Skip to main content
Poultry Science logoLink to Poultry Science
. 2025 Mar 7;104(4):104985. doi: 10.1016/j.psj.2025.104985

Genetic and pathogenic characteristics of a novel recombinant GI-19 infectious bronchitis virus strain isolated from northeastern China

Zhe Zeng a,b,c, Lun Yao a,b,c, Helong Feng a,b,c,e, Zichen Wang a,b,c, Liren Jiang a,b,c, Haojie Wang a,b,c, Chengli Zhou f, Yu Shang a,b,c, Hongcai Wang a,b,c, Huabin Shao a,b,c, Guoyuan Wen a,b,c,d,⁎⁎, Qingping Luo a,b,c,d,
PMCID: PMC11946749  PMID: 40081171

Abstract

Since the 1980s, despite vaccination, the infectious bronchitis virus (IBV) infection rate in commercial broilers and layers in China has continued to rise significantly, causing substantial economic losses to the poultry industry. In this study, an IBV strain was isolated from a layer farm in northeast China and named CK/CH/LN/2302. The whole genome sequence analysis revealed that CK/CH/LN/2302 shared a high level of homology (96.41 %) with the GI-19 strain SC/SDL/19. The phylogenetic tree based on the S1 gene indicates that CK/CH/LN/2302 belongs to the GI-19 lineage. Notably, recombination analysis using RDP5 and SimPlot software suggested that the GI-19 strain and a 4/91-like strain likely contributed to four recombination events in the CK/CH/LN/2302 genome. Phylogenetic analysis of these four regions further supported this conclusion. Protein structure analysis revealed that most of the nonstructural protein 2 (nsp2), main protease (Mpro), S1, and 5a protein regions were replaced by sequences from the 4/91-like strain. After infecting 1-day-old SPF chickens, CK/CH/LN/2302 presented a mortality rate as high as 60 %. Higher viral loads were detected in tissues such as the larynx, trachea, lungs, duodenum, jejunum and kidneys, indicating the multitissue tropism of this strain. Neutralization assay results revealed that the serum from 28-day-old commercial chickens immunized with the H120 vaccine was unable to effectively neutralize CK/CH/LN/2302. Compared with the S1 subunit of H120, CK/CH/LN/2302 demonstrated conformational changes, particularly in the hypervariable regions (HVRs), which may facilitate immune evasion. The genetic characteristics and pathogenicity of CK/CH/LN/2302 highlight the ongoing evolution of GI-19 IBV strains in China, emphasizing the urgent need for appropriate control strategies.

Keywords: Infectious bronchitis virus, GI-19, Evolutionary, Recombination, Pathogenicity, Antigenic variation

Introduction

Infectious bronchitis (IB) is a highly infectious disease caused by infectious bronchitis virus (IBV) (Jackwood, 2012). It is widely distributed worldwide and causes considerable economic damage to the poultry industry. Since IBV was first reported in China in the 1980s, the infection rate in commercial broilers and layer chickens has significantly increased, even with vaccination (Zhang, et al., 2021). IBV can infect multiple physiological systems in chickens, including the respiratory, urinary, and reproductive systems, causing typical symptoms such as coughing, tracheal rales, urate deposits in the kidneys, and a decrease in egg production (Zhao, et al., 2023). Additionally, IBV infection can damage tracheal cilia, resulting in secondary infections caused by bacteria or other pathogens, which can lead to further economic losses (Hoerr, 2021). Therefore, IBV poses a significant threat to the poultry farming industry.

IBV is a single-stranded positive-sense RNA virus with a 27.6 kb genome and belongs to the Gammacoronavirus genus of the Coronaviridae family (Rohaim, et al., 2020). It encodes four structural proteins, namely, the spike (S), envelope (E), membrane (M), and nucleocapsid (N) proteins, and nonstructural proteins (nsp2-16) (Britton, et al., 2012). The S protein binds to receptors on susceptible host cells and plays a crucial role in determining the virus's host range, tissue tropism, and induction of the host's immune response (Wickramasinghe, et al., 2014). The S protein is located on the surface of the IBV envelope and forms a trimer (Shang, et al., 2018). After translation, it is cleaved into two subunits: S1 and S2. The S1 subunit contains the receptor-binding domain (RBD) and the hypervariable region (HVR), whereas the S2 subunit is responsible for mediating membrane fusion (Abozeid, 2023).

In the early 1980s, IBV was first isolated in China (Zhang, et al., 2021). Since then, the virus has spread nationwide, causing significant economic losses. Currently, the four most prevalent genotypes are the GI-19 lineage (QX type), GⅥ-1 lineage (TC07-2 type), GI-13 lineage (793B type), and GI-7 lineage (Taiwan-I type) (Fan, et al., 2022; Li, et al., 2020). Among these, the GI-19 lineage is the dominant genotype with relatively high pathogenicity, coexisting with various other genotypes (Xu, et al., 2018). Despite extensive use of vaccine strains in China (such as the Mass-type, LDT3-A, and QXL87 strains), the low homology between vaccine strains and many emerging variant strains limits vaccine effectiveness in providing protection (Li, et al., 2023). Therefore, long-term monitoring of IBV prevalence and development of vaccines targeting new variants are crucial.

