Inhibition of HIF-prolyl hydroxylase promotes renal tubule regeneration via the reprogramming of renal proximal tubular cells

Abstract

The ability of the mammalian kidney to repair or regenerate after acute kidney injury (AKI) is very limited. The maladaptive repair of AKI promotes progression to chronic kidney disease (CKD). Therefore, new strategies to promote the repair/regeneration of injured renal tubules after AKI are urgently needed. Hypoxia has been shown to induce heart regeneration in adult mice. However, it is unknown whether hypoxia can induce kidney regeneration after AKI. In this study, we used a prolyl hydroxylase domain inhibitor (PHDI), MK-8617, to mimic hypoxic conditions and found that MK-8617 significantly ameliorated ischemia reperfusion injury (IRI)-induced AKI. We also showed that MK-8617 dramatically facilitated renal tubule regeneration by promoting the proliferation of renal proximal tubular cells (RPTCs) after IRI-induced AKI. We then performed bulk mRNA sequencing and discovered that multiple nephrogenesis-related genes were significantly upregulated with MK-8617 pretreatment. We also showed that MK-8617 may alleviate proximal tubule injury by stabilizing the HIF-1α protein specifically in renal proximal tubular cells. Furthermore, we demonstrated that MK-8617 promotes the reprogramming of renal proximal tubular cells to Sox9⁺ renal progenitor cells and the regeneration of renal proximal tubules. In summary, we report that the inhibition of prolyl hydroxylase improves renal proximal tubule regeneration after IRI-induced AKI by promoting the reprogramming of renal proximal tubular cells to Sox9⁺ renal progenitor cells.

Introduction

Acute kidney injury, characterized by an abrupt decrease in urine output and a rapid increase in serum creatinine [1], is a heterogeneous clinical syndrome with multiple etiologies, variable pathogenesis, and diverse outcomes [2]. The ability of the tubular epithelium to regenerate depends on the degree of injury [3]. An emerging body of literature supports a role for endogenous surviving tubular epithelial cells in replenishing proximal tubular epithelial cells (PTECs) after injury [4–9]. Sox9 is a critical transcription factor known to play a vital role in kidney development. Recent research has shed light on its potential role in the repair and regeneration of damaged kidneys [10–16]. Studies have shown that Sox9 is expressed in renal progenitor cells, which are essential for renal tubule regeneration after injury. These Sox9⁺ progenitor cells can differentiate into multiple cell types, including nephron epithelial cells, which are crucial for normal kidney function. Sox9 activation has been found to promote the self-renewal and proliferation of these progenitor cells, facilitating kidney repair and regeneration [10, 11]. Activated Sox9⁺ renal epithelial cells promote kidney repair through the secretion of factors [12]. Taken together, these studies suggest that Sox9⁺ renal epithelial cells play crucial roles in kidney repair and regeneration. However, how these Sox9⁺ renal progenitor cells are activated in the regeneration/repair of injured renal proximal tubules is unclear.

Hypoxia is a crucial physiological phenomenon that plays a significant role in various biological processes, including embryonic development and tissue regeneration [17, 18]. Understanding the relationship between hypoxia and tissue regeneration is highly important for advancing medical research and discovering novel therapeutic approaches. During embryonic development, developing tissues and organs experience a naturally occurring hypoxic environment. This low oxygen tension is vital for proper embryogenesis, as it regulates key cellular processes such as cell proliferation, differentiation, migration and angiogenesis. Hypoxia has also been found to promote tissue repair and regeneration [19–21]. The Murphy Roths Large (MRL) mouse is capable of healing ear tissue through a process reminiscent of salamander limb regrowth, and HIF-1α was identified as a central mediator of this regenerative response [22, 23]. Heber-Katz et al. reported that multiple peripheral subcutaneous injections of 1,4-DPCA, a prolyl hydroxylase domain inhibitor, led to regenerative wound healing in Swiss Webster mice after ear hole punch injury [23]. Hypoxia has been reported to promote heart regeneration in adult mice. Exposure to hypoxia 1 week after the induction of myocardial infarction induces a robust regenerative response with decreased myocardial fibrosis and improved left ventricular systolic function [19]. However, it is not known whether hypoxia can induce kidney regeneration after AKI.

By stimulating several hypoxia-inducible factors (HIFs), cells respond to their hypoxic microenvironment. The active HIF transcription factor complex consists of heterodimers that are composed of an oxygen-dependent α-subunit (HIF-α) and a constitutive β-subunit (HIF-β). There are three HIF-α isoforms: HIF-1α, HIF-2α and HIF-3α. Under normal oxygen conditions, the HIF-α protein is hydroxylated on conserved proline residues by prolyl hydroxylases (PHDs), leading to its proteasome degradation mediated by the von Hippel-Lindau (VHL) protein and preventing its interaction with the constitutively expressed β subunit. When the oxygen level decreases below 2%, prolyl hydroxylases lose their function, and HIF-α proteins are stabilized in the cytosol. HIF-α proteins are imported into the nucleus, form heterodimers with HIF-β, and then bind to hypoxia response elements (HREs) in the regulatory regions of target genes involved in angiogenesis, erythropoiesis and metabolism, ultimately leading to normal embryonic development [24–28].

Recently, researchers have explored the potential of stabilizing HIF-α as a therapeutic approach for tissue regeneration. HIF-α stabilizers can increase the expression of HIF-α proteins, thereby mimicking the hypoxic response and promoting tissue regeneration under oxygen-rich conditions. The silencing of PHD2 alone is sufficient to stabilize HIF-1α in human cells under normoxic conditions, whereas the silencing of PHD1 or PHD3 has no effect on HIF-1α protein expression [29]. siRNA-mediated knockdown of PHD2 does not increase HIF-2α stability in MCF7 cells, and significant accumulation of the HIF-2α protein is achieved through the silencing of PHD1 and/or PHD3. These differential responses likely stem from sequence variations in the N-terminal oxygen-dependent degradation (ODD) domains of HIF-1α and HIF-2α [30].

