Abstract
Background: The GRIN2A gene and its product protein have been linked to a wide spectrum of neurodevelopmental disorders named GRIN2A-related disorders. Clinical presentation is highly variable and characteristically includes acquired cognitive, behavioral, and language impairment, as well as epilepsy, ranging from benign forms to severe epileptic encephalopathy. Recent genetic investigations have expanded the clinical spectrum of heterozygous GRIN2A variants, improving our understanding of genotype–phenotype correlations. However, there have been few long-term observational studies of patients affected by the genetically determined GRIN2A-related disease. Methods: To understand the long-term changes in clinical features, we described three patients from two Italian families, carrying variants in the GRIN2A gene. Results: After more than a decade of extensive electro-clinical follow-up, we observed a progressive cognitive decline associated with severe behavioral disturbances, despite clinical seizure control. The persistent presence of EEG epileptiform abnormalities over time suggests the need for a longitudinal neurophysiological study to monitor disease progression and evaluate the potential for anti-seizure medication discontinuation. Conclusions: Our study offers new insights into the natural progression of epilepsy in GRIN2A-related disorders, highlighting that a more detailed understanding of the phenotype and timely, personalized treatment could enhance the management and quality of life for both GRIN2A patients and their caregivers.
Keywords: GRIN2A, targeted resequencing, neurodevelopmental disorders, epilepsy, cognitive impairment, behavioral disorders, electroencephalography, long-term follow-up
1. Introduction
N-methyl-D-aspartate receptors (NMDARs) are ligand-gated ion channels, typically composed of two obligatory glycine-binding GluN1 subunits and two glutamate-binding GluN2 or GluN3 subunits, which are encoded by the GRIN1, GRIN2A–D, and GRIN3A–B receptor genes [1]. Each subtype of NMDA receptor exhibits distinct temporal and spatial expression patterns in the brain, localized in various cell types and subcellular compartments, contributing to a broad variety of protein functions [2]. These receptors play a critical role in mediating excitatory neurotransmission and are essential for neuronal development, synaptic plasticity, and fundamental cognitive processes such as learning, memory, and cognitive function.
GRIN-related encephalopathies represent a group of diseases characterized by epilepsy and intellectual disability associated with variants in one of the genes encoding one of the subunits of the NMDAR [3]. Between these, GRIN2A-related disease is the most common group of diseases, manifesting with acquired cognitive, behavioral, and language impairment, as well as various types of epilepsy, ranging from benign forms to severe epileptic encephalopathy with multi-drug resistance of which the long-term electro-clinical evolution has not been extensively studied.
From the phenotype point of view, variants in GRIN2A are predominantly associated with a more definite phenotype characterized by an epileptic spectrum ranging from Landau–Kleffner syndrome to benign childhood epilepsy with centrotemporal spikes, epileptic encephalopathy, atypical childhood epilepsy with centrotemporal spikes (ACECTS), and benign childhood epilepsy with centrotemporal spikes (BECTS) often associated with DD/ID [4,5]. In more than 80% of patients, GRIN2A variants cause epilepsy and speech disorders [6]. Furthermore, pharmacological manipulations that interfere with GluN2A have been associated with deficits in short-term memory, impaired fear memory formation, and compromised spatial working memory [7,8].
Here, we describe three adult patients with variants in GRIN2A, affected by developmental and epileptic encephalopathy, focusing on seizure semiology, EEG, and response to antiseizure medications (ASMs) to better delineate the electroclinical features, treatment options, and long-term outcome of epilepsy associated with GRIN2A variants.
2. Materials and Methods
2.1. Genomic DNA Extraction and Quantification
Peripheral blood samples have been taken from both the proband and his parents. The DNA extraction from peripheral blood lymphocytes and the relative quantitative dosage were obtained as previously described [9].
The family provided written informed consent for the molecular testing and the full content of this paper, and the study was performed according to the 1984 Declaration of Helsinki. The conservation and use of biological samples for scientific purposes were approved.