In June 2023, one IBV strain was isolated from a chicken farm with a suspected IB outbreak in northeast China, where chickens had been vaccinated with the H120 vaccine. Evolutionary analysis indicated that this isolate was a new recombinant virus belonging to the GI-19 lineage. Subsequently, recombination events and pathogenicity were analyzed, providing a meaningful reference for the development of local IBV prevention and control strategies.

Materials and methods

Clinical samples

In June 2023, six laryngeal and tracheal samples were collected from 37-day-old Hy-Line Brown chickens vaccinated with the H120 vaccine at a layer farm in northeastern China. Previously, the laying hens at this farm presented decreased egg production and increased production of soft-shelled eggs.

IBV detection and isolation

The tissue samples were subjected to three freeze‒thaw cycles at -80° C, followed by centrifugation at 5000 rpm for 10 minutes, after which the supernatant was collected. Viral genomic RNA was extracted via the FastPure Viral DNA/RNA Mini Kit (Vazyme, Nanjing, China). Subsequently, reverse transcription was performed using HiScript II Q RT SuperMix (Vazyme, Nanjing, China). PCR was performed with IBV-specific primers (forward: 5′-GAAGAAAGAACAAAAGACCGACTTAGT-3′; reverse: 5′-CGTGTTTGTATGTACTCATCTGTAACAGT-3′), which were designed using SnapGene v6.1.1 software (GSL Biotech, LLC, San Diego, CA, USA). A 25-μL reaction mixture contained 12.5 μL of the Rapid Taq master mix (Vazyme, Nanjing, China), 1 μL of each primer, 2 μL of template DNA, and 8.5 μL of ultrapure water. The PCR conditions were as follows: initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation at 95° C for 15 s, annealing at 56° C for 15 s, and extension at 72° C for 45 s, with a final extension at 72° C for 5 min. Simultaneously, the samples were tested by PCR for the presence of Newcastle disease virus (NDV), infectious laryngotracheitis virus (ILTV), avian leukosis virus (ALV), and adenovirus. The supernatant from IBV-positive samples was filtered through a 0.22 µm filter and supplemented with 1 % penicillin and streptomycin (Solarbio, Beijing, China). Then, 100 µL of the sample was injected into the allantoic cavity of 9-day-old SPF chicken embryos, with any dead embryos discarded within 24 hours. After 4 days, IBV was detected in the allantoic fluid. The 50 % infectious dose (EID50) for egg embryos was determined via the Reed and Muench method (Reed and Muench, 1938). The IBV-positive allantoic fluid was passaged three times in chicken embryos and then stored at -80° C.

Viral genome sequencing

A total of 21 pairs of primers were designed using SnapGene version 6.1.1 to amplify and sequence the entire genome of IBV. The sequencing reads were assembled via SnapGene version 6.1.1 to obtain the complete IBV genome sequence.

Phylogenetic and recombination analyses

The S1 gene sequences from 74 strains, including representative sequences from various IBV genotypes and currently used vaccine strains, were downloaded from the GenBank database following a previously described method (Wang, et al., 2022). Phylogenetic tree analysis was performed using MEGA version 10.0, with the tree constructed via the neighbor‒joining method and the maximum composite likelihood model. The bootstrap values were set to 1000. The complete genome sequences of 26 strains were downloaded from the GenBank database, and phylogenetic trees for the whole genome and individual genes were constructed. Genetic distance analysis was performed using MEGA version 10.0 with the maximum composite likelihood model and 1000 bootstrap replicates. Sequence similarity analysis was conducted using nucleotide BLAST within the National Center for Biotechnology Information (NCBI) database.

Possible recombination events were analyzed using seven methods via RDP5 software (version 5.1.0), namely, RDP, GENECONV, BootScan, MaxChi, Chimera, SiScan, and 3Seq, as previously described (Yan, et al., 2021). These findings were further validated via Simplot software, with results generated using a window width of 500 bp and a step size of 100 bp.

Protein structure prediction

The protein structures were predicted using AlphaFold 3 (https://golgi.sandbox.google.com/). The protein structure was analyzed via PyMOL version 2.1.

Pathogenicity of IBV isolates in SPF chickens

A total of 90 one-day-old SPF chickens were divided into six groups: A, B, C, D, E and F. Groups A, C, and E each contained 25 chickens, whereas groups B, D, and F each contained 5 chickens. Groups A and B were inoculated with CK/CH/LN/2302 at a dose of 106 EID50 in 100 µL via nasal drops. Groups C and D received PBS via nasal drops as a control. On the fifth day post inoculation (dpi), all chickens in groups B and D were necropsied to observe gross lesions, and samples were collected from the spleen, bursa of Fabricius, thymus, cecal tonsils, trachea, larynx, lungs, liver, proventriculus, gizzard, duodenum, jejunum, ileum, cecum, rectum, heart, brain, muscle and kidneys for tissue virus titration. Additionally, tissues with significant pathological changes were fixed in 10 % neutral formalin for histopathological examination. Groups A and C were monitored for 14 days to record their clinical symptoms and survival rates. Clinical symptom scoring was performed as previously described (Tang, et al., 2022), with the following scores assigned: 0 for normal; 1 for mild symptoms, such as slight tearing, mild tremors, watery feces, or tracheal rales; 2 for worsening symptoms, such as excessive tearing, nasal discharge, depression, severe watery feces, frequent sneezing, or coughing; and 3 for death. At 3, 5, and 7 dpi, ten chickens from each of these groups were randomly selected, and throat and cloacal swabs were collected for virus titration.