Hypoxia-inducible factor-prolyl hydroxylase domain inhibitors (PHDIs) have been used to clinically treat patients with renal anemia [31–34]. MK-8617 is a newly developed oral PHD pan-inhibitor with strong inhibitory effects on PHD1, PHD2 and PHD3, which could stabilize the HIF-1α, HIF-2α and HIF-3α proteins. In this study, we demonstrated that MK-8617 significantly ameliorated IRI-induced acute kidney injury by promoting the reprogramming of renal proximal tubular cells to Sox9⁺ renal progenitor cells and renal tubule regeneration in vivo.

Materials and methods

Animal models

The mice were maintained under specific pathogen-free conditions at the laboratory animal resource center of Nanfang Hospital. Male C57BL/6 mice weighing approximately 20-22 g were purchased from Southern Medical University Animal Center (Guangzhou, China). The mice were maintained in a temperature-controlled (23-25 °C) room with a 12:12-h light-dark cycle and free access to food and water. All animal studies were performed in accordance with the Guide for the Care and Use of Laboratory Animals and were approved by the Experimental Animal Committee of Nanfang Hospital, Southern Medical University.

Renal ischemia reperfusion injury (IRI) was established as previously described [35]. Briefly, the animals were anesthetized with pentobarbital sodium (50 mg/kg body weight, intraperitoneally). The bilateral renal pedicles were clipped for 32 min using microaneurysm clips. During the ischemic period, body temperature was maintained between 35 °C and 37 °C via a temperature-controlled heating system. After removal of the clips, reperfusion of the kidneys was visually confirmed. The sham group underwent the same procedure without clipping.

Chemical ischemia PHDI screening

Prolyl hydroxylase domain inhibitors were purchased from Selleck Chemicals (Selleck, China). Renal proximal tubular HK2 cells were incubated with optimized concentrations of PHDIs in serum-free medium for 3 h and then with 20 μM CCCP in Ca²⁺ Krebs-Ringer buffer (115 mM NaCl, 1 mM KH₂PO₄, 4 mM KCl, 1 mM MgSO₄, 1.25 mM CaCl₂, and 25 mM NaHCO₃, pH 7.4) for 2 h, followed by 6 h of recovery in regular cell culture medium. The cells were harvested, and the effects of PHDIs on cell proliferation were evaluated via Western blot analysis.

MK-8617 pretreatment

MK-8617 powder was dissolved in vehicle (DMSO:PEG300:Tween-80:ddH₂O = 5:40:5:50). MK-8617 was introduced by intraperitoneal injection (5 mg/kg body weight) at 18 and 6 h before ischemic surgery or cisplatin injection.

Tissue preparation

Kidneys were processed according to previously described protocols [36]. Briefly, mice were anesthetized, sacrificed, and immediately perfused via the left ventricle with ice-cold PBS. Kidneys were hemi-sectioned, and portions were snap-frozen in liquid nitrogen. A portion of the kidney was fixed in 4% neutral buffered formalin at 4 °C for 24 h, processed, embedded in paraffin wax, and sectioned for subsequent analyses. Kidney tissues were fixed with 4% paraformaldehyde for 1-2 h at room temperature, cryopreserved in 30% sucrose/1× PBS overnight at 4 °C, embedded in Tissue-Tek (O.C.T. Compound, Sakura Finetek) and quickly frozen at −80 °C until use.

Assessment of renal damage

Renal damage was evaluated through biochemical analyses (serum creatinine and blood urea nitrogen measurements) and histological examination (H&E staining), as well as by measuring the expression of injury biomarkers (Kim-1 and NGAL). Blood collected at 24 h (IRI) or 72 h (cisplatin nephrotoxicity) via enucleation of the eyeball was utilized for serum creatinine and blood urine nitrogen measurements via an automatic chemistry analyzer (AU480; Beckman 496 Coulter, Brea, CA). Histological analysis of renal tissues was carried out by harvesting the kidneys, followed by paraffin embedding and tissue sectioning. Tissue sections (3 μm) were then stained with hematoxylin and eosin (H&E) via standard methods. Histopathologic scoring was conducted in a blinded fashion by examining ten consecutive 400× fields per section from five mice per group. Renal tubular damage was graded based on loss of the brush border, tubular dilation, cast formation, tubular necrosis, denudation of the basement membrane, and neutrophil infiltration. Each field was scored from 0-5 (0: normal; 1: mild injury, involvement of 0%–10%; 2: moderate injury, involvement of 11%–25%; 3: severe injury, involvement of 26%–49%; 4: highly severe injury, involvement of 50%–75%; and 5: extensive injury, involvement of >75%) [37]. All sections were imaged with an Olympus BX61 microscope.

Quantitative real-time PCR

Total RNA was extracted from kidney tissue by using TRIzol Reagent Kit (AG, China) according to the manufacturer’s protocol. The RNA concentrations were determined via a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA). Total RNA (2 μg) was reverse transcribed using the Hifair^TM III 1st Strand cDNA Synthesis SuperMix Kit (YEASEN, China), and qRT-PCR analysis was then performed via the StepOnePlus^TM Real-Time PCR System (ABI, USA) via the Hieff^® qPCR SYBR^® Green Master Mix (High Rox Plus) (YEASEN, China). The expression levels of the target genes were normalized to those of β-actin/rn18s using the ΔΔCT value method. The specific primers used are shown in Table 1.

Table 1.

Sequences of oligonucleotide primers used for qPCR.

