Abstract
This study investigated the protective effects of aqueous extracts of Asparagus officinalis and Corn Silk (Stigma maydis) against formaldehyde-induced reproductive toxicity in male albino rats. High-Performance Liquid Chromatography (HPLC) analysis revealed that Gallic acid was the major phenolic component in Corn Silk, while Syringic acid predominated in A. officinalis. Formaldehyde exposure significantly reduced (P < 0.05) body and testicular weights, reproductive hormone levels, sperm count, motility, and normal sperm morphology. It also caused notable histological changes and downregulated fertility-related genes (CDK2, Spem1, Fbxo47, and Tet1). Treatment with the plant extracts, especially at higher concentrations, significantly (P < 0.05) reversed these adverse effects, improved antioxidant status, and reduced tumor necrosis factor-α levels. These findings emphasize the potential applications of A. officinalis and Corn Silk extracts as natural toxicological agents, particularly for mitigating formaldehyde-induced reproductive toxicity. Additionally, their prospective role in fertility treatment underscores their potential to support reproductive health through natural, plant-based interventions.
Keywords: formaldehyde, stigma maydis, Asparagus officinalis, fertility genes, antioxidant properties
Graphical Abstract
Graphical Abstract.
Introduction
As highlighted in numerous studies globally, a significant focus has been on how work-related risks affect the reproductive system. Research has consistently shown that exposure to specific toxins can lead to hormonal imbalances, which in turn cause structural alterations in reproductive organs [1]. One key area of interest is the relationship between hazardous chemicals and infertility [2]. Formaldehyde (FA) is widely used in various products, including cosmetics, adhesives, and the healthcare industry [3]. It is also frequently utilized in anatomy, histology, and pathology laboratories. According to prior research, FA negatively impacts the reproductive, gastrointestinal, and neurological systems [4]. Specifically, it affects the reproductive system by reducing testosterone levels, sperm quality, and concentration, potentially leading to infertility due to testicular injury [5, 6]. Mice and rats exposed to FA through inhalation or intraperitoneal injection exhibited alterations in their seminiferous epithelium, resulting in reduced spermatozoa numbers and motility [7]. In rats, formaldehyde exposure led to significant adverse effects on testicular tissue, including cell atrophy in the seminiferous tubules, swelling of connective tissues, degenerating spermatogenesis, depletion of the germinal layer, vacuoles within the seminiferous tubules, and fewer spermatozoa in the tubule lumen [8]. Further research emphasizes that formaldehyde exposure negatively impacts male reproductive health by reducing semen quality, with observed outcomes such as lower sperm counts, decreased motility, and abnormal sperm morphology [9]. The underlying mechanisms include genotoxicity (chromosome and DNA damage), oxidative stress, hormonal and enzymatic disruptions, apoptosis, and epigenomic changes like DNA methylation. Collectively, these factors impair spermatogenesis and hormonal balance, compromising fertility. Formaldehyde-induced oxidative stress disrupts the balance of antioxidant enzymes, further impairing reproductive functions. Additionally, formaldehyde triggers autophagy in testicular tissues, where excessive autophagy leads to cellular degradation and structural damage in the seminiferous tubules, ultimately reducing sperm production and quality [10]. These findings underscore the multifaceted impact of formaldehyde on male reproductive health and highlight the critical need for further research into protective interventions. Such interventions may include the use of antioxidants and the implementation of stricter occupational safety measures to mitigate the adverse effects associated with formaldehyde exposure.
For many years, people have turned to herbal therapy as a safe and effective means of treatment. It has been suggested that certain plants can alleviate a range of ailments, including those affecting the reproductive system [11].
Corn silk (Stigma maydis), the elongated stigma of Zea mays L., appears as soft, yellowish threads extending beyond the cob [12]. Primarily collecting pollen during pollination, corn silk is a byproduct rich in pharmacological properties, including anti-inflammatory, antidepressant, antihyperlipidemic, antidiabetic, antifatigue, antioxidant, neuroprotective, diuretic, and kaliuretic effects [13]. Its health benefits stem from bioactive compounds like steroids, alkaloids, saponins, carotenoids, anthocyanins, and phenolics [14]. Corn silk helps alleviate jaundice, measles, swelling, gout, hematuria, and prostatitis [12]. The biological activities of its phenolic mixtures, particularly flavonoids and anthocyanins, correlate with their concentrations [15]. It contains lipids, proteins, carbohydrates, minerals, vitamins, and volatile oils [14]. The woody base of A. officinalis L. stalks, often discarded, holds bioactive compounds with health benefits [16]. A. officinalis, a perennial plant of the Asparagaceae family, thrives in temperate and subtropical regions [17]. Valued for its nutritional, pharmaceutical, and industrial applications, it contains anticancer compounds and antioxidants like saponin, aspartic acid, rutin, protodioscin, glutathione, flavonoids, essential vitamins (A, B, C, E), zinc, and fiber [18]. Minerals and amino acids in asparagus extracts combat fatigue, and protect liver cells [19]., and its high folate (B9) and vitamin K content lowers congenital defect risks and may improve erectile dysfunction [20].