Determination of the viral load in tissues

All collected tissues were tested for the presence of the virus via quantitative real-time PCR (qPCR). For GI-19, a pair of S gene-specific primers was designed (GI-19-F: CGTAAACAGCTTGTTCACGTCTA; GI-19-R: TTTAACATGGCGCTTAAGCTTTTC). SYBR Green I was used for qPCR. The primers used were designed with SnapGene (version 6.1.1) and synthesized by Sangon Biotech (Shanghai, China). The amplified products were subsequently cloned and inserted into a pMD19-T vector (Takara) to create a positive control plasmid for establishing the standard curve.

Virus neutralization test

Serum was collected from 28-day-old commercial laying hens that had been vaccinated with the H120 vaccine at 1, 7, and 21 days of age and processed as previously described (Gao, et al., 2016). The serum was inactivated at 56° C for 30 minutes and then subjected to twofold serial dilutions with sterile PBS and mixed with 200 EID50 of the IBV strain. The virus-serum mixture was incubated at 37° C for 1 hour before being inoculated into the allantoic cavity of SPF chicken embryos. The embryos were monitored for 5 days, and the endpoint titer of the IBV serum was determined via the Reed and Muench method.

S1 Amino acid sequence alignment and structural analysis

The alignment of the CK/CH/LN/2302 and H120 S1 subunit amino acid sequences was visualized using the online tool ESPript 3.0 (https://espript.ibcp.fr/ESPript/cgi-bin/ESPript.cgi). Structural comparisons, root mean square deviation (RMSD) analyses, and visualizations were performed using PyMOL version 2.1.

Ethical approval

This study was approved by the Institutional Animal Care and Use Committee of the Hubei Academy of Agricultural Sciences and was carried out in compliance with the established guidelines.

Statistical analysis

The experimental data were analyzed for significance via Prism version 10 (GraphPad Software, San Diego, CA, USA). The virus titers shed were compared and analyzed using one-way ANOVA, with the significance levels indicated as follows: ****, p < 0.0001 and ns, not significant.

Results

Identification and isolation of IBV

IBV-positive samples were collected from the larynx and trachea of laying hens. The supernatant was inoculated into 9-day-old SPF chicken embryos and passaged three times. The PCR results revealed the presence of only IBV and no other pathogens, and the virus was named CK/CH/LN/2302 (GenBank accession number: PQ659106). The EID50 was subsequently calculated via the Reed‒Muench method, with the titer of CK/CH/LN/2302 being 108.5 EID50/mL.

CK/CH/LN/2302 belongs to the GI-19 lineage

To clarify the evolutionary lineage of the newly identified strains, phylogenetic analysis was conducted using the S1 gene sequences of the isolates alongside 74 representative strains spanning all lineages. The analysis indicated that CK/CH/LN/2302 lies between the GI-13 and GI-19 lineages, indicating a closer relationship with the GI-19 lineage. Additionally, the S protein cleavage site of CK/CH/LN/2302 is consistent with that of GI-19 genotype strains, characterized by the sequence HRRRR (His-Arg-Arg-Arg-Arg). Interestingly, the S1 gene sequence of CK/CH/LN/2302 shares the highest similarity (91.13 %) with that of CK/CH/YN/SL17-6, which belongs to the GI-13 lineage (Fig. 1A). Further phylogenetic analysis was performed on the basis of the whole-genome sequences of this isolate and 29 representative strains. The results revealed that CK/CH/LN/2302 is more closely related to the SC/SDL/19 strain, with a similarity of 96.45 % (Fig. 1B). To further understand the genetic evolutionary relationships between the isolate and the reference strains, phylogenetic trees for specific genes were constructed by using MEGA version 10.0. Most of the genes of CK/CH/LN/2302 were found to be more closely related to those of SC/SDL/19 (Fig. 2). Analysis of the whole-genome nucleotide sequence similarity revealed that CK/CH/LN/2302 shares nucleotide similarities ranging from 74.47 % to 96.41 % with 26 reference strains (Table 1). Specifically, the S1 gene shows similar levels of similarity to the GI-19 and GI-13 genotypes, whereas the 5a gene exhibits comparable similarity to the GI-7, GI-13, and GI-29 genotypes (Table 1). The phylogenetic distance analysis results are consistent with the above results (Table 2). These results suggest that CK/CH/LN/2302 may have evolved through the recombination of strains from different genotypes.

Fig. 1.