Gene name	Forward (5'-3')	Reverse (5'-3')
Havcr1	TCAGCTCGGGAATGCACAA	TGGTTGCCTTCCGTGTCTCT
Lcn2	TGGCCCTGAGTGTCATGTG	CTCTTGTAGCTCATAGATGGTGC
Lif	ATTGTGCCCTTACTGCTGCTG	GCCAGTTGATTCTTGATCTGGT
Sox9	GTGCAAGCTGGCAAAGTTGA	TGCTCAGTTCACCGATGTCC
Foxd1	CCCCTCCTGGACTAACCGGGC	CGAGGTGTTTGCGCTCCCCG
Lgr4	CCGCTGCCTGCTTGCCTGAA	TCCTGGTGACACGCCGCTTC
Pax8	CAGAAGGCGTTTGTGACAATGA	TGCACTTTGGTCCGGATGAT
Six2	GGACGGATCGTTGTGACTCAGGA	TCGCTGTTCTCCCTTTCCTGGC
Beta-Act	GAGCGCAAGTACTCTGTGTG	AACGCAGCTCAGTAACAGTC
rn18s	TTGACGGAAGGGCACCACCAG	GCACCACCACCCACGGAATCG

Western blot analysis

Western blot analysis was performed as described previously [38]. Briefly, proteins were extracted from kidney tissue and separated on precast 10%-12% SDS-polyacrylamide gels. The proteins were transferred to a nitrocellulose membrane and then blocked with 5% nonfat milk. The membranes were incubated at 4 °C overnight with primary antibodies against Kim-1 (goat, AF1817, R&D, 1:2000), NGAL (rabbit, ab63929, Abcam, 1:1000), p53 (mouse, sc-126, Santa Cruz, 1:1000), Bax (mouse, sc-7480, Santa Cruz, 1:1000), FasL (mouse, sc-19681, Santa Cruz, 1:1000), cleaved caspase-7 (rabbit, 8438, CST, 1:1000), GAPDH (mouse, T0004, Affinity, 1:2000), α-tubulin (mouse, AT819, Beyotime, 1:2000), β-actin (rabbit, 81115-1-RR, Proteintech, 1:2000), HIF-1α (rabbit, ab179483, Abcam, 1:1000), HIF-2α (rabbit, ab109616, Abcam, 1:1000), pH3S10 (rabbit, 53348, CST, 1:1000), cyclin D1 (rabbit, ab16663, Abcam, 1:1000), and c-myc (rabbit, T55150S, Abmart, 1:1000). After being washed in TBST buffer, the membranes were incubated with secondary antibody (goat anti-mouse IRDye 800CW, 926-32210, LI-COR, 1:10000; goat anti-rabbit IRDye 800CW, 926-32211, LI-COR, 1:10000; and donkey anti-goat IRDye 800CW, 926-32214, LI-COR, 1:10000) solution at room temperature for 1-2 h. The signals were visualized via an Odyssey CLx Infrared Imaging System (9140, LI-COR, Inc.).

Immunofluorescence staining

Immunofluorescence staining was performed as described previously [36]. Briefly, 3-µm sections generated by transversely cutting through the entire kidney via a cryotome (Leica Microsystems, Germany) were mounted on microscope slides for immunofluorescence staining. Briefly, kidney cryosections were washed with PBST (PBS, 0.3% Triton X-100). After being blocked with 5% bovine serum albumin in PBST at room temperature for 1 h, the slides were immunostained with primary antibodies against Kim-1 (goat, AF1817, R&D, 1:200), HIF-1α (rabbit, Abcam, 1:50), Sox9 (rabbit, ab185966, Abcam, 1:50), Ki67 (rabbit, ab16667, Abcam, 1:50), pH3S10 (rabbit, 53348, CST, 1:50), and Ki67 (rat, 14-5698-82, Invitrogen, 1:200) at 4 °C overnight. Following primary antibody incubation, the slides were washed in PBST and PBS successively and incubated in secondary antibody solution at room temperature for 1-2 h. The secondary antibodies used were diluted in PBST and included Alexa Fluor® 488 goat anti-rabbit IgG (ab150077, Abcam, 1:200), Cy3 AffiniPure donkey anti-rabbit IgG (711-165-152, Jackson ImmunoResearch, 1:200), Alexa Fluor® 488 donkey anti-goat IgG (ab150129, Abcam, 1:200), and Cy3 AffiniPure donkey anti-rat IgG (712-165-150, Jackson ImmunoResearch, 1:300). After washing, the nuclei were stained with DAPI (C1006, Beyotime) at room temperature for 5 min. LTL (FL-1321, Vector, 1:200) was used to detect proximal tubule epithelial cells. The slides were viewed under an Olympus BX61 microscope with all parameters held constant throughout.

Immunohistochemical staining

The renal tissues were fixed in 4% formaldehyde for 24 h and embedded in paraffin. Tissue sections (3 μm thick) were transversely cut through the entire kidney via a rotary microtome (Leica Microsystems, Germany) and mounted on microscope slides for immunohistochemical staining. Antigens were retrieved via the microwave antigen retrieval method using citric acid buffer (pH 6.0). After blocking with 5% goat serum at room temperature for 1 h, the tissue sections were incubated with anti-HIF-1α (rabbit, ab179483, Abcam, 1:100) and anti-HIF-2α (rabbit, ab109616, Abcam, 1:100) antibodies overnight at 4 °C, followed by incubation with the Biotin-SP AffiniPure goat anti-rabbit secondary antibody (YEASEN, 33103ES60, 1:300) for 1 h. After washing, the slides were incubated with streptavidin solution (YEASEN, 35105ES60, 1:300) for 30 min. DAB working solution (ZSGB-BIO, ZLI-9017) was added to the surface of each tissue section to completely cover the samples. The color development was monitored under an Olympus DP27 microscope at room temperature and terminated with pure water. Nuclei were counterstained with hematoxylin. Color images were acquired via an Olympus DP27 microscope.

TUNEL cell apoptosis assay

The TUNEL assay was carried out using the one-step TUNEL apoptosis assay kit (C1089, Beyotime) following the manufacturer’s instructions with modifications. Briefly, after being washed with PBS and permeated with PBST (PBS, 0.3% Triton X-100), 3-µm kidney cryosections were incubated with 50 µl of TUNEL reaction mixture for 1 h at 37 °C in the dark, followed by the addition of DAPI (5 min) to stain the nuclei.

