground roots that belong to the Apiaceae family (Rasheed et al., 2022). Purple carrots are an excellent source of beta-carotene and contain manganese, vitamin C, potassium, and fiber and also contain various bioactive substances, including anthocyanins, carotenoids, polyphenols, and vitamins [16]. Due to the various health benefits these compounds offer, including antioxidative, anti-inflammatory, anticancer, and immune-boosting properties, recent studies have actively investigated various nutrients and bioactive substances in purple carrots (Mizgier et al., 2016). However, the main bioactive substances and the anticancer effects and apoptotic mechanisms of the components of purple carrots are not yet fully understood. Therefore, further in-depth research is needed to better understand the potential anticancer properties of purple carrots. This study aimed to investigate the anticancer effects of purple carrot extract (PCE) and its main bioactive substance, chlorogenic acid (CHA), as well as to elucidate the mechanisms underlying apoptosis and anticancer activity, focusing on key genes such as p53 and Bax, as well as to elucidate the mechanisms underlying apoptosis and anticancer activity. The findings from this study provide essential data for the potential use of PCE and its main bioactive substance as functional food ingredients and potential anticancer agents.

Materials and methods

Raw materials and reagents

The purple carrots used in this study were purchased as dried powder from Purunsan agricultural corporation (Seoul, Korea) and were extracted using 99.5% v/v ethanol (Duksan, Gapyoung, Korea). Fetal bovine serum (FBS), Dulbecco’s modified eagle medium (DMEM), and 0.05% trypsin–EDTA used for cell culture and cytotoxicity evaluation were purchased from Thermo Fisher (Waltham, MA, USA). 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl-tetrazolium bromide (MTT), dimethyl sulfoxide (DMSO), 2 N Folin-ciocalteu, potassium acetate, aluminum chloride, 2,2-diphenyl-1-picrylhydrazyl (DPPH), citric acid, gallic acid, quercetin, ascorbic acid, acetonitrile, and acetic acid required for the measurement of antioxidant activity and HPLC analysis were purchased from Sigma-Aldrich (St. Louis, MO, USA).

Ultrasound-assisted extraction (UAE)

The purple carrot was dried in convection oven (VS-1202D4N, Vision Bionex, Bucheon, Korea) at 60 ± 1 ℃ until there was no further weight change, then pulverized to 40 mesh size or smaller (> 0.381 mm) using a food processor (HMF-3000S, Hanil Electric, Seoul, Korea). To extract prepare the extract, 1 g of purple carrot powder and 20 mL of 50% v/v ethanol were mixed in a pressure vessel (Pyrex -1636, Scilab, Seoul, Korea). This mixture was subjected to sonication using a tabletop ultrasound processor (SD-250H, Sungdong, Hwaseong, Korea) operating at an output frequency of 40 kHz 60 °C for 30 min. Following the sonication process, the resulting extract was centrifuged at 2800 × g for 10 min using a centrifuge (1236R, Labogene, Daejeon, Korea), the collected supernatant and stored at − 21 °C for further analysis and subsequent use.

In subsequent experiments, the stock solution was diluted to the required concentrations (μg/mL) for use. The concentration of the initial stock solution was calculated based on the dry weight of the purple carrot powder used and the volume of ethanol solvent. The final concentrations of PCE used in all experiments were adjusted to μg/mL by diluting this stock solution.

Measurement of total polyphenol content (TPC)

TPC analysis was conducted with slight modifications to the existing colorimetric method that assesses the extent to which polyphenols in the extract reduce the Folin-ciocalteu phenol reagent (Ainsworth and Gillespie, 2007). After mixing 0.7 mL of 0.2 N Folin-ciocalteu’s phenol reagent with 0.14 mL of PCE, and the mixture was allowed to react for 8 min. Subsequently, 0.56 mL of 7.5% Na₂CO₃ was added, and the reaction was continued for 60 min. The absorbance of the mixture was measured at 765 nm in spectrophotometer (Optizen 2120 UV, Mecasys Co., Daejeon, Korea), and the TPC was expressed as mg gallic acid equivalent (GAE)/g dry matter (DM) using standard calibration curve plotted by gallic acid.