Fig 1

Phylogenetic trees were constructed by using the S1 nucleotide sequences (A) and the whole-genome sequence (B) of CK/CH/LN/2302 (marked with red dots), along with those of other reference strains. The tree was generated in MEGA 11.0 software via the neighbor‒joining method with 1000 bootstrap replicates. Seven different IBV genotypes were classified as genotypes GI to GVII.

Fig. 2.

Fig 2

Phylogenetic trees based on the whole genome and specific genes of the strain were constructed via the neighbor‒joining method with 1,000 bootstrap replicates via MEGA 10.0 software. CK/CH/LN/2302 is marked with a red circle.

Table 1.

A heatmap illustrating the similarity between CK/CH/LN/2302 and other representative IBV strains across the whole genome and individual genes. Higher similarity is indicated by green, whereas lower similarity is shown in red.

Image, table 1

Ck/Aus/V6/92a: The 3b and 5b genes are missing. N: No significant similarity found.

Table 2.

Heatmap showing the genetic distances between CK/CH/LN/2302 and other representative IBV strains across the whole genome and individual genes. Shorter distances, indicating greater similarity, are represented in green, whereas longer distances, reflecting greater divergence, are displayed in red.

Image, table 2

Ck/Aus/V6/92a:The 3b and 5b genes are missing.

CK/CH/LN/2302 is a novel strain derived from multiple recombination events between the GI-19 and GI-13 strains

Potential recombination events in the CK/CH/LN/2302 strain were analyzed using RDP5 software via seven different methods. These results indicate that CK/CH/LN/2302 is likely a recombinant strain formed through recombination between SC/SDL/19 and the 4/91 vaccine strain. Four recombination events were identified in the regions nt852–nt1118, nt8833–nt9650, nt20452–nt21068, and nt25428–nt25738, with gene similarity to the 4/91 vaccine strains of 100 %, 99.3 %, 99 %, and 96.4 %, respectively (Fig. 3A). To further investigate the characteristics of these recombination events, H120, 4/91, and SC/SDL/19 were selected as reference strains. BootScan analysis using SimPlot software was employed to visualize gene recombination, revealing that these events occurred in regions encoding nsp2, the main protease (Mpro), and the S1 and 5a proteins (Fig. 3B). For a more detailed understanding of the genetic contributions of parental strains, the whole genome was segmented on the basis of the identified recombination regions, and phylogenetic trees were reconstructed using the neighbor-joining method in MEGA software. The primary parental strain of CK/CH/LN/2302 was identified as SC/SDL/19, while its genetic distance in the nt852–nt1118, nt8833–nt9650, nt20452–nt21068, and nt25428–nt25738 regions was closest to 4/91 (Fig. 3C). Protein structure prediction and analysis further visualized the recombination regions. Most of the nsp2, Mpro, S1, and 5a protein regions in CK/CH/LN/2302 were replaced by protein regions resembling those of the 4/91 strain (Fig. 3D). These findings demonstrate that CK/CH/LN/2302 is a novel recombinant strain formed through genetic recombination between a GI-19 field strain and a 4/91-like strain.

Fig. 3.

Fig 3

Genomic recombination analysis of CK/CH/LN/2302. (A) Information on recombination events. (B) Genomic features and whole-genome recombination analysis of CK/CH/LN/2302. Recombination analysis was performed using Simplot software with Bootscan analysis (window size: 500 bp, step size: 100 bp). (C) Phylogenetic trees were constructed using the neighbor‒joining method in MEGA 10.0 software on the basis of nucleotide sequences from different regions, with bootstrap values set to 1,000. The isolate is marked with a red circle, the primary parental strain is marked with a green triangle, and the secondary parental strain is marked with a blue square. (D) The nsp2 monomer, Mpro dimer, S protein trimer, and accessory protein 5a monomer structures of CK/CH/LN/2302 were predicted using AlphaFold 3 (https://golgi.sandbox.google.com/), with the replaced regions highlighted in red.

Pathogenicity of CK/CH/LN/2302

After 1-day-old SPF chicks were challenged with the isolated strain, typical clinical symptoms, such as depression, coughing, or death, began to appear at 1 dpi. The peak of disease onset was observed at 4–5 dpi, with more severe clinical symptoms observed in the CK/CH/LN/2302 group (Fig. 4A). The survival rate was 40 % in the CK/CH/LN/2302 group (Fig. 4B), and chicks infected with CK/CH/LN/2302 presented pronounced "speckled kidney" symptoms characterized by urate deposition and swelling. Additionally, reddening and hemorrhage of the trachea were observed. The control group showed no clinical symptoms (Fig. 4C). To investigate the replication of the isolated strain in different tissues, qRT‒PCR was used to measure the viral load in various chicken tissues. The results revealed high viral loads of CK/CH/LN/2302 in the larynx, trachea, lungs, duodenum, jejunum and kidneys (Fig. 4D). H&E staining of tissues from the CK/CH/LN/2302 group revealed significant pathological changes, including indistinct boundaries between the cortex and medulla of the spleen and a marked reduction in lymphocytes. Necrosis of the laryngeal tracheal glands, shedding of mucosal epithelial cells, and inflammatory cell infiltration were observed. The lungs showed severe hemorrhage and infiltration of inflammatory cells. In the duodenum, there was a notable increase in the number of goblet cells and a shortening of the intestinal villi. The cecum exhibited extensive stromal cell necrosis and villous detachment, whereas the kidneys presented severe hemorrhage and glomerular atrophy. In contrast, no pathological changes were observed in any of the tissues from the PBS control group (Fig. 4E). To assess the viral shedding of the isolated strains, viral loads in the tracheal and cloacal swabs were measured via qRT‒PCR on days 3, 5, and 7 dpi. The CK/CH/LN/2302 group presented a high rate of viral shedding in tracheal and cloacal swabs, which persisted for at least 7 days. The viral shedding in the cloaca on days 3 and 7 was significantly greater than that in the trachea (Fig. 4F). CK/CH/LN/2302 presented greater viral shedding in cloacal swabs and demonstrated multitissue tropism.