Transcriptomic analysis

Total RNA was extracted according to the manufacturer’s instructions and assessed via the RNA Nano 6000 Assay Kit of the Bioanalyzer 2100 system (Agilent Technologies, CA, USA). The primary experimental procedures for transcriptome sequencing analysis include RNA quantification and qualification, library preparation for transcriptome sequencing, clustering and sequencing, and data analysis. The image data measured by the high-throughput sequencer were converted into sequence data (reads) via CASSAVA base recognition. Reference genome and gene model annotation files were downloaded from the genome website directly. The index of the reference genome was built using HISAT2 (v2.0.5), and paired-end clean reads were aligned to the reference genome. Differential expression analysis of two groups was performed via the DESeq2 R package (1.20.0). The resulting P values were adjusted via Benjamini and Hochberg’s approach for controlling the false discovery rate. padj<0.05 and |log2(fold change)| > 1 were set as the thresholds for significantly differential expression. Gene Ontology (GO) enrichment analysis of the differentially expressed genes was performed via the clusterProfiler R package (3.8.1). GO terms with corrected P values less than 0.05 were considered significantly enriched with DEGs. KEGG is a database resource for understanding high-level functions and utilities of biological systems, such as cells, organisms and ecosystems, from molecular-level information, especially large-scale molecular datasets generated by genome sequencing and other high-throughput experimental technologies (http://www.genome.jp/kegg/). We used the clusterProfiler R package (3.8.1) to test the statistical enrichment of DEGs in the KEGG pathways. A corrected P value less than 0.05 was considered to indicate significant enrichment of differentially expressed genes. The transcriptome sequencing analysis in our research was supported by Novogene Co., Ltd. (Beijing, China).

Quantification and statistical analysis

Bivariate correlation analysis of the Kim-1 fluorescence intensity and of the percentage of HIF-1α⁺ cells was performed using tissues from mice in the IRI group treated with MK-8617, while correlation analysis of the Kim-1 fluorescence intensity and the percentage of Sox9⁺ cells was performed using tissues from mice in both the IRI group and the IRI group treated with MK-8617. The Kim-1 fluorescence intensity was quantified via ImageJ. HIF-1α⁺ cells and Sox9⁺ cells were quantified as the percentage of the total number of proximal tubular epithelial nuclei counted after DAPI staining. Under 400× magnification, ten proximal tubules were taken randomly from each individual, and five individuals were scored from each group. Linear regression was performed via Spearman correlation analysis.

Image quantification was performed with ImageJ. All of the data are expressed as the mean ± SEM. Statistical analysis was performed via SPSS version 26.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism version 8.0 software (GraphPad Software, La Jolla, CA, USA). Significant differences between two groups were evaluated via two-tailed independent sample t tests. Significant differences among multiple groups were evaluated by one-way analysis of variance (ANOVA) followed by the least significant difference (LSD) test or Dunnett’s T3 test. P < 0.05 was considered statistically significant.

Results

PHDIs effectively induce the proliferation of renal proximal tubular cells in vitro

To test our hypothesis that hypoxia plays an essential role in renal repair/regeneration after AKI in vitro, we performed a small-scale targeted screen of PHDIs to search for small molecules that could effectively promote the proliferation of renal proximal tubular cells. We adopted an in vitro IRI-induced AKI model by inducing “chemical ischemia” in renal proximal tubular cells with carbonyl cyanide 3-chlorophenylhydrazone (CCCP) [39]. Renal proximal tubular HK2 cells were incubated with 20 μM CCCP in Ca²⁺ Krebs-Ringer buffer (115 mM NaCl, 1 mM KH₂PO₄, 4 mM KCl, 1 mM MgSO₄, 1.25 mM CaCl₂, and 25 mM NaHCO₃, pH 7.4) for 2 h, followed by 6 h of recovery to model in vivo renal ischemia reperfusion injury (Figure S1a). The effects of PHDIs on the proliferation of cultured HK2 cells were evaluated via Western blot analysis. As shown in Figure S1, the results of our chemical screening revealed that some PHDIs, such as molidustat, daprodustat and FG-2216, could efficiently stabilize the HIF-1α protein but not the HIF-2α protein in CCCP-induced chemical ischemia in our experimental conditions (Figure S1b-d). Some PHDIs, such as MK-8617 and roxadustat, could effectively stabilize both the HIF-1α protein and the HIF-2α protein and significantly promote the expression of c-myc (Figure S1b,e). Since MK-8617 can stabilize both HIF-α proteins more efficiently than other PHDIs could, we further analyzed the induction efficiency of the HIF-1α and HIF-2α proteins, thereby enabling us to estimate the half-life and optimal concentration of MK-8617 for subsequent in vivo studies. HK2 cells were treated with different concentrations (ranging from 1-50 μM) of MK-8617 for different durations. As shown in Fig. 1a-c, both the HIF-1α and HIF-2α proteins were efficiently induced 3 h after MK-8617 treatment at different concentrations. The protein levels of both HIF-1α and HIF-2α significantly increased 1 h after treatment with 1 µM MK-8617. The induction of HIF-1α protein expression peaked at 3 h and lasted for 24 h (Fig. 1e-f). Under normal conditions, MK-8617 could effectively stabilize both the HIF-1α and HIF-2α proteins (Fig. 1g-i). In the presence of CCCP, MK-8617 significantly stabilized the HIF-1α and HIF-2α proteins while promoting the expression of c-myc, cyclin D1 and pH3S10 (Fig. 1j-l), indicating that MK-8617 could promote HK2 cell proliferation. These results suggested that MK-8617 was very effective in stabilizing the HIF-1α and HIF-2α proteins while promoting the proliferation of HK2 cells under CCCP-induced chemical ischemia conditions. Therefore, we chose MK-8617 to further investigate the role of hypoxia in renal regeneration after AKI.