Measurement of total flavonoid content (TFC)

The determination of TFC using aluminum chloride is a vital analytical method for quantifying flavonoid levels in plant samples (Jeong et al., 2018). 0.1 mL of PCE, 0.56 mL of DW and 0.3 mL of 99.5% v/v ethanol were added, and 1 M potassium acetate and 10.0% aluminum chloride were sequentially added by 0.02 mL each for a color development. The mixture reacted for 30 min to induce color development, and absorbance was measured at 415 nm in a spectrometer. TFC was quantified as a relative concentration with mg quercetin equivalent (QE)/g DM through a standard calibration curve using quercetin.

Measurement of DPPH radical scavenging activity (DSA)

The assessment of free radical scavenging activity involved a comprehensive analysis that evaluated the reduction of a solution. This reduction process led to a noticeable change in color, transitioning from purple to yellow, and served as an indicator of the sample's antioxidant capacity. After adjusting the absorbance of the DPPH solution diluted with methanol at 1.00 (± 0.02), 1.25 mL of 0.1 mM DPPH was added to 0.25 mL of PCE or CA. After the mixture was allowed to react under dark conditions for 20 min, absorbance was measured at 517 nm. For the quantification of free radical scavenging activity, ascorbic acid was used as a positive control to DSA by the following.

$$\text{DSA}\left(\text{\%},\right)=\left(1-\frac{\text{Absorbance of PCE}}{\text{Absorbance of control group}}\right)\times 100$$ 1

Measurement of ABTS radical scavenging activity (ASA)

The cation radical scavenging activity was assessed through the reduction of the ABTS⁺ to ABTS using the ABTS radical cation decolorization assay. 20 mL of 7 mM ABTS and 0.352 mL of 140 mM potassium persulfate were mixed and allowed to form ABTS cations by reacting under dark conditions for 14 h. The reaction solution was diluted with ethanol to adjust the absorbance value to 0.7 (± 0.02), at 734 nm, mixed with 50 µL of PCE, and reacted under dark conditions for 2.5 min. The absorbance of the reaction product was measured at 734 nm, and for quantification, ascorbic acid was used as a positive control to assess ASA by the following method.

$$\text{ASA}\left(\text{\%}\right)=\left(1-\frac{\text{Absorbance of PCE}}{\text{Absorbance of control group}}\right)\times 100$$ 2

Qualification of bioactive substance using LC–MS/MS

For the analysis of bioactive substance in the PCE, the sample was filtered through a 0.22 µm syringe filter (Hyundai Micro Co., Ltd., Seoul, Korea) and subjected to qualitative analysis using LC–MS/MS with an ROC C18 column (3.0 × 150 mm, Restek Ltd., PA, USA) installed in the Finnigan TSQ Quantum system (Thermo Fisher). The mobile phase composition for separation of phenolic substance was as follows: 1.0% formic acid/distilled water (mobile phase A) and 1.0% formic acid/acetonitrile (mobile phase B) with a gradient change over time: 0 ~ 11 min: 95.0 → 0.0% A, 11 ~ 14 min: 0.0 → 0.0% A, 14 ~ 15 min: 0.0 → 95.0% A, and 15 ~ 20 min: 95.0 → 9.0% A. The filtered sample (10 µL) was injected, and the flow rate of the mobile phase was fixed at 0.2 mL/min. The column temperature was set at 30℃ for the analysis. Electrospray ionization (ESI) in the negative ion mode was employed, and full scan mode was used to collect mass spectra information in the range of 50 ~ 800 m/z.

Quantification of bioactive substance using HPLC

To detect bioactive substance contained in purple carrots, the PCE was filtered with a 0.22 µm syringe filter (PVDF2025A, Hyundai Micro Co., Seoul, Korea), and HPLC analysis was performed using a Poroshell 120 EC-C18 column (4.6 mm × 150 mm, Agilent Tech., CA, USA). Mobile phases were used by changing the mixing ratio of mobile phase A (99.9% acetonitrile) and B (1.0% acetic acid) according to the separation time. For identification of bioactive substance in extract, the flow rate was fixed at 0.5 mL/min for the comparison of retention time (RT), and the comparison of absorption spectrum was applied to reconfirm the substance identified based on retention time at 190 ~ 640 nm using diode array detector (DAD). The RT and absorption spectrum were compared with a polyphenol standard material, and quantitative analysis was conducted using a calibration curve based on the peak area.