2.2. Next-Generation Sequencing Analysis
Proband DNA was analyzed by Targeted resequencing (TRS) by using a SureSelect gene panel (Agilent Technologies, Boulder, CO, USA) designed to selectively capture 135 known genes associated with genetic epilepsy.
Libraries preparation and NGS data analysis were performed as previously described [9].
The clinical significance of the identified putative variants was interpreted according to the American College of Medical Genetics and Genomics (ACMG) guidelines [10]. Variant analysis was performed taking the patient’s ethnicity into account. The variants were submitted to the LOVD database, and the nucleotide variant nomenclature follows the format recommended by the Human Genome Variation Society (HGVS, http://www.hgvs.org) (accessed on 25 July 2023).
2.3. Electro-Clinical Study
We conducted a comprehensive clinical and electroencephalographic (EEG) study on three patients from two unrelated families in the Apulia region of Southern Italy. These patients presented with developmental and epileptic encephalopathy due to GRIN2A gene mutations.
Data from each patient were collected, including demographic details, comprehensive epilepsy characteristics, the presence of additional symptoms, and the progression of epilepsy and other symptoms over time.
Additionally, all patients were administered the Wechsler Intelligence Scale for Children-Revised (WISC-R). EEG electrodes were placed according to the 10–20 International System with a bipolar montage. Signals were digitally acquired with a sampling frequency of 512 Hz and band-pass filters of 1.6–210 Hz, using equipment from Nihon Kohden (Tokyo, Japan).
3. Results
3.1. Electro-Clinical Features (See Table 1)
3.1.1. Family 1
Patients 1 and 2 are siblings from non-related parents. Their father, carrying the c.1783del, p.(His595Metfs*59) variant, is asymptomatic.
Table 1.
Clinical and instrumental features. y: years; ID: intellectual disability; FT: frontotemporal; SW: spike and wave; VPA: valproate; LEV: levetiracetam; CBZ; carbamazepine; ASM: anti-seizure medication.
| Patient 1 | Patient 2 | Patient 3 | |
|---|---|---|---|
| Sex | M | M | M |
| Age | 25y | 19y | 24y |
| Age of Genetic Diagnosis | 22y | 17y | 23y |
| ID | Severe | Severe | Severe |
| Speech delay | Yes | Yes | Yes |
| Behavior disorder | Yes | Yes | Yes |
| EEG | R FT and diffuse SW, disclosed by sleep | Normal | Normal |
| Seizure type | Tonic-Clonic in sleep |
Tonic-Clonic in sleep |
Tonic-clonic in wakefulness and sleep |
| Current ASM | VPA 1000 mg/day | VPA 500 mg/day | VPA 600 mg/day |
| Precedent ASMs | LEV, CBZ | CBZ | CBZ |
| Brain MRI | Normal | Normal | Normal |
Patient 1 was a 25-year-old male born prematurely due to placental abruption whose early infancy was marked by language impairment, attention difficulties, and hyperactivity. At age 5, he began experiencing monthly focal motor seizures during sleep. EEG recordings revealed diffuse, asynchronous spike-wave and polyspike-wave discharges, particularly during non-REM sleep, with persistent epileptiform abnormalities in the right frontotemporal regions (see Figure 1). Despite polytherapy with valproate, levetiracetam, carbamazepine, and pulse steroids, seizures persisted. From age 10, he experienced cognitive and language decline, behavioral disturbances, and gradual seizure control.
Figure 1.
Patient 1 at (A) 14 years old: Asynchronous epileptiform abnormalities on bilateral fronto-centro-temporal derivations, markedly accentuated by sleep; (B) 16 years old: Asynchronous epileptiform discharges over bilateral fronto-centro-temporal regions, markedly accentuated during sleep, suggestive of a continuous spike-wave pattern, (C) 25 years old: epileptiform discharges over right fronto-centro-temporal region during awake; (D) 25 years old: epileptiform discharges over right fronto-centro-temporal region, markedly accentuated by sleep and with diffusion.