Fig. 1. MK-8617 effectively induces the proliferation of renal proximal tubular cells in vitro.

a Representative images of the Western blot of HIF-1α and HIF-2α in HK2 cells treated with different doses of MK for 3 h. b, c Quantification data for HIF-1α and HIF-2α shown in (a). d Representative images of the Western blot of HIF-1α and HIF-2α in HK2 cells treated with 1 μM MK for various durations. e, f Quantification data for HIF-1α and HIF-2α shown in (d). g Representative images of the Western blot of HIF-1α, HIF-2α, c-myc, cyclin D1, and pH3S10 in HK2 cells treated with 10 μM MK under normal conditions. h, i Quantification data for HIF-1α, HIF-2α, c-myc, cyclin D1, and pH3S10 shown in (g). j Representative images of the Western blot of HIF-1α, HIF-2α, c-myc, cyclin D1, and pH3S10 in HK2 cells treated with 10 μM MK in mice with CCCP-induced chemical ischemia. k, l Quantification data for HIF-1α, HIF-2α, c-myc, cyclin D1, and pH3S10 are shown in panel j. Data are presented as the means ± SEMs. n = 3 independent experiments. ns indicates no significant difference; *P  <  0.05, **P  <  0.01, and ***P  <  0.001.

MK-8617 ameliorates IRI-induced acute kidney injury

To test our hypothesis that hypoxia plays an essential role in renal repair/regeneration after acute kidney injury, we used MK-8617 to mimic hypoxic conditions in vivo and examined the effects of MK-8617 on renal function, renal tissue structure and renal injury after IRI-induced acute kidney injury. As shown in Fig. 2a, MK-8617 was administered by intraperitoneal injection at 18 and 6 h before IRI  in mice from the IRI group treated with MK-8617, and the same volume of vehicle was given to mice from the IRI group not treated with MK-8617. Renal function was assessed by serum creatinine (Scr) and blood urea nitrogen (BUN) levels. The Scr and BUN levels in the IRI group were greater than those in the sham group 1 day post-IRI. Interestingly, MK-8617 pretreatment significantly reduced the Scr and BUN levels (Fig. 2b-c). HE staining revealed severe pathological changes characterized by loss of the brush border, cast formation and tubular necrosis in the IRI group. These histological changes were dramatically alleviated by MK-8617 pretreatment (Fig. 2d), and those mice treated with MK-8617 presented considerably decreased tubular injury scores (Fig. 2e).

Fig. 2. MK-8617 ameliorates IRI-induced kidney injury.

a Schematic diagram of the experimental design. Blue arrowheads indicate the intraperitoneal injection of MK-8617 (5 mg/kg) before surgery. Mice were euthanized at 1 day post-IRI. (b-c) MK-8617 improved kidney function in IRI mice. Serum creatinine (Scr) (b) and blood urea nitrogen (BUN) (c) levels are shown. d Representative images of hematoxylin and eosin (H&E)-stained renal sections in mice from the three groups. Scale bar, 50 µm. The arrow indicates manifestations of severe renal tubular injury: loss of the brush border, cast formation, and tubular necrosis. e Mean tubular injury scores of ten randomly chosen mouse renal sections under high-power fields (original magnification 400×). f Representative images of the Western blot of Kim-1 and NGAL in renal tissue of mice from the three groups. g, h Quantification data for Kim-1 and NGAL. i, j The mRNA expression of Kim-1 and NGAL assessed via qRT‒PCR. k, l Representative images of Kim-1 immunofluorescence-stained renal sections and quantification data for Kim-1 in mice from the three groups. DAPI was used to stain the nuclei. Scale bars, 200 μm. Data are presented as the means ± SEMs. n  =  5 biologically independent animals. ns indicates no significant difference; *P  <  0.05 and ***P  <  0.001.

The expression of proximal renal tubular injury marker kidney injury molecule-1 (Kim-1) and the distal renal tubular injury marker neutrophil gelatinase-associated lipocalin (NGAL) rapidly increase after AKI [40, 41]. The expression of Kim-1 was significantly increased in the kidneys of mice from the IRI group, which was remarkably blocked by MK-8617 pretreatment at both the protein and mRNA levels, as shown by Western blot (Fig. 2f, g) and quantitative real-time PCR (qRT-PCR) analyses (Fig. 2i). However, MK-8617 had no effect on the expression of NGAL at either the protein or the mRNA level (Fig. 2f, h, j). Similar results were also obtained by immunofluorescence staining with a Kim-1 antibody (Fig. 2k, l). These data showed that MK-8617 pretreatment significantly attenuated IRI-induced renal injury, especially in renal proximal tubules.

MK-8617 prevents renal proximal tubular cell apoptosis induced by IRI

Cell death and proliferation are two major events in the process of tissue regeneration/repair after injury. To evaluate the effect of MK-8617 on cell apoptosis induced by IRI, IRI and MK-8617 pretreatment were performed as described above, and the mice were sacrificed 3 days after surgery. The Western blot results revealed that MK-8617 pretreatment led to dramatic decreases in p53, Bax, FasL and cleaved caspase-7 expression, which was significantly increased due to IRI (Fig. 3a–e). Similarly, the number of TUNEL⁺ cells decreased in the MK-8617 pretreatment group (Fig. 3f, g). To clarify the location of TUNEL⁺ cells, we performed immunofluorescence colocalization staining for TUNEL and Lotus tetragonolobus lectin (LTL), a specific marker of renal proximal tubules. We found that kidneys in the MK-8617 pretreatment group had fewer TUNEL⁺ renal proximal tubular cells than those in the IRI group (Fig. 3f, g). In summary, MK-8617 significantly prevented the apoptosis of renal proximal tubular cells caused by IRI.