Cell culture

For the evaluation of gene expression related to anticancer activity, human embryonic kidney 293 (HEK-293) and cancer cells (MDA-MB-231, HepG2, Hep3B and B16F10) were purchased from the Korean cell line bank (Seoul, Korea) and used for cell culture. For the subculture of each cell line, the cells were seeded at a density of 2.5 × 10⁴ cells/mL in culture flasks containing DMEM supplemented with 10.0% FBS and 1.0% penicillin. The cells were maintained in a CO₂ incubator (SA-MCO-18AIC, Sanyo Co., Osaka, Japan) at 37℃ with 5.0% CO₂, and subcultured every 3 days.

Measurement of cell activity

To evaluate the effects of PCE and CHA on the cell activity of both cancer cells (MDA-MB-231, HepG2, Hep3B and B16F10) and HEK-293, cell lines were seeded in 96-well plates at a density of 2.0 × 10³ cells per well and cultured for 24 h. PCE and CHA were diluted to concentrations ranging from 15 μg/mL to 500 μg/mL, and each cell line was treated with 0.02 mL of the respective dilutions. Subsequently, the cells were further incubated for 72 h. For the cell activity assay, 0.1 mL of MTT solution was added to each well and incubated for 4 h. Afterward, 0.1 mL of DMSO was added to dissolve the formazan crystals formed by viable cells. The absorbance was measured at 450 nm using a microplate reader (AMR-100, Allsheng Co., Seoul, Korea) and cell activity was calculated using the following formula.

$$\text{Cell activity}\left(\%\right)=\left(1-\frac{\text{Absorbance of PCE}}{\text{Absorbance of control group}}\right)\times 100$$ 3

Measurement of apoptotic gene expression

To investigate the anticancer effect of PCE on MDA-MB-231, the cells were cultured in a 24-well plate at a density of 1.0 × 10⁵ cells/mL and treated with PCE and CHA or 24 h. Subsequently, RNA was extracted using the Accuprep® universal RNA extraction kit (Bioneer, Daejeon, Korea). Extracted RNA was mixed with cDNA synthesis buffer, cDNA synthesis enzyme mix, and diethylpyrocarbonate (DEPC) to achieve a final volume of 20.0 μL. After mixing 1.0 μL of synthesized cDNA and 10.0 μL of PowerUP™ SYBR® Green Master Mix (Applied Biosystems, Waltham, MA, USA), 1.0 μL each of primers for apoptosis-related genes were added, and the final volume was adjusted to 20.0 μL with DEPC. The key apoptosis-related genes, namely p53, Bax, Bcl-2, caspase-9, JNK, and ERK, were amplified using reverse transcription-PCR, and GAPDH was used as a housekeeping gene (Table 1). The real time-polymerase chain reaction (RT-PCR) conditions for gene amplification consisted of denaturation at 95 °C for 10 min, followed by annealing at 62 °C for 1 min, and extension at 72 °C for 30 s, and a total of 60 amplification cycles were performed under these conditions. The analysis was performed using the comparative C_t method, and the resulting C_t values were used to conduct relative quantification for each gene using the 2^−∆∆CT method. ∆C_T

$$\mathrm{\Delta }{C}_t=[C_t\left(\text{Target gene}\right)-C_t\left(\text{Housekeeping gene}\right)$$ 4

$$2^{-\mathrm{\Delta }\mathrm{\Delta }{C}_t}=\left(\frac{1^{\mathrm{\Delta }{C}_t}=[C_t\left(\text{Target gene}\right)-C_t\left(\text{Housekeeping gene}\right)]}{2}\right)$$ 5

Table 1.

The primer sequences for evaluating the gene expressions of the major anticancer-related genes, p53, Bax, Bcl-2, caspase-9, JNK, and ERK, using real time-polymerase chain reaction

Primers	Forward (5'-3')	Reverse (3'-5')
P53	CCCATCCTCACCATCATCACAC	GCACAAACACGCACCTCAAAG
Bax1)	GAGCTGCAGAGGATGATGATTCG	AAGTTGCCGTCAGAAAACACG
Bcl-22)	ATTGGGAAGTTTCAAATCACG	TCTATTCCTCTGTGATGTGT
caspase-9	AAC AGG CAA GCA GCA AAG TTG	CTG CTC GAC ATC ACC AAA TCC
JNK3)	GCC TCC TGT GAC CTC GAG ATC	GAA GCC GAA ATA GCA GCT GTT G
ERK4)	ACG CTC AAG TCG GGC TAC AC	CTC CAT GAA CTC GGT GAT GAT C
GAPDH5)	GATGGGCATGAAGCATGAGA	TGGCATGGACTGTGGTCATT