Patient 2 was a 19-year-old male who developed language impairment at age 2. EEG recordings revealed right fronto-temporal spike-wave and polyspike-wave discharges, predominantly during sleep. Over time, he experienced severe communication impairment, loss of reading and writing skills, and behavioral disturbances. At age 10, he had three focal motor seizures, which were controlled with valproate. In recent years, he has exhibited only behavioral disturbances, with normal awake EEG (see Figure 2).
Figure 2.
Patient 2 at (A) 9 years old: asynchronous epileptiform discharges over fronto-centro-temporal regions, accentuated by resting wakefulness; (B) 11 years old: epileptiform discharges over right fronto-centro-temporal region, accentuated by resting wakefulness; (C) 19 years old: EEG normal during resting wakefulness; (D) 19 years old: dysgraphia with an inability to construct sentences, suggesting a more severe underlying language disorder.
3.1.2. Family 2
Patient 3 is a 24-year-old male whose mother carries the c.2453C > T, p.(Ala818Val) variant and is asymptomatic. From infancy, he presented with severe speech and language impairments, as well as behavioral disturbances. At 13 months, he experienced febrile seizures, followed by non-febrile seizures during sleep at age 6. Valproate effectively controlled seizures. Longitudinal EEGs during wakefulness were normal.
3.2. Genetic Analysis
TRS enabled the identification of a novel variant, c.1783del, p.(His595Metfs*59), in exon 10 and c.2453C > T, p.(Ala818Val), in exon 13 of the GRIN2A gene (NM_000833). Both variants were detected with a depth coverage greater than 150× and high-quality scores (Phred quality > 3000 and genotype quality = 99). The first frameshift variant led to a premature stop codon and was absent in GnomAD, dbSNP, EP6500, and our in-house controls. Co-segregation analysis was performed in the family. The second missense variant causes an amino acid change and was also absent in GnomAD, dbSNP, EP6500, and our in-house controls. Bioinformatics details are provided in Table 2. Primers were designed using Primer3.0 (http://bioinfo.ut.ee/primer3-0.4.0) (accessed on 25 February 2023), with the following sequences: GRIN2A, exon 10 (Forward: GGCAATCACAGGACACAACT; Reverse: GTGCATTCGAGTTGATGGATCT) and GRIN2A, exon 13 (Forward: GCTGTGAGTTGCACATCGTC; Reverse: GAGCATCCAGATTTTGTGCA). PCR was performed under standard conditions, and the PCR products (479 bp and 478 bp) were sequenced on an ABI 3500xL DNA Analyzer (Applied Biosystems, Foster City, CA, USA). Parental DNA analysis confirmed the variant as a de novo event (Figure 3). Based on ACMG guidelines, the detected variant was classified as likely pathogenic.
Table 2.
Bioinformatic details of variants.
| Chromosome | Position | Reference Allele | Alternative Allele | Genotype | Gene | Nucleotide Change | Amminoacid Change | dbSNP ID | TOPMED Allele Count | GnomAD ALL Allele Count |
|---|---|---|---|---|---|---|---|---|---|---|
| 16 | 9923502 | GG | G | Het | GRIN2A (NM_000833) | c.1783 | c.1783del, p.(His595Metfs*59) | rs779219028 | N.A. | 0.00000398 |
| 16 | 9862850 | C | T | Het | GRIN2A (NM_000833) | c.2453C > T | p.(Ala818Val) | rs751455326 | N.A. | 0.00000398 |
Figure 3.
(A) Family pedigree with the phenotypes and segregation of GRIN2A mutations. (B) DNA sequence chromatogram of the GRIN2A mutations. Arrows indicate the positions of the mutations. (C) Schematic representation of GRIN2A protein and variants. Abbreviations: NTD, N-terminal domain; S1 and S2 segments form the glutamate-binding domain; M1–M4 transmembrane segments form the ion channel pore; CTD, C-terminal domain.
4. Discussion
GRIN2A mutations have previously been associated primarily with idiopathic focal epilepsy with incomplete penetrance [4,5,11] and, less frequently, with epileptic encephalopathy (EE) [12,13].