Fig. 4.

Fig 4

Pathogenicity study of CK/CH/LN/2302. (A) Clinical scores of chickens inoculated with CK/CH/LN/2302 or PBS (control group). (B) Survival rate of 1-day-old SPF chickens inoculated with CK/CH/LN/2302. The mortality of the chickens was recorded over a 14-day observation period. (C) Gross pathological appearance of the chicken trachea and kidneys. (D) Tissue tropism analysis of CK/CH/LN/2302. On day 5 postchallenge, the viral load was assessed via qRT‒PCR in samples collected from the spleen, bursa of Fabricius, thymus, cecal tonsils, trachea, larynx, lungs, liver, proventriculus, gizzard, duodenum, jejunum, ileum, cecum, rectum, heart, brain, muscle and kidneys. (E) Histopathological analysis of the spleen, throat, trachea, lungs, duodenum, cecum, and kidneys of SPF chickens challenged with CK/CH/LN/2302. Scale bar: 50 µm. (F) Shedding analysis of CK/CH/LN/2302. Tracheal swabs and cloacal swabs were collected on days 3, 5, and 7 postchallenge to determine the tracheal viral load. ****, p < 0.0001; ns, not significant.

Analysis of the antigenic properties and molecular basis of antigenic variation between CK/CH/LN/2302 and H120

To evaluate the neutralizing effect of the serum of chickens immunized with the H120 vaccine against CK/CH/LN/2302, serum was collected from 28-day-old commercial chickens and subjected to a virus neutralization assay. The neutralization titer of the H120 serum against CK/CH/LN/2302 was 8, while that against H120 was 64, indicating that the H120 serum may not effectively neutralize CK/CH/LN/2302. To analyze the molecular basis of the antigenic variation in CK/CH/LN/2302, a homology comparison of the S1 sequences of CK/CH/LN/2302 and H120 was conducted, revealing a similarity of 86.77 %. Amino acid sequence alignment revealed many nonconserved mutations, particularly in the HVRs (Fig. 5A). Visualization of all mutated amino acids in the S1 protein structure revealed 40 mutations in the S1-NTD region, 24 mutations in the S1-CTD region, and 20 mutations in other regions (Fig. 5B and C). Many of these mutations were located within the HVRs of the S1-NTD, potentially leading to conformational changes in the protein (Fig. 5D). The structural overlay of the S1 monomers from CK/CH/LN/2302 and H120 showed an RMSD of 0.360 Å, with separate analysis of specific regions revealing the greatest RMSD difference of 0.694 Å in HVR II (Fig. 5E). These conformational changes in the protein are likely responsible for the observed antigenic variation.

Fig. 5.

Fig 5

Sequence alignment and structural analysis of the S1 subunit between CK/CH/LN/2302 and H120. (A) Differences in the S1 amino acid sequence were identified, with the HVRs enclosed in black dashed boxes. Identical residues are indicated by white text on a red background, and conserved residues are highlighted with red text on a white background. (B) A schematic diagram of the IBV S1 subunit. S1-NTD is in cyan, S1-CTD is in green, and HVRs are in red. (C) Monomeric structure of the S1 protein from CK/CH/LN/2302, with amino acid differences from H120 highlighted as red spheres. (D) Structural comparison of the S1 protein between CK/CH/LN/2302 and H120. CK/CH/LN/2302 is in blue, H120 is in green, and HVRs of CK/CH/LN/2302 are highlighted in red. (E) RMSD analysis.

Discussion

Coronaviruses pose serious challenges to the health of both humans and animals. The occurrence of severe acute respiratory syndrome (SARS) in 2002-2003, Middle East respiratory syndrome (MERS) in 2012, and the coronavirus disease 2019 (COVID-19) pandemic increased public awareness of the health impacts of coronaviruses (Ciotti, et al., 2020; Peiris, et al., 2003; Zumla, et al., 2015). Avian coronavirus IBV is also prevalent globally, causing significant economic losses to the poultry industry. In China, the predominant IBV strains are GI-19, GVI-1, GI-7, and GI-13, with over 70 % of the isolated strains being GI-19 (Fan, et al., 2019). Here, we isolated a novel IBV strain belonging to the GI-19 lineage from a laying flock vaccinated with the H120 vaccine. The isolated strain exhibited low homology with H120, and virus neutralization tests revealed that H120 serum had very limited neutralizing activity against the CK/CH/LN/2302 strain, which may explain the lack of effective control.

