Skip to main content
NCBI home page
Genome Biology logoLink to Genome Biology
. 2025 Mar 26;26:71. doi: 10.1186/s13059-025-03548-z

Author Correction: Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells

Viktor Glaser 1,2, Christian Flugel 1,2, Jonas Kath 1,2, Weijie Du 1,2, Vanessa Drosdek 1,2, Clemens Franke 1,2, Maik Stein 1,2, Axel Pruß 3, Michael Schmueck-Henneresse 1,2, Hans-Dieter Volk 1,2,4,5, Petra Reinke 1,2, Dimitrios L Wagner 1,2,3,4,✉
PMCID: PMC11938680  PMID: 40140907

Correction: Genome Biol 24, 89 (2023)

https://doi.org/10.1186/s13059-023–02928-7

Following publication of the original article [1], the authors identified an error in one of the guide RNA spacer sequences disclosed in Supplementary Table S3. The correct sequence for base editing mediated silencing of the CIITA is 5’−3’: CACTCACCTTAGCCTGAGCA, as originally described in Gaudelli et al. 2020 [2].

This error does not affect the main results and conclusions of the paper.

The Supplementary Table S3 of the original article [1] has been corrected.

Supplementary Information

Additional file 2: Supplementary Tables (20.5KB, xlsx)

References

  • 1.Glaser V, Flugel C, Kath J, et al. Combining different CRISPR nucleases for simultaneous knock-in and base editing prevents translocations in multiplex-edited CAR T cells. Genome Biol. 2023;24:89. 10.1186/s13059-023-02928-7. [DOI] [PMC free article] [PubMed] [Google Scholar]
  • 2.Gaudelli NM, Lam DK, Rees H, et al. Directed evolution of adenine base editors with increased activity and therapeutic application. Nat Biotechnol. 2020;38:7. 10.1038/s41587-020-0491-6. [DOI] [PubMed] [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

Additional file 2: Supplementary Tables (20.5KB, xlsx)

Articles from Genome Biology are provided here courtesy of BMC

RESOURCES