¹⁾Bax Bcl-2 associated x, ²⁾Bcl-2 B-cell lymphoma-2, ³⁾JNK Jun N-terminal kinase, ⁴⁾ERK Extracellular signal-regulated kinase , ⁵⁾GAPDH glyceraldehyde-3-phosphate dehydrogenase

Measurement of apoptotic protein expression

To investigate the anticancer effect of PCE on MDA-MB-231, the cells were cultured in a 24-well plate at a density of 1.0 × 10⁶ cells/mL and treated with PCE and CHA or 24 h. Subsequently, for the isolation of proteins from growing cells, HEPES buffer solution was used, and protein quantification was performed using the Bradford method with BSA (Bio-Rad, Hercules, USA) as the standard. A quantified amount of 25 μg of skin regeneration protein was subjected to electrophoresis on a 10% SDS–polyacrylamide gel, followed by transfer to a polyvinylidene fluoride (PVDF) membrane.

To prevent non-specific binding of antibodies to the PVDF membrane, blocking was performed using 5% skim milk at room temperature for 1 h. Each primary antibody was diluted 1: 1,000 μL in 5% skim milk, reacted for 3 h, and then washed 5 times for 5 min with PBS-T containing 0.1% Tween® 20. Afterward, the membrane was washed 5 times for 5 min each with PBS-T containing 0.1% Tween® 20, followed by a 4 h incubation with the secondary antibody diluted 1: 1000—2000 in 5% skim milk. For antibody detection, enhanced chemiluminescence (ECL) solution was used to induce color development, and the resulting bands were quantified using the KwikQuant Pro Multi-Image (D1010, Kindle Bio, Boston, USA) and KwikQuant Image Analyzer Ver. 5.9 (Kindle Bio, Boston, USA).

Statistical analysis

For the functional evaluation of PCE, all experimental data were performed in triplicate and expressed as mean ± standard deviation. Statistical analysis was conducted using GraphPad Prism software (Ver. 5.0, GraphPad Software Inc., San Diego, CA, USA) to calculate the mean, standard deviation, and statistical significance. The significance of the experimental groups was assessed using Student's t-test and one-way analysis of variance (ANOVA), considering p < 0.05 as statistically significant.

Experimental results and discussion

Evaluation of antioxidant effect

ROS, which are highly reactive oxygen radicals involved in essential biological processes, can cause oxidative stress leading to cellular damage and diseases like cancer when their levels exceed the body’s antioxidant defenses (Bisht and Dada, 2017; Zhang et al., 2022). Antioxidant activity is intricately linked to anticancer activity, as antioxidants neutralize reactive oxygen species (ROS), reducing oxidative stress that can lead to DNA damage and cancer development. For instance, polyphenols, known for their strong antioxidant properties, have been shown to induce apoptosis in cancer cells, thereby inhibiting tumor growth (Russo et al., 2010). A specific example includes green tea catechins, such as epigallocatechin-3-gallate (EGCG), which have demonstrated significant anticancer effects by both scavenging ROS and suppressing cancer cell proliferation (Singh et al., 2011). Therefore, to validate PCE's anticancer potential associated with its antioxidant properties, it was important to measure the levels of polyphenols and flavonoids, secondary metabolites in plants known for their antioxidant capabilities. To this end, assessing their antioxidant capacity through the evaluation of electron-donating ability was essential.

Based on TPC evaluation, the polyphenol content in PCE (50 mg/mL) was measured at 17.13 ± 0.25 mg GAE/g DM, which was 1.4 times higher than that in pomegranate peel extract (Magangana et al., 2021). Additionally, the flavonoid content in PCE (50 mg/mL) was measured at 0.54 ± 0.02 mg QE/g DM, which was 1.7 times higher than that in Carthamus Tinctorius seed extract from previous studies (Kim et al., 2022). These results indicate that PCE contains a significantly higher amount of polyphenol metabolites, suggesting its superior antioxidant effect as compared with existing natural extracts (Fig. 1A, B).

Fig. 1.