Recombination analysis of gene sequences provided valuable information on the genetic relationships of the virus. The S1 RBD gene of the CK/CH/LN/2302 strain was recombined with the gene from the 4/91-like strain. This may explain why CK/CH/LN/2302 is positioned between the GI-13 and GI-19 lineages in the S1 phylogenetic tree. The RBD of the IBV S protein can bind to sialic acids, playing a crucial role in the viral entry process (You, et al., 2023). Alterations in the S1 RBD of the CK/CH/LN/2302 strain may lead to changes in its pathogenicity. Additionally, since the S protein is an important antigen that induces antibody production in chickens, the use of the 4/91 vaccine strain may improve immune protection. Moreover, the CK/CH/LN/2302 strain likely underwent recombination in regions encoding the nsp2, Mpro, S1 and 5a proteins, all of which play distinct and essential roles in viral replication. The nsp2 protein is involved in various processes, such as coronavirus infection, replication, and pathogenicity, and plays a role in regulating the host's early immune response during viral infection (Yang, et al., 2009; Yu, et al., 2012). The IBV Mpro is responsible for its own maturation and the subsequent processing of replicase polyproteins (Ziebuhr, et al., 2000). The 5a gene is an important virulence gene, and its absence can reduce the pathogenicity of the virus (Laconi, et al., 2018; Zhao, et al., 2022). Recombination events may alter properties of the corresponding proteins, leading to changes in infection, replication, and pathogenicity of the resulting novel strains.

In terms of pathogenicity for chickens, the CK/CH/LN/2302 strain induces a mortality rate of 60 %. Typically, the GI-19 strain has a relatively high mortality rate (Hou, et al., 2020; Sun, et al., 2021), which is similar to that observed for our isolated virus. The CK/CH/LN/2302 strain presented high viral loads in multiple tissues, including the lungs, duodenum, kidneys, and oviduct, demonstrating multitissue tropism. The GI-19 lineages exhibit high pathogenicity and can infect multiple organs, with the kidneys showing characteristic urate deposition (Chen, et al., 2024; Hou, et al., 2020). Our research provides insights into the latest epidemiological trends and changes in the virulence of IBV in northeast China.

The serum from chickens immunized with H120 was unable to effectively neutralize CK/CH/LN/2302, likely due to the antigenic variations observed in CK/CH/LN/2302. Significant amino acid differences were identified in the HVRs and other S1 regions, particularly in the conformational changes within HVR II. The increased variation in the HVRs likely reduces antigenic similarity (Shan, et al., 2018). The S1 subunit contains the major serotype-specific neutralizing epitopes (Abozeid, 2023), and the S1 of CK/CH/LN/2302 has undergone certain conformational changes. Consequently, these structural and antigenic alterations prevent the antibodies generated by H120 immunization from providing effective protection against CK/CH/LN/2302 infection.

In this study, a novel IBV strain was isolated from H120-vaccinated chicken flocks in northeast China. The isolate was primarily formed through recombination between field and vaccine strains, with CK/CH/LN/2302 exhibiting multitissue tropism and increased pathogenicity. Continuous epidemiological surveillance of different IBV genotypes and development of appropriate control strategies are needed in the future.

Disclosures

Authors declare no conflicts of interest.

Acknowledgements

This work was financially supported by the National Natural Science Foundation of China [grant numbers U23A20239 and 32302869], the Earmarked Fund for the China Agriculture Research System [grant number CARS-41], the Science and Technology Major Project of Hubei Province [grant number 2023BBB034], and the Wuhan Major Science and Technology Program [grant number 2023020302020573]. Conflict of Interest Statement: The authors declare that they have no conflicts of interest.

Contributor Information

Guoyuan Wen, Email: Wgy_524@163.com.

Qingping Luo, Email: qingping0523@163.com.