Fig. 3. MK-8617 prevents renal proximal tubular cell apoptosis induced by IRI.

a Representative images of the Western blot of p53, Bax, FasL and cleaved caspase-7 in renal tissue 3 days post-IRI. b–e Quantification data for p53 (b), Bax (c), FasL (d) and cleaved caspase-7 (e). f Representative images of the immunofluorescence colocalization of TUNEL and LTL in renal sections 1 day post-IRI. DAPI was used to stain the nuclei. Boxed areas are enlarged. Scale bars, 50 μm. g Quantification of the percentage of TUNEL⁺ cells among LTL⁺ proximal tubular cells after IRI. Data are presented as the means ± SEMs. n  =  5 biologically independent animals. **P  <  0.01, and ***P  <  0.001.

MK-8617 promotes the proliferation of injured renal proximal tubular cells

Renal proximal tubular cells, especially those located in the most vulnerable S3 segment, rapidly proliferate to repair renal tubular structure and function after AKI [6]. The results of immunofluorescence staining for Ki67 and LTL revealed that the number of Ki67⁺ renal proximal tubular cells in MK-8617-pretreated mice 3 days post-IRI was significantly greater than that in mice from the IRI group (Fig. 4a, b), with approximately 24.62% ± 1.84% vs. 4.71% ± 0.41% of LTL⁺ cells being Ki67⁺, respectively. In addition, immunofluorescence colocalization of Ki67 and Kim-1 revealed an increase in Ki67⁺ Kim-1⁺ renal proximal tubular cells in MK-8617-pretreated mice (51.17% ± 4.34% vs. 4.77% ± 0.90%), indicating enhanced proliferation of injured proximal tubular cells after MK-8617 pretreatment (Fig. 4c, d). Similar results were also obtained using the mitosis-specific cell proliferation marker pH3S10 (Fig. S2). Taken together, these results suggest that MK-8617 promotes the proliferation of injured renal proximal tubular cells.

Fig. 4. MK-8617 promotes the proliferation of injured proximal tubular epithelial cells.

a Representative images of the immunofluorescence colocalization of Ki67 and LTL in renal sections 3 days post-IRI. DAPI was used to stain the nuclei. Boxed areas are enlarged. Scale bars, 50 μm. b Quantification of the percentage of Ki67⁺ cells among LTL⁺ proximal tubular cells. c Representative images of the immunofluorescence colocalization of Ki67 and Kim-1 in renal sections 3 days post-IRI. DAPI was used to stain the nuclei. Boxed areas are enlarged. Scale bars, 50 μm. d Quantification of the percentage of Ki67⁺ cells among Kim-1⁺ proximal tubular cells. Data are presented as the means ± SEMs. n  =  5 biologically independent animals. *P  <  0.05, and **P  <  0.01.

The transcriptional regulatory network of the kidney after IRI-induced kidney injury with MK-8617 pretreatment

To investigate the molecular mechanism through which MK-8617 ameliorates IRI-induced acute kidney injury, we performed total mRNA sequencing 1 day post-IRI using whole kidneys from mice treated with MK-8617 or vehicle. The transcriptome expression profiles revealed that 3499 genes were upregulated and 3841 genes were downregulated in the kidneys of IRI mice treated with MK-8617 compared with those of IRI mice without MK-8617 treatment (Fig. 5a). The transcriptomic data were deposited and are available at the National Center for Biotechnology Information under the GEO accession number GSE247560. KEGG enrichment analysis revealed that these upregulated genes participated in multiple signaling pathways, such as the HIF-1 signaling pathway, FoxO signaling pathway and signaling pathways regulating the pluripotency of stem cells (Fig. 5b). Gene Ontology (GO) enrichment analysis revealed that these upregulated genes were associated with multiple biological processes, including response to hypoxia, histone modification, fatty acid metabolic process, glucose metabolic process, kidney development and stem cell population maintenance (Fig. 5c). Multiple nephrogenesis-related genes were significantly upregulated in the MK-8617 pretreatment group (Fig. 5d). Furthermore, via qRT‒PCR, we confirmed that the expression of several nephrogenesis-related genes, including Sox9, Lif, Foxd1, Lgr4, Pax8 and Six2, was upregulated (Fig. 5e-j).

Fig. 5. Changes in the transcriptome after IRI-induced kidney injury in mice with or without MK-8617 pretreatment.

a Volcano plot from bulk RNA-seq analysis showing the differentially expressed genes. b KEGG enrichment analysis revealed that the upregulated genes participated in different signaling pathways. c GO enrichment analysis revealed that the upregulated genes were associated with several biological processes. d Heatmap showing the expression of upregulated genes involved in kidney development. e–j The mRNA expression of Sox9, Lif, Foxd1, Lgr4, Pax8 and Six2 was assessed via qRT-PCR. Data are presented as the means ± SEMs. n  =  5 biologically independent animals. ns indicates no significant difference; *P  <  0.05, **P  <  0.01, and ***P  <  0.001.

MK-8617 may alleviate proximal tubule injury by stabilizing the HIF-1α protein specifically in renal proximal tubular cells

To investigate whether MK-8617 mitigates renal proximal tubule injury via HIF-1α or HIF-2α in IRI-induced acute kidney injury, 8-week-old C57BL/6 J mice were intraperitoneally administered MK-8617 at a dose of 5 mg/kg and sacrificed at 6, 12 or 24 h after injection. Kidney tissues were harvested for immunohistochemical staining to examine the protein expression of HIF-1α and HIF-2α. The results revealed that there was no HIF-1α protein in the renal cortex, whereas HIF-2α was expressed in some glomerular cells under normal conditions. After MK-8617 injection, both HIF-1α and HIF-2α proteins were detected in the renal cortex. HIF-1α was expressed mainly in the nuclei of renal tubular epithelial cells, whereas HIF-2α was expressed in the nuclei of glomerular and interstitial cells. The protein expression levels of both HIF-1α and HIF-2α peaked at 6 h and then gradually decreased (Figure S3). These results suggest that MK-8617 stabilizes the HIF-1α and HIF-2α proteins in renal tissues under normal conditions.