Evaluation of the effect of purple carrot extract (PCE) on total polyphenol content (TPC) (A) total flavonoid content (TFC) (B) DPPH radical scavenging activity (DSA) (C) ABTS radical scavenging activity (ASA) (D) of purple carrot extract (PCE). Concentrations of PCE and ascorbic acid used were both 50 mg/mL, and all values were repeated three times and expressed as mean ± standard deviation

Therefore, the antioxidant activity was compared using DPPH and ABTS methods, which are known to generate free radicals and cation radicals, respectively. Based on the evaluation of free radical scavenging activity using DSA, PCE (50 mg/mL) was measured at 71.63 ± 1.15%, which is 2.2 times higher than that of parsley extract and 1.7 times higher than that of bee pollen extract (Fig. 1C) (Choi et al., 2017; Lee et al., 2022). In addition, the assessment of free radical scavenging activity using ASA revealed that PCE (50 mg/mL) was measured at 48.16 ± 1.59%, a value similar to that of Valoniopsis pachynema extract (Fig. 1D) (Kavitha et al., 2015). These variations in antioxidant activity are likely due to the specific types of polyphenols in PCE and their differing abilities to bind to free radicals and cation radical (Kim et al., 2019). The antioxidant effect of PCE, with its excellent scavenging ability against free and cation radicals, is attributed to its polyphenols and flavonoids, suggesting its potential as a promising antioxidant candidate.

Cancer cells possess abnormal oxygen metabolism and redox systems, obtaining energy through glycolysis under aerobic conditions and accumulating ROS to activate cancer genes (Choi, 2013). Therefore, it was anticipated that PCE, rich in polyphenols and flavonoids, would effectively eliminate ROS and potentially demonstrate anticancer effects. To validate this, further investigations were conducted to analyze the main bioactive substances of PCE and assess apoptotic genes.

Identification of bioactive substance

To explore the bioactive substance of PCE, qualitative analysis was performed using LC–MS/MS based on molecular weight distribution in negative ion mode, measuring protonated molecules with one proton loss at m/z values. According to the Fig. 2-A, a compound with a molecular weight (MW) of 353.0 was identified, which was predicted to be from where one hydrogen atom was detached from CHA (MW 354.0) (Salman et al., 2018).

Fig. 2.

LC–MS/MS and HPLC chromatogram for quantitative and qualitative analysis of bioactive substance in purple carrot extract (PCE). (A) LC–MS/MS spectrum of fragmentation pattern of chlorogenic acid in PCE (MW 354.0), (B) HPLC chromatogram and DAD spectrum of PCE, (C) HPLC chromatogram and DAD spectrum of chlorogenic acid standard

Additionally, the detection of a molecular weight of 191.0 in the spectrum suggested the presence of quinic acid (MW 192.1), indicating that quinic acid, a subunit of caffeic acid (MW 164.0), was detached from CHA (Maazoun et al., 2017). CHA is a naturally occurring polyphenolic compound that is abundantly found in a wide range of plant species. It exerts its antioxidant effects by neutralizing reactive oxygen species (ROS) like superoxide anions and hydroxyl radicals, converting them into less harmful oxidation byproducts, including H₂O, CO₂, thio compounds, or nitrogen oxides through a reduction process (Eghbaliferiz and Iranshahi, 2016).

Generally, polyphenols effectively scavenge ROS and exhibit anticancer effects by modulating different enzymes, including DNA polymerase, RNA polymerase, cyclooxygenase, and catalase, preventing their dysfunction and destruction, thus demonstrating their anticancer properties (Kovacic and Osuna Jr, 2000). Additionally, polyphenols possess anti-inflammatory properties and reduce chronic inflammation associated with cancer development. They promote apoptosis, regulate the cell cycle to inhibit abnormal cell growth, and hinder angiogenesis, impeding the formation of blood vessels that nourish tumors. Moreover, polyphenols may obstruct metastasis, particularly making them relevant for hormone-dependent cancers, and potentially modulating the hormone levels. Therefore, PCE containing CHA is considered a candidate for nature-derived anticancer agents because of its antioxidant properties. Therefore, in the following experiment, additional qualitative and quantitative analyses using high-performance liquid chromatography (HPLC) conducted to reconfirm that CHA is the primary bioactive substance in PCE.

Quantitation of bioactive substance

To validate the previous results of LC–MS/MS analysis, qualitative and quantitative analyses were conducted using HPLC based on RT and absorbance characteristics of the substance. The RT of the main peak detected in PCE was 11.527 min, which was highly consistent with that of 11.530 min found for CHA, the standard (Fig. 2B, C). Upon analyzing this peak using DAD-based spectra, the maximum absorption wavelength was confirmed to be 325 nm, and the absorbance pattern matched, thus reconfirming that CHA is the main bioactive substance in PCE. Based on the peak area of the CHA standard substance, the concentration of CHA in the extract was calculated to be 0.47 mg/g DM.