References

  1. Abozeid H.H. Global emergence of infectious bronchitis virus variants: evolution, immunity, and vaccination challenges. Transbound. Emerg. Dis. 2023;2023 [Google Scholar]
  2. Britton P., Armesto M., Cavanagh D., Keep S. Modification of the avian coronavirus infectious bronchitis virus for vaccine development. Bioengineered. 2012;3:114–119. doi: 10.4161/bbug.18983. [DOI] [PMC free article] [PubMed] [Google Scholar]
  3. Chen H., Shi W., Feng S., Yuan L., Jin M., Liang S., Wang X., Si H., Li G., Ou C. A novel highly virulent nephropathogenic QX-like infectious bronchitis virus originating from recombination of GI-13 and GI-19 genotype strains in China. Poult. Sci. 2024;103 doi: 10.1016/j.psj.2024.103881. [DOI] [PMC free article] [PubMed] [Google Scholar]
  4. Ciotti M., Ciccozzi M., Terrinoni A., Jiang W.-C., Wang C.-B., Bernardini S. The COVID-19 pandemic. Crit. Rev. Clin. Lab. Sci. 2020;57:365–388. doi: 10.1080/10408363.2020.1783198. [DOI] [PubMed] [Google Scholar]
  5. Fan W., Chen J., Zhang Y., Deng Q., Wei L., Zhao C., Lv D., Lin L., Zhang B., Wei T. Phylogenetic and spatiotemporal analyses of the complete genome sequences of avian coronavirus infectious bronchitis virus in China during 1985–2020: revealing coexistence of multiple transmission chains and the origin of LX4-type virus. Front. Microbiol. 2022;13 doi: 10.3389/fmicb.2022.693196. [DOI] [PMC free article] [PubMed] [Google Scholar]
  6. Fan W., Tang N., Dong Z., Chen J., Zhang W., Zhao C., He Y., Li M., Wu C., Wei T. Genetic analysis of avian coronavirus infectious bronchitis virus in yellow chickens in Southern China over the past decade: revealing the changes of genetic diversity, dominant genotypes, and selection pressure. Viruses. 2019;11:898. doi: 10.3390/v11100898. [DOI] [PMC free article] [PubMed] [Google Scholar]
  7. Gao M., Wang Q., Zhao W., Chen Y., Zhang T., Han Z., Xu Q., Kong X., Liu S. Serotype, antigenicity, and pathogenicity of a naturally recombinant TW I genotype infectious bronchitis coronavirus in China. Vet. Microbiol. 2016;191:1–8. doi: 10.1016/j.vetmic.2016.05.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  8. Hoerr F.J. The pathology of infectious bronchitis. Avian Dis. 2021;65:600–611. doi: 10.1637/aviandiseases-D-21-00096. [DOI] [PubMed] [Google Scholar]
  9. Hou Y., Zhang L., Ren M., Han Z., Sun J., Zhao Y., Liu S. A highly pathogenic GI-19 lineage infectious bronchitis virus originated from multiple recombination events with broad tissue tropism. Virus. Res. 2020;285 doi: 10.1016/j.virusres.2020.198002. [DOI] [PMC free article] [PubMed] [Google Scholar]
  10. Jackwood M.W. Review of infectious bronchitis virus around the world. Avian Dis. 2012;56:634–641. doi: 10.1637/10227-043012-Review.1. [DOI] [PubMed] [Google Scholar]
  11. Laconi A., van Beurden S.J., Berends A.J., Krämer-Kühl A., Jansen C.A., Spekreijse D., Chénard G., Philipp H.-C., Mundt E., Rottier P.J. Deletion of accessory genes 3a, 3b, 5a or 5b from avian coronavirus infectious bronchitis virus induces an attenuated phenotype both in vitro and in vivo. J. Gen. Virol. 2018;99:1381–1390. doi: 10.1099/jgv.0.001130. [DOI] [PMC free article] [PubMed] [Google Scholar]
  12. Li H., Liu G., Zhou Q., Yang H., Zhou C., Kong W., Su J., Li G., Si H., Ou C. Which strain of the avian coronavirus vaccine will become the prevalent one in China next? Front. Vet. Sci. 2023;10 doi: 10.3389/fvets.2023.1139089. [DOI] [PMC free article] [PubMed] [Google Scholar]
  13. Li Y.T., Chen T.C., Lin S.Y., Mase M., Murakami S., Horimoto T., Chen H.W. Emerging lethal infectious bronchitis coronavirus variants with multiorgan tropism. Transbound. Emerg. Dis. 2020;67:884–893. doi: 10.1111/tbed.13412. [DOI] [PMC free article] [PubMed] [Google Scholar]
  14. Peiris J.S., Yuen K.Y., Osterhaus A.D., Stöhr K. The severe acute respiratory syndrome. N. Engl. J. Med. 2003;349:2431–2441. doi: 10.1056/NEJMra032498. [DOI] [PubMed] [Google Scholar]
  15. Reed, L. J., and H. Muench. 1938. A simple method of estimating fifty per cent endpoints.
  16. Rohaim M.A., El Naggar R.F., Abdelsabour M.A., Mohamed M.H., El-Sabagh I.M., Munir M. Evolutionary analysis of infectious bronchitis virus reveals marked genetic diversity and recombination events. Genes. 2020;11:605. doi: 10.3390/genes11060605. [DOI] [PMC free article] [PubMed] [Google Scholar]