Moreover, this study explores the molecular pathways involving CDK2, Spem1, Fbxo47, and Tet1. Cyclins and cyclin-dependent kinases (CDKs) play a crucial role in cell cycle regulation, essential for the proliferation of spermatogenic cells [21]. SPEM family member 2 (Spem2) is vital for spermatid maturation(is necessary for spermiogenesis and male fertility) [22], while F-box-only protein 47 (FBXO47) is involved in protein degradation pathways that maintain cellular homeostasis [23]. Tet1 is essential for DNA demethylation, influencing gene expression critical for reproductive health [24]. Introducing these pathways provides a foundational context for understanding how A. officinalis and Corn Silk extracts may exert their protective effects against formaldehyde-induced reproductive toxicity.
Our study extends existing research by exploring the protective effects of Corn Silk (Stigma maydis) and A. officinalis L. against formaldehyde-induced reproductive toxicity, focusing on sperm quality, hormone levels, oxidative stress, and fertility-related gene expression [20]. While previous studies highlighted their pharmacological properties and bioactive compounds [19], the molecular mechanisms underlying their reproductive benefits remain unclear. We address this by examining key pathways (CDK2, Spem1, Fbxo47, Tet1), providing novel mechanistic insights. Overall, by bridging the gap between pharmacological properties and reproductive health outcomes through a molecular perspective, our study offers a comprehensive understanding of the therapeutic potential of Corn Silk and A. officinalis in combating formaldehyde-induced reproductive toxicity.
Materials and methods
Chemicals
Egyptian firm Agri-Seeds, Herbs, and Medicinal Plants provided the dried corn silk and Asparagus Officinalis. Sigma Chemical Company supplied the formaldehyde with ahigh purity level and analytical grade.
Making corn silk extract
One hundred grams of corn silk were subjected to maceration in 1000 mL of distilled water. The mixture was then heated and boiled at 100 °C for 4 h. After boiling, the sample was filtered through Whatman No. 1 filter paper to separate the filtrate collected in a beaker. The filtrate was subsequently concentrated to dryness, yielding the final extract [25].
Formulation of asparagus Officinalis extract (AOE)
The plants were initially air-dried at room temperature (25 °C). After drying, 100 grams of the samples were extracted in 1 liter of boiling distilled water for 2 h at 100 °C. The mixture was then filtered, and the filtrate was concentrated to dryness. The resulting dried extract was stored at −20 °C until use. All procedures were conducted according to the specified guidelines in the referenced protocol [26].
HPLC bioactive compound detection
HPLC was carried out using an Agilent Technologies 1,100 series system with an autosampler and a diode-array detector. The analysis was performed on an Eclipse XDB-C18 column (150 × 4.6 mm, 5 μm) protected by a C18 guard column (Phenomenex, Torrance, CA). The mobile phase comprised acetonitrile (solvent A) and 2% acetic acid in water (solvent B), with a flow rate of 0.8 mL/min over 70 min. The gradient elution program transitioned from 100% solvent B to 85% B over 30 min, then 50% B over 20 min, followed by 0% B in 5 min, and returned to 100% B in the final 5 min. A 50 μL sample injection was used, with detection wavelengths set at 280 and 320 nm for monitoring benzoic and cinnamic acid derivatives, respectively. Before injection, samples were filtered through a 0.45 μm Acrodisc syringe filter (Gelman Laboratory, MI). Peak identification was achieved by comparing retention times and UV spectra with standard references [27].
Methodological planning
Thirty-six male albino Sprague–Dawley rats, aged 10 to 12 wkand weighing between 129 and 138 g, were obtained from the Vaccine and Immunity Organization, Ministry of Health, Egypt. The animals were housed in well-ventilated cages under controlled conditions, including a 12/12 light/dark cycle, 23 ± 2 °C temperature, and 60% humidity. They were provided unlimited water access and a standard diet [28].
Humane endpoints were clearly established and rigorously followed throughout the study to minimize suffering. These endpoints included regular monitoring for signs of pain or distress, with daily health assessments conducted by trained personnel. Health evaluations focused on behavior, posture, grooming, and overall physical condition, and any abnormalities were promptly addressed. Specific humane endpoint criteria included persistent lethargy, severe respiratory distress, and inability to access food or water. Animals exhibiting these signs were humanely euthanized to prevent undue suffering. To further promote well-being and reduce stress, environmental enrichment strategies, such as providing nesting materials and shelter, were implemented to encourage natural behaviors. After the animals had adjusted to their new environment for a week, they were divided into six groups. First, the animals were divided into two groups; one was a control (6 rats). Thirty rats from the second group were injected intraperitoneally with 37% pure formaldehyde at a dose of 10 mg/kg daily for fourteen days [29], beginning on the twenty-fourth and continuing over the next fourteen days. Thirty rats from the second group were divided into five subgroups, each consisting of six rats. One subgroup served as the control (positive) and was injected with formalin only, while the remaining subgroups received formalin along with additional treatments, which will be detailed subsequently.