To examine the effect of MK-8617 on the expression of HIF-1α and HIF-2α 1 day post-IRI, we performed immunohistochemical staining of kidney tissues from mice in the three groups (sham, IRI and IRI + MK-8617). A high level of HIF-1α protein was detected in the nucleus of renal tubular epithelial cells in mice from the MK-8617 pretreatment group, whereas no HIF-1α protein was detected in mice from either the sham or IRI group. There was no significant difference in the protein expression level of HIF-2α, which was expressed mainly in glomerular cells, among these three groups (Figure S4). These results suggest that MK-8617 stabilizes the HIF-1α protein rather than the HIF-2α protein in the IRI-induced AKI model.

To localize the HIF-1α protein after MK-8617 pretreatment, we performed immunofluorescence colocalization staining of HIF-1α and LTL. The results revealed that the HIF-1α protein was restricted to renal proximal tubular cells (Fig. 6a-b). The results of immunofluorescence colocalization staining of HIF-1α and Kim-1 revealed a remarkable decrease in Kim-1 expression in areas with high levels of HIF-1α expression (Fig. 6c-d). These results suggest that MK-8617 may alleviate proximal tubule injury by stabilizing the HIF-1α protein specifically in renal proximal tubular cells.

Fig. 6. MK-8617 may alleviate proximal tubule injury by stabilizing the HIF-1α protein specifically in renal proximal tubular cells.

a Representative images of the immunofluorescence colocalization of HIF-1α and LTL in renal sections 1 day post-IRI. DAPI was used to stain the nuclei. Boxed areas are enlarged. Scale bars, 50 μm. b Quantification of the percentage of LTL⁺ cells among HIF-1α⁺ proximal tubular cells. DAPI was used to stain the nuclei. Boxed areas are enlarged. c Representative images of the immunofluorescence colocalization of HIF-1α and Kim-1 in renal sections 1 day post-IRI. DAPI was used to stain the nuclei. Boxed areas are enlarged. Scale bars, 50 μm. d Scatter plot with linear regression showing an inverse correlation between Kim-1 expression level and the number of HIF-1α-positive cells in renal sections of mice from the IRI group pretreated with MK-8617. Data are presented as the means ± SEMs. n  =  5 biologically independent animals. ns indicates no significant difference; ***P  <  0.001.

MK-8617 activates Sox9 expression in renal proximal tubular cells

The results of our bulk mRNA-seq analysis revealed that Sox9 expression was upregulated in the kidneys of IRI mice pretreated with MK-8617 compared with those of IRI mice receiving no pretreatment (Fig. 5d). Coimmunofluorescence staining for Sox9 and LTL revealed a marked increase in Sox9⁺ renal proximal tubular cells after MK-8617 pretreatment at 1 day post-IRI (Fig. 7a). The results of the quantification analysis revealed that 74.84% ± 2.36% of the LTL⁺ renal proximal tubular cells were Sox9⁺ cells (Fig. 7b). In addition, immunofluorescence colocalization of Sox9 and Kim-1 revealed an inverse correlation between Sox9 and Kim-1 expression levels in renal proximal tubular cells (Fig. 7c-d). These results suggest that MK-8617 activated Sox9 expression in renal proximal tubular cells, which in turn promoted the reprogramming of renal proximal tubular cells to Sox9⁺ renal progenitor cells and promoted renal regeneration after IRI-induced acute kidney injury.

Fig. 7. MK-8617 activates Sox9 expression in renal proximal tubular cells.

a Representative images of the immunofluorescence colocalization of Sox9 and LTL in renal sections 1 day post-IRI. DAPI was used to stain the nuclei. Boxed areas are enlarged. Scale bars, 50 μm. b Quantification of the percentage of Sox9⁺ cells among LTL⁺ proximal tubular cells. c Representative images of the immunofluorescence colocalization of Sox9 and Kim-1 in renal sections 1 day post-IRI. DAPI was used to stain the nuclei. Boxed areas are enlarged. Scale bars, 50 μm. d Scatter plot with linear regression showing an inverse correlation between Kim-1 expression level and the number of HIF-1α-positive cells in renal sections of mice from both the IRI group and the IRI group pretreated with MK-8617. Scale bars, 50 μm. Data are presented as the means ± SEMs. n  =  5 biologically independent animals. **P  <  0.01, and ***P  <  0.001.

MK-8617 promotes the proliferation of Sox9⁺ renal progenitor cells

Sox9⁺ renal proximal tubular cells proliferate, expand and differentiate into proximal tubules, distal tubules and loops of Henle segments to repair damaged tubular cells in AKI [10]. Immunofluorescence colocalization of Sox9 and Ki67 revealed that MK-8617 pretreatment significantly promoted the proliferation of Sox9⁺ renal progenitor cells 3 days post-IRI (Fig. 8a, b). These results suggest that MK-8617 may facilitate the repair and regeneration of renal proximal tubules by promoting the proliferation of Sox9⁺ renal progenitor cells after IRI-induced acute kidney injury.

Fig. 8. MK-8617 promotes the proliferation of Sox9⁺ renal proximal tubular cells.

a Representative images of the immunofluorescence colocalization of Sox9 and Ki67 in renal sections 3 days post-IRI. DAPI was used to stain the nuclei. Boxed areas are enlarged. Scale bars, 50 μm. b Quantification of the percentage of Ki67⁺ cells among Sox9⁺ cells. Data are presented as the means ± SEMs. n  =  5 biologically independent animals. *P  <  0.05.

Discussion

Previous studies have shown that hypoxia promotes heart regeneration in adult mice [19]. However, it is unclear whether hypoxia can improve renal tubule regeneration after AKI. In this study, we used the prolyl hydroxylase domain inhibitor MK-8617 to mimic hypoxic conditions and examined the effect of MK-8617 on renal tubule regeneration. We found that MK-8617 significantly ameliorated IRI-induced acute kidney injury and promoted renal tubule regeneration by inducing the reprogramming of Sox9⁺ renal proximal tubular cells (Fig. 9).