Previous studies have reported that CHA offers health benefits with various physiological effects, including antioxidant, anti-inflammatory, blood glucose regulation, blood pressure stabilization, metabolism control, and anticancer properties (Xue et al., 2023). According to a recent study, CHA inhibits tumor growth and angiogenesis in several types of malignancies by inhibiting matrix metalloproteinase-9 or inducing p38 mitogen-activated protein kinase-dependent apoptosis (Bandyopadhyay et al., 2004), (Jin et al., 2005). Furthermore, according to the findings by N. Xue et al., CHA was found to suppress the M2 polarization of macrophages and reorient them from an M2 to M1 phenotype, resulting in the inhibition of glioblastoma growth (Xue et al., 2017). These results underscore the considerable potential of CHA, a primary bioactive compound in PCE, as an anticancer agent. Therefore, it is considered essential to evaluate the apoptotic effects of PCE and CHA on cancer cells and assess their effect on the expression of apoptosis-related genes through additional experiments to elucidate the anticancer mechanisms.

Evaluation of cytotoxicity

Cytotoxicity measurements were conducted on non-cancer cells (HEK-293) and human breast cancer cells (MDA-MB-231) in the concentration range of 0.0 to 500 μg/mL to evaluate the breast cancer anticancer effect of PCE and CHA. Treatment with 60 μg/mL of PCE did not exhibit cytotoxicity in both HEK-293 and MDA-MB-231 cells, while treatment with 125 μg/mL of PCE resulted in a significant decrease in cell viability in both cell types, with reductions of 89.9% and 86.5%, respectively, compared to the untreated group (p < 0.05, Fig. 3). This underscores the importance of determining the treatment concentration, particularly at or above a specific threshold, at which natural extracts can diminish the activity of normal cells. Typically, cell cytotoxicity induces DNA damage and triggers apoptosis. The treatment of PCE equally reduced the activity of both HEK-293 and MDA-MB-231 cells, indicating a lack of selective apoptotic effects of PCE on cancer cells (Roos and Kaina 2008).

Fig. 3.

Effects of purple carrot extract (PCE) and chlorogenic acid (CHA) on the cell activity in various cancer cell lines and HEK-293 measured in the range of 30–500 ug/mL. The cell activity of non-treated group (N.T.) was expressed as 100%, and the bar value was calculated as percentage compared to the non-treated group (*p < 0.05)

Treatment of HEK-293 cells with the main bioactive compound of PCE, CHA, at a concentration of 250 μg/mL resulted in a cell activity of 97.21%, indicating the absence of cytotoxicity and that CHA does not directly induce apoptosis in normal cells (p > 0.05). However, when MDA-MB-231 cells were exposed to 250 μg/mL of CHA, the cell activity rate was 84.72%, demonstrating the selective apoptotic effect of CHA on cancer cells (p < 0.05). This is similar to previous results indicating that CHA selectively induces apoptosis in lung cancer cells without inhibiting the growth of lung fibroblasts, suggesting that CHA may also exhibit a selective apoptotic effect in various cancer cells, including breast cancer cells (Gouthamchandra et al., 2017).

Additionally, the in vitro inhibitory effects of PCE and CHA on the proliferation of various tumor cell lines (B16F10, HepG2 and Hep3B) were investigated using the MTT assay. The results indicate that both PCE and CHA exhibited broad-spectrum anticancer effects across these cell lines as well. For melanoma cells (B16F10), which are murine melanoma cells, the treatment with PCE and CHA resulted in a noticeable reduction in cell viability, demonstrating their potent anticancer properties. Similarly, human liver cancer cells (HepG2 and Hep3B), both of which are human liver cancer cell lines, showed marked decreases in proliferation upon treatment with these compounds. This suggests that the anticancer effects of PCE and CHA are not limited to a single type of cancer but are rather broad-spectrum in their action.