As far as we know, to date, approximately 250 individuals affected by GRIN2A-related disorders have been recorded showing a wide range of clinical manifestations [14]. Null variants, including microdeletions, and missense variants within the amino-terminal domain (ATD) and the ligand-binding domains (LBD) S1 and S2 cause a significant reduction or loss of NMDARs biological activity, leading to mild phenotypes [15]. In contrast, missense variants within the three transmembrane domains (TMDs) and linker domains predominantly lead to an increase in NMDAR activity, which correlates to more severe phenotypes [14,16]. The position of the variants in different functional domains suggests that their clinical effects might also differ. Therefore, electrophysiological analysis is a useful method to understand how a variant causes disease and, importantly, to evaluate possible treatment options.
Here, we described two families from the Apulia region, in Southern Italy, carrying a variant in the GRIN2A gene identified employing TRS, which was able to reveal two heterozygous GRIN2A variants, c.1783, p.(His595Metfs*59) in the first and c.2453C > T, p.(Ala818Val) in the second family, respectively. The variant c.1783del, p.(His595Metfs*59) is of paternal origin while the variant c.2453C > T, p.(Ala818Val) is maternal. Both parents are unaffected carriers. Previous studies described the incomplete penetrance and variable expressivity of GRIN2A mutations [5,11]. This scenario was also observed in the families described here but the underlying mechanism remains poorly understood. The numerous genomic variations in each individual and environmental factors might modify the phenotype. However, previous research has shown that the locations of missense mutations influenced the severity of developmental phenotypes, suggesting that the traits observed in the patients could reasonably be affected by a sub-regional molecular effect of GRIN2A mutations. Furthermore, in our patients, we cannot exclude potential founder effects or other population-specific factors able to mediate and/or influence both the severity and the variability of the clinical traits found since they came from a specific region in Southern Italy (Apulia). To understand the functional impact of the identified variants and to shed light on some molecular aspects that are currently unknown and could help explain the incomplete penetrance and variable expressivity already known and widely documented in GRIN2A-related disorders, functional studies and/or animal models are needed.
Although GRIN2A-related disorders have been well characterized from a phenotypic standpoint and the genotype–phenotype correlations have been widely documented, the long-term electro-clinical evolution has not been extensively studied. The present patients underwent extensive clinical and instrumental follow-up (>10 years). We observed a clinical picture characterized by cognitive decline and behavioral disturbance despite the complete control of epilepsy seizures, generalized tonic–clonic or focal motor that started in early childhood and especially during sleep were rapidly controlled with monotherapy, and, at the time of the last clinical evaluation, all patients have been seizure-free for several years.
Serial EEGs over the years showed epileptiform abnormalities prevalent in the temporal regions, disclosed and marked by sleep and often continuous, suggesting an electro-clinical pattern similar to those with Landau–Kleffner syndrome [17]. Interestingly, in one patient, we also observed the persistence of this electro-clinical pattern during sleep in adulthood.
In conclusion, a long-term electro-clinical follow-up in three patients with GRIN2A mutations suggests a clinical picture characterized overall by severe cognitive and behavioral disturbances. In addition, although rapid and complete control of seizures is reached, the persistence of epileptiform abnormalities during sleep suggests longitudinal neurophysiological studies in order to detect the monitoring of the disease progression and to provide an eventual suspension of ASMs.
In this regard, our study provides insights useful to suggest that a multidisciplinary team with neurologists, psychiatrists, and psychologists is mandatory in order to organize the appropriate management and give support to parents and caregivers.
Acknowledgments
The authors thank the patients’ families for their kind availability and for authorizing the publication of the data.
Author Contributions
Conceptualization, G.d. and O.P.; data curation, E.D.M., P.P. and M.B.; formal analysis, E.D.M., P.P. and M.B.; funding acquisition, M.C. (Massimo Carella); investigation, E.D.M.; resources, M.R.B., G.D.M., U.C. and G.d.; supervision, M.C. (Massimo Carella), M.C. (Marco Castori) and O.P.; writing—original draft, E.D.M., G.d. and O.P.; writing—review and editing, G.d. and O.P. All authors have read and agreed to the published version of the manuscript.