  17. Shan D., Fang S., Han Z., Ai H., Zhao W., Chen Y., Jiang L., Liu S. Effects of hypervariable regions in spike protein on pathogenicity, tropism, and serotypes of infectious bronchitis virus. Virus. Res. 2018;250:104–113. doi: 10.1016/j.virusres.2018.04.013. [DOI] [PMC free article] [PubMed] [Google Scholar]
  18. Shang J., Zheng Y., Yang Y., Liu C., Geng Q., Luo C., Zhang W., Li F. Cryo-EM structure of infectious bronchitis coronavirus spike protein reveals structural and functional evolution of coronavirus spike proteins. PLoS Pathog. 2018;14 doi: 10.1371/journal.ppat.1007009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  19. Sun L., Tang X., Qi J., Zhang C., Zhao J., Zhang G., Zhao Y. Two newly isolated GVI lineage infectious bronchitis viruses in China show unique molecular and pathogenicity characteristics. Infect. Genet. Evol. 2021;94 doi: 10.1016/j.meegid.2021.105006. [DOI] [PubMed] [Google Scholar]
  20. Tang X., Qi J., Sun L., Zhao J., Zhang G., Zhao Y. Pathological effect of different avian infectious bronchitis virus strains on the bursa of Fabricius of chickens. Avian Pathol. 2022;51:339–348. doi: 10.1080/03079457.2022.2063710. [DOI] [PubMed] [Google Scholar]
  21. Wang C.-y., Luo Z.-b., Shao G.-q., Hou B. Genetic and pathogenic characteristics of a novel infectious bronchitis virus strain in genogroup VI (CK/CH/FJ/202005) Vet. Microbiol. 2022;266 doi: 10.1016/j.vetmic.2022.109352. [DOI] [PubMed] [Google Scholar]
  22. Wickramasinghe I.A., Van Beurden S., Weerts E., Verheije M. The avian coronavirus spike protein. Virus. Res. 2014;194:37–48. doi: 10.1016/j.virusres.2014.10.009. [DOI] [PMC free article] [PubMed] [Google Scholar]
  23. Xu L., Han Z., Jiang L., Sun J., Zhao Y., Liu S. Genetic diversity of avian infectious bronchitis virus in China in recent years. Infect. Genet. Evol. 2018;66:82–94. doi: 10.1016/j.meegid.2018.09.018. [DOI] [PMC free article] [PubMed] [Google Scholar]
  24. Yan W., Qiu R., Wang F., Fu X., Li H., Cui P., Zhai Y., Li C., Zhang L., Gu K. Genetic and pathogenic characterization of a novel recombinant avian infectious bronchitis virus derived from GI-1, GI-13, GI-28, and GI-19 strains in Southwestern China. Poult. Sci. 2021;100 doi: 10.1016/j.psj.2021.101210. [DOI] [PMC free article] [PubMed] [Google Scholar]
  25. Yang A., Wei L., Zhao W., Xu Y., Rao Z. Expression, crystallization and preliminary X-ray diffraction analysis of the N-terminal domain of nsp2 from avian infectious bronchitis virus. Acta Crystallogr. Sect. F: Struct. Biol. Cryst. Commun. 2009;65:788–790. doi: 10.1107/S1744309109024749. [DOI] [PMC free article] [PubMed] [Google Scholar]
  26. You R., Liu K., Huang M., Tang L., Zhang X., Huang Y., Zhao J., Zhao Y., Ye L., Zhang G. Identification and comparison of the sialic acid-binding domain characteristics of Avian coronavirus infectious Bronchitis virus spike protein. J. Virol. 2023;97:e00489. doi: 10.1128/jvi.00489-23. -00423. [DOI] [PMC free article] [PubMed] [Google Scholar]
  27. Yu K., Ming Z., Li Y., Chen C., Bao Z., Ren Z., Liu B., Tao W., Rao Z., Lou Z. Purification, crystallization and preliminary X-ray analysis of nonstructural protein 2 (nsp2) from avian infectious bronchitis virus. Acta Crystallogr. Sect. F: Struct. Biol. Cryst. Commun. 2012;68:716–719. doi: 10.1107/S1744309112018623. [DOI] [PMC free article] [PubMed] [Google Scholar]
  28. Zhang X., Guo M., Zhao J., Wu Y. Avian infectious bronchitis in China: epidemiology, vaccination, and control. Avian Dis. 2021;65:654–658. doi: 10.1637/aviandiseases-21-00098. [DOI] [PubMed] [Google Scholar]
  29. Zhao J., Zhao Y., Zhang G. Key aspects of coronavirus avian infectious bronchitis virus. Pathogens. 2023;12:698. doi: 10.3390/pathogens12050698. [DOI] [PMC free article] [PubMed] [Google Scholar]
  30. Zhao Y., Liang R., Cheng J., Zhao J., Xue J., Zhang G. Attenuated viral replication of avian infectious bronchitis virus with a novel 82-nucleotide deletion in the 5a gene indicates a critical role for 5a in virus-host interactions. Microbiol. Spectr. 2022;10:e01405–e01422. doi: 10.1128/spectrum.01405-22. [DOI] [PMC free article] [PubMed] [Google Scholar]
  31. Ziebuhr J., Snijder E.J., Gorbalenya A.E. Virus-encoded proteinases and proteolytic processing in the Nidovirales. J. Gen. Virol. 2000;81:853–879. doi: 10.1099/0022-1317-81-4-853. [DOI] [PubMed] [Google Scholar]
  32. Zumla A., Hui D.S., Perlman S. Middle East respiratory syndrome. Lancet. 2015;386:995–1007. doi: 10.1016/S0140-6736(15)60454-8. [DOI] [PMC free article] [PubMed] [Google Scholar]

Articles from Poultry Science are provided here courtesy of Elsevier

RESOURCES