Notably, at a concentration of 125 μg/mL of CHA, MDA-MB-231 cells, which are human breast cancer cells, exhibited the lowest cell viability at 95.41% when compared to the other cancer cell lines tested, such as HepG2 (95.9%), Hep3B (95.71%), and B16F10 (95.6%). Additionally, at the same concentration of PCE, MDA-MB-231 cells also exhibited the lowest viability at 86.5%, compared to HepG2 (95.5%), Hep3B (90.91%), and B16F10 (88.57%) cells. This observation is important as it highlights the potential of PCE and CHA to reduce the viability of breast cancer cells more effectively than other types of cancer cells. The enhanced sensitivity of MDA-MB-231 cells could be due to specific cellular mechanisms or pathways. This finding is crucial for developing targeted breast cancer therapies, suggesting that these natural compounds could play a crucial role in devising effective treatments.

Based on these findings, CHA itself or natural products containing CHA have a high potential as valuable candidates for the development of safe and effective anticancer therapies. Therefore, to elucidate the potential anticancer effects of PCE and CHA, the expression of apoptotic genes in MDA-MB-231 cells was evaluated using non-growth-inhibitory concentrations of PCE (60 μg/mL) and CHA (125 μg/mL) or lower.

Evaluation of gene expression related to MAPK signaling pathway

The p53 and MAPK signaling pathways are essential in cancer biology for their distinct roles: p53 acts as a tumor suppressor by inducing cell cycle arrest and apoptosis in response to DNA damage, while MAPK transduces extracellular signals affecting cell growth, differentiation, and apoptosis. Their interplay ensures robust cancer defense mechanisms (Kang, 2013). Apoptosis, a highly regulated process of programmed cell death, plays a pivotal role in tumor suppression through intricate immune mechanisms designed to eliminate cancerous cells. This programmed and controlled cellular event ensures the removal of damaged or potentially harmful cells, contributing to the body’s defense against cancer development, with various genes acting in a cascade.

JNK, a gene within the MAPK pathway, enhances the initial apoptosis signal by phosphorylating nuclear transcription factors in response to stressors like DNA damage, UV radiation, inflammatory cytokines, and changes in osmotic pressure (Liu et al., 2021). Conversely, ERK is engaged in cell viability, proliferation, and growth, which implies that the deactivation of ERK results in the upsurge of apoptotic signals within cancer cells. Thus, it is speculated that PCE and CHA induce an increase in JNK expression and a decrease in ERK expression, thereby forming a positive feedback for apoptosis (Liu et al., 2023).

Therefore, to elucidate these underlying mechanisms, we examined the expression of JNK and ERK at the gene level to investigate the activation of the MAPK pathway and apoptosis induction by PCE and CHA (Fig. 4-A). In MDA-MB-231 cells treated with PCE (60 μg/mL) and CHA (120 μg/mL), the expression of JNK increased by approximately 5.09-fold and 8.7-fold, respectively, whereas the expression of ERK decreased by approximately 2.27-fold and 3.23-fold, respectively, confirming that the apoptosis-inducing effect of CHA is superior to that of PCE (p < 0.05). The exceptional apoptotic effect of CHA underscores the importance of harnessing specific bioactive substance over plant extracts, offering valuable insights for producing nature-derived anticancer agents. Based on this, the evaluation of apoptotic gene expression via CHA-induced MAPK pathway activation was conducted.

Fig. 4.

Evaluation of anticancer effect of purple carrot extract (PCE) and chlorogenic acid (CHA) through comparison of MAPK signaling pathway gene (A) and p53 signaling pathway gene (B) expression. Values presented as mean ± standard deviation; bars significantly different from controls marked with an asterisk (*p < 0.05)

Evaluation of gene expression related to p53 signaling pathway

The p53 signaling pathway in apoptosis is considered an important mechanism in cancer treatment and exerts anticancer effect by detecting abnormal cancer cells, preventing their proliferation, and inhibiting tumor growth (Fang et al., 2014). The widely acknowledged tumor suppressor gene, p53, operates by temporarily halting cell division when the cell's DNA is damaged, preventing replication until the damaged DNA is repaired, and activating signals to induce apoptosis, thereby eliminating damaged cells and exhibiting anticancer effects (Ruiz-Losada et al., 2022). This emphasizes p53 as a significant indicator of apoptosis accomplished by suppressing Bcl-2 expression, elevating Bax expression, enhancing mitochondrial outer membrane permeability, and prompting cytochrome-C release (Qian et al., 2022). After being released into the cytoplasm, cytochrome-C binds to caspase-9 and interacts with apoptotic peptidase activating factor 1 (APAF1) to form a complex that sequentially activates caspases and ultimately induces apoptosis (Tie et al., 2023).