Institutional Review Board Statement
The study was conducted according to the guidelines of the Declaration of Helsinki and approved by the Ethics Committee of Casa Sollievo della Sofferenza Hospital (protocol no. 177CE, 7 November 2017).
Informed Consent Statement
The families provided written informed consent for the molecular testing and for the full content of this publication. This study was conducted in accordance with the 1984 Declaration of Helsinki and its subsequent revisions.
Data Availability Statement
The data presented in this study are reported in the Leiden Open Variation Databases (LOVDs) (https://databases.lovd.nl/shared/variants/0000933303#00001108; https://databases.lovd.nl/shared/variants/0000933302#00001108) (accessed on 6 September 2023).
Conflicts of Interest
The authors declare no conflicts of interest. The funders had no role in the design of the study, in the collection, analyses, or interpretation of data, in the writing of the manuscript, or in the decision to publish the results.
Funding Statement
This research was funded by the European Union—Next-Generation EU—PNRR M6/C2. Project ‘Creating next-generation databases to improve molecular diagnosis in neurodevelopmental disorders’—PNRR-MR1-2023-12377843.
Footnotes
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.
References
- 1.Mangano G.D., Riva A., Fontana A., Salpietro V., Mangano G.R., Nobile G., Orsini A., Iacomino M., Battini R., Astrea G., et al. De novo GRIN2A variants associated with epilepsy and autism and literature review. Epilepsy Behav. 2022;129:108604. doi: 10.1016/j.yebeh.2022.108604. [DOI] [PubMed] [Google Scholar]
- 2.Paoletti P., Bellone C., Zhou Q. NMDA receptor subunit diversity: Impact on receptor properties, synaptic plasticity and disease. Nat. Rev. Neurosci. 2013;14:383–400. doi: 10.1038/nrn3504. [DOI] [PubMed] [Google Scholar]
- 3.Traynelis S.F., Wollmuth L.P., McBain C.J., Menniti F.S., Vance K.M., Ogden K.K., Hansen K.B., Yuan H., Myers S.J., Dingledine R. Glutamate Receptor Ion Channels: Structure, Regulation, and Function. Pharmacol. Rev. 2010;62:405–496. doi: 10.1124/pr.109.002451. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Carvill G.L., Regan B.M., Yendle S.C., O’Roak B.J., Lozovaya N., Bruneau N., Burnashev N., Khan A., Cook J., Geraghty E., et al. GRIN2A mutations cause epilepsy aphasia spectrum disorders. Nat. Genet. 2013;45:1073–1076. doi: 10.1038/ng.2727. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Lemke J.R., Lal D., Reinthaler E.M., Steiner I., Nothnagel M., Alber M., Geider K., Laube B., Schwake M., Finsterwalder K., et al. Mutations in GRIN2A cause idiopathic focal epilepsy with rolandic spikes. Nat. Genet. 2013;45:1067–1072. doi: 10.1038/ng.2728. [DOI] [PubMed] [Google Scholar]
- 6.Samanta D. GRIN2A-related epilepsy and speech disorders: A comprehensive overview with a focus on the role of precision therapeutics. Epilepsy Res. 2023;189:107065. doi: 10.1016/j.eplepsyres.2022.107065. [DOI] [PubMed] [Google Scholar]
- 7.Bannerman D.M., Niewoehner B., Lyon L., Romberg C., Schmitt W.B., Taylor A., Sanderson D.J., Cottam J., Sprengel R., Seeburg P.H., et al. NMDA receptor subunit NR2A is required for rapidly acquired spatial working memory but not incremental spatial reference memory. J. Neurosci. 2008;28:3623–3630. doi: 10.1523/JNEUROSCI.3639-07.2008. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Zhang X., Yan X., Zhang B., Yang Q., Ye M., Cao W., Qiang W., Zhu L., Du Y., Xu X., et al. Activity-induced synaptic delivery of the GluN2A-containing NMDA receptor is dependent on endoplasmic reticulum chaperone Bip and involved in fear memory. Cell Res. 2015;25:818–836. doi: 10.1038/cr.2015.75. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Dinoi G., Conte E., Palumbo O., Benvenuto M., Coppola M.A., Palumbo P., Lastella P., Boccanegra B., Di Muro E., Castori M., et al. The Biallelic Inheritance of Two Novel SCN1A Variants Results in Developmental and Epileptic Encephalopathy Responsive to Levetiracetam. Biomedicines. 2024;12:1698. doi: 10.3390/biomedicines12081698. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Richards S., Aziz N., Bale S., Bick D., Das S., Gastier-Foster J., Grody W.W., Hegde M., Lyon E., Spector E., et al. ACMG Laboratory Quality Assurance Committee. Standards and guidelines for the interpretation of sequence variants: A joint consensus recommendation of the American College of Medical Genetics and Genomics and the Association for Molecular Pathology. Genet. Med. 2015;17:405–424. doi: 10.1038/gim.2015.30. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Lesca G., Rudolf G., Bruneau N., Lozovaya N., Labalme A., Boutry-Kryza N., Salmi M., Tsintsadze T., Addis L., Motte J., et al. GRIN2A mutations in acquired epileptic aphasia and related childhood focal epilepsies and encephalopathies with speech and language dysfunction. Nat. Genet. 2013;45:1061–1066. doi: 10.1038/ng.2726. [DOI] [PubMed] [Google Scholar]
- 12.Venkateswaran S., Myers K.A., Smith A.C., Beaulieu C.L., Schwartzentruber J.A., FORGE Canada Consortium. Majewski J., Bulman D., Boycott K.M., Dyment D.A. Whole-exome sequencing in an individual with severe global developmental delay and intractable epilepsy identifies a novel, de novo GRIN2A mutation. Epilepsia. 2014;55:e75–e79. doi: 10.1111/epi.12663. [DOI] [PubMed] [Google Scholar]
- 13.Yuan H., Hansen K.B., Zhang J., Pierson T.M., Markello T.C., Fajardo K.V.F., Holloman C.M., Golas G., Adams D.R., Boerkoel C.F., et al. Functional analysis of a de novo GRIN2A missense mutation associated with early-onset epileptic encephalopathy. Nat. Commun. 2014;5:3251. doi: 10.1038/ncomms4251. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Strehlow V., Heyne H.O., Vlaskamp D.R.M., Marwick K., Rudolf G., de Bellescize J., Biskup S., Brilstra E.H., Brouwer O.F., Callenbach P.M.C., et al. GRIN2A_related disorders: Genotype and functional consequence predict phenotype. Brain. 2019;142:80–92. doi: 10.1093/brain/awy304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15.Addis L., Virdee J.K., Vidler L.R., Collier D.A., Pal D.K., Ursu D. Epilepsy-associated GRIN2A mutations reduce NMDA receptor trafficking and agonist potency—Molecular profiling and functional rescue. Sci. Rep. 2017;7:66. doi: 10.1038/s41598-017-00115-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Pierson T.M., Yuan H., Marsh E.D., Fuentes-Fajardo K., Adams D.R., Markello T., Golas G., Simeonov D.R., Holloman C., Tankovic A., et al. GRIN2A mutation and early-onset epileptic encephalopathy: Personalized therapy with memantine. Ann. Clin. Transl. Neurol. 2014;1:190–198. doi: 10.1002/acn3.39. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Imataka G., Arisaka O. Serial EEG study in a girl with Landau-Kleffner Syndrome associated with continuous spikes and waves during slow sleep. Eur. Rev. Med. Pharmacol. Sci. 2014;18:2145–2147. [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Data Availability Statement
The data presented in this study are reported in the Leiden Open Variation Databases (LOVDs) (https://databases.lovd.nl/shared/variants/0000933303#00001108; https://databases.lovd.nl/shared/variants/0000933302#00001108) (accessed on 6 September 2023).