Fig. 9. Working model of the promotion by MK-8617 of renal tubule regeneration after IRI.

MK-8617 pretreatment stabilized the HIF-1α protein specifically in injured renal proximal tubular epithelial cells (HIF1α⁺ RPTECs) after IRI (a). HIF-1α activated the expression of nephrogenesis-related genes (Sox9, Lif, Lgr4, Pax8 and Six2) and promoted the reprogramming of HIF1α⁺ RPTECs to Sox9⁺ renal progenitors (b). Sox9⁺ renal progenitors proliferated (c), differentiated (d) and matured into renal proximal tubular epithelial cells (e).

Several lines of evidence have shown that Sox9⁺ renal proximal tubular cells are essential for the repair and regeneration of renal tubules following acute kidney injury [10–16]. Kumar et al. reported that Sox9-descendant cells regenerate functional proximal tubular epithelium after AKI and that Sox9 is required for a normal epithelial repair process after AKI [11]. Kang et al. reported that inducible deletion of Sox9 resulted in reduced epithelial proliferation, more severe injury and fibrosis development [10]. They demonstrated that Sox9⁺ cells show progenitor-like properties in vitro and contribute to the regeneration of proximal tubule, loop of Henle and distal tubule segments but not the collecting duct or glomerular cells following injury in vivo. The results of a study of Sox9 cKO mice revealed that Sox9 activity in proximal tubular cells is required for normal repair [11]. It remains unclear how these Sox9⁺ renal proximal tubular cells are activated. Ma et al. reported that the Notch pathway could mediate Sox9 activation after partial nephrectomy [13]. In this study, for the first time, we show that MK-8617, a HIF-prolyl hydroxylase domain inhibitor, promotes the reprogramming of renal proximal tubular cells to Sox9⁺ renal progenitor cells, which could significantly contribute to enhanced renal tubule regeneration after IRI-induced acute kidney injury. These data suggest that HIF-1α protein stabilizers could be potential novel drugs for preventing IRI-induced acute kidney injury by promoting the reprogramming and proliferation of Sox9⁺ renal proximal tubular cells.

The results of our bulk mRNA sequencing revealed that multiple nephrogenesis-related genes, such as Sox9, Lif, Foxd1, Lgr4, Pax8 and Six2, were significantly upregulated in response to MK-8617 pretreatment. These genes are involved in the early stage of renal development [42–47]. The reactivation of these genes could recapitulate renal development during the renal regeneration process after AKI [10]. Elucidating the role of these genes in renal regeneration after AKI in the future will be informative. Our results showed that MK-8617 stabilizes the HIF-1α protein in renal tubular cells and the HIF-2α protein in glomerular and interstitial cells under normal conditions. However, MK-8617 only increased the protein expression level of HIF-1α but not that of HIF-2α in renal proximal tubular cells after IRI-induced AKI. Sox9 is one of the downstream target genes of HIF-1α [48]. It is reasonable to speculate that MK-8617 may regulate Sox9 expression in renal proximal tubular cells by stabilizing the HIF-1α protein.

Small molecule-based chemical reprogramming allows the manipulation of cell fate to generate the desired cell types, which holds great potential for regenerative medicine [49–51]. Deng et al. demonstrated the chemical reprogramming of mouse and human somatic cells to pluripotent stem cells using a small-molecule compound cocktail [49, 50]. Xiong et al. reported that a chemical cocktail of five small molecules promoted adult endogenous cardiomyocyte proliferation and heart regeneration [51]. PHDIs constitute a new class of oral drugs developed to treat anemia in patients with chronic kidney disease [31–34]. PHDIs have not yet been reported to promote kidney regeneration after injury. Our data showed that MK-8617 pretreatment stabilized the HIF-1α protein and activated Sox9 expression specifically in renal proximal tubular cells after IRI-induced AKI. Strikingly, 1 day post-IRI, 75% of renal proximal tubular cells in the MK-8617 pretreatment group were Sox9⁺, compared with 5% in the IRI group, and more than 20% of these Sox9⁺ cells were Ki67⁺ proliferating cells, indicating that MK-8617 could efficiently promote the reprogramming of renal proximal tubular cells to Sox9⁺ renal progenitor cells. Our current study is the first to demonstrate that MK-8617 can significantly ameliorate IRI-induced acute kidney injury and induce renal tubule regeneration by promoting the reprogramming of renal proximal tubular cells to Sox9⁺ renal progenitor cells. It would be very exciting to examine whether PHDIs could promote the reprogramming of adult cells to progenitor cells, as well as tissue regeneration after injury in other organs.

Author contributions

Conceptualization: FJZ, FFH; Methodology: JL, LTC, YLW, STL, XZH; Validation: JL, LTC, YLW; Formal analysis: FJZ, JL, LTC, YLW, STL, XZH; Investigation: JL, LTC, YLW; Resources: FJZ; Data curation: FJZ JL, LTC; Writing - original draft: FJZ, JL, LTC; Writing – review & editing: FJZ, FFH; Visualization: FJZ, JL, LTC; Supervision: FJZ, FFH; Project administration: FJZ, FFH; Funding acquisition: FJZ, FFH

Funding

This work was supported by the National Natural Science Foundation of China (82470812 to FJZ); Guangdong Basic and Applied Basic Research Foundation (2024A1515012857 to FJZ); the National Natural Science Foundation of China (Key Program) (82030022 to FFH); the Program of Introducing Talents of Discipline to Universities, 111 Plan (D18005 to FFH); the Key Technologies R&D Program of Guangdong Province (2023B1111030004 to FFH); and the Guangdong Provincial Clinical Research Center for Kidney Disease (2020B1111170013 to FFH).

Data availability

The transcriptomic data supporting the findings of this study are openly available at the National Center for Biotechnology Information under the GEO accession number GSE247560.

Competing interests

The authors declare no competing interests.

Supplementary information

The online version contains supplementary material available at 10.1038/s41401-024-01445-y.