Therefore, to assess the mechanisms of apoptosis induced by PCE and CHA, the expressions of apoptosis-related genes, including p53, Bax, Bcl-2, and caspase-9, were evaluated in MDA-MB-231 cells (Fig. 4-B). Upon treatment with PCE (60 μg/mL), the expression levels of three genes increased by 1.16-fold, 6.29-fold, and 34.71-fold, respectively, whereas that of Bcl-2 decreased by 2.34-fold, confirming induction of apoptosis by regulation of p53 signaling pathway (p < 0.05). Additionally, when treated with CHA (120 μg/mL), p53, Bax, and caspase-9 expression levels increased by approximately 4.25-fold, 7.06-fold, and 106.31-fold, respectively, whereas that of Bcl-2 decreased by approximately 3.45-fold (p < 0.05). This is consistent with the results of the evaluation of MAPK pathway gene expression as described earlier, indicating that CHA exhibits superior apoptosis-inducing effects by regulating p53 signaling pathway genes as compared with PCE. This process results in an increase in Bax and caspase-9 expression levels and decrease in Bcl-2 expression levels, ultimately inducing apoptosis in MDA-MB-231 cells.

Evaluation of protein expression related to p53 signaling pathway

The anticancer effect through apoptosis ultimately leads to the regulation of protein expression of p53, Bax, Bcl-2, and caspase-9, which are involved in apoptosis, via the MAPK and p53 signaling pathway. Therefore, to confirm the apoptosis-inducing effect of PCE and CHA through the activation of the p53 signaling pathway, changes in the protein expression of p53, Bax, Bcl-2, and caspase-9 were evaluated (Fig. 5).

Fig. 5.

Evaluation of anticancer effect of purple carrot extract (PCE) and chlorogenic acid (CHA) through comparison of p53 signaling pathway protein expression (A), Bax/Bcl-2 ratio (B) and western blot analysis showing the expression levels of p53 signaling pathway protein (C). Values presented as mean ± standard deviation; bars significantly different from controls marked with an asterisk (*p < 0.05)

Upon treating MD-MB-231 cells with PCE and CHA and evaluating the expression of p53, Bax, Bcl-2, and caspase-9, a similar trend to the previous gene expression evaluations was observed. Specifically, the expression of p53 and caspase-9 increased by 1.36-fold and 1.72-fold, respectively, by PCE (60 μg/mL) treatment, but the expression of Bcl-2 decreased by 1.22-fold. Additionally, when treated with CHA (120 μg/mL), the expression of p53, Bax, and caspase-9 increased by 1.61-fold, 1.22-fold, and 1.97-fold, respectively, while the expression level of Bcl-2 decreased by 1.67-fold, confirming the apoptosis-inducing effect.

In addition, the expression ratio of Bax and Bcl-2 represents an indicator of apoptosis, and the ratio of Bax to Bcl-2 has been reported to be correlated with apoptosis observed as a decrease in Bcl-2 levels or an increase in Bax levels (Khodapasand et al., 2015). The Bax/Bcl-2 ratio of PCE (60 μg/mL) increased by 1.06-fold, and the Bax/Bcl-2 ratio of CHA (120 ug/mL) increased by 1.68-fold, confirming the apoptosis-promoting effect of CHA.

In particular, the expression of caspase-9, a pivotal late-stage factor in apoptosis, showed the highest level of increase in both gene and protein expression. These results indicate that CHA more effectively stimulates caspase-9 expression, leading to apoptosis, compared with curcumin DK1, which showed approximately a 90% increase in caspase-9 expression (Ali et al., 2017). Caspase-9, governs caspase-3 which is recognized by executioner activity by forming a complex with vacuolar protein sorting 34 (VPS34) to trigger apoptosis, contrasting its interaction with phosphorylated Bcl-2 via JNK and cleavage of Beclin 1 (Choi et al., 2023). Therefore, it is presumed that CHA can enhance the activation of caspase-3 by significantly increasing the expression of caspase-9, leading to apoptosis. This study, through elucidation of the apoptosis mechanisms of PCE and CHA, confirmed that CHA exhibits a more potent effects in inducing apoptosis compared with PCE. Therefore, polyphenols with anticancer effects, such as CHA, which are abundant in purple carrots, are considered valuable candidates for the development of anticancer therapies.

Declarations

Conflict of interest

The authors have no conflicts of interest to declare.