The selection of a formaldehyde (FA) dose of 10 mg/kg administered intraperitoneally for fourteen days was based on previously published studies that demonstrated this concentration and exposure period are sufficient to induce measurable reproductive toxicity without causing excessive mortality or severe systemic toxicity. The 10 mg/kg dose has been widely used in experimental models to investigate the toxicological effects of FA on reproductive parameters, allowing for reliable comparison with existing literature [29–32]. In which Chowdhury et al. reported a progressive decrease in testicular weight in rats that received daily intraperitoneal injections of formaldehyde at doses of 5, 10, and 15 mg/kg body weight for 30 consecutive days. The study further noted that the reduction in testicular weight was more pronounced at the higher doses of 10 and 15 mg/kg [33]. In addition, Golalipour et al. [34] reported that experimental animals exposed to formaldehyde (FA) for 2 wk exhibited atrophy of the seminiferous tubules, reduced spermatogenic cells, and disorganization of the seminiferous epithelial cells. Two groups were given a regular diet with corn silk orally for 28 days; the third group received 200 mg/Kg body weight, and the fourth group received 400 mg/Kg. [35]. Group 5 received 200 mg/kg body weight of Asparagus Officinalis orally for 28 days, while group 6 received 400 mg/kg body weight [19]. The Corn Silk and A. officinalis doses were selected based on prior studies and preliminary data confirming their efficacy and safety. These doses enable the evaluation of dose-dependent effects on formaldehyde-induced reproductive toxicity, aligning with traditional use and pharmacological evidence for effective outcomes without toxicity.
Collection of samples
Twenty-four h following the last treatment administration, with ketamine/xylazine anesthesia (7.5 and 1.0 mg/kg via intra-peritoneal infusion) [36]. Blood samples were collected from each rat and left to clot for 30 min at 25 °C. The serum was then separated by centrifugation at 3000 g for 15 min and stored at −80 °C until further analysis. The tastes were weighed after being dried between two sheets of filter paper. The right testes were designated for the measurement of malondialdehyde (MDA), superoxide dismutase (SOD), and glutathione peroxidase (GPx) levels, while the left testes were reserved for histological examination.
Quantity and shape of sperm
After removing the testes, the cauda epididymis was carefully dissected and placed in 2 mL of an isotonic solution (0.9% sodium chloride). The tissue was gently disrupted, and a drop of the resulting solution was placed in a sperm-counting chamber. Sperm cells were counted under a light microscope at 40 × magnification, covering 100 frames, with the total sperm count reported as 106/mL. Additionally, sperm samples from the cauda epididymis were smeared onto two slides for each rat. The slides were air-dried and stained using the Diff-Quik method to assess sperm morphology. Under 100 × magnification, 200 sperm cells per slide were analyzed to determine the percentages of normal sperm and those with head or tail abnormalities, following the specified formula. [37]:
![]() |
Analysis of hormones
Testosterone levels in serum were measured using a radioimmunoassay kit (RIA TESTO CTC KIT) from Dia-Sorin Company, Stillwater, Minnesota, USA. Luteinizing hormone (LH) concentrations were assessed with RIA kits from NIADDK, Bethesda, MD, USA. Serum Follicle-Stimulating Hormone (FSH) levels were determined using immunodiagnostic reagents and an ELISA kit from DiaMetra, Via Giustozzi, Italy.
Quantification of serum TNF-α
The Tumor Necrosis Factor-alpha (TNFα) levels were determined by following the instructions given with each ELISA kit, developed explicitly for rats.
Establishing oxidative stress metrics
The testicular tissues were suspended after removal in a sodium-potassium phosphate buffer (pH 7.4) containing 1.15% KCl. The next step was to centrifuge the homogenates at 10,000 g after they had been at room temperature for 20 min. We stored the collected supernatants in the freezer until we needed them for other analyses. Superoxide dismutase (SOD) activity in the testes was measured using the procedure detailed in [38]. The GPx assay kit was utilized to evaluate the activity of GPx. Following the directions provided by the kits, all of the measures above were carried out. Lipid peroxidation byproducts were measured using thiobarbituric acid reactive chemicals. [39]
Histopathological examination
After fixing the testes tissue with Bouin’s solution, paraffin slices were removed to explore the histological changes utilizing the H and E stain. Then, the slides were examined using a light microscope, and photos were taken. Histopathological examination of the testicular tissues was conducted in a blinded manner. An independent laboratory technician coded tissue samples, and the pathologist performing the analysis was unaware of the treatment group assignments.
Real-time quantitative of gene expression
Total RNA was extracted from testicular tissue using the Genezol RNA extraction kit, following the manufacturer’s instructions. The RNA’s quantity and purity were determined using a Nanodrop spectrophotometer (BioDrop LITE, UK), and its quality and integrity were confirmed through electrophoresis on a 1.0% agarose gel. One microgram of total RNA was utilized in a 20 μL reaction mixture with an oligo (dT) primer, using the FIREScript RT cDNA Synthesis kit (Solis BioDyne) for cDNA synthesis. Gene expression responses to control and test treatments were evaluated using quantitative real-time polymerase chain reaction (qRT-PCR). The qRT-PCR was performed with SYBR Green dye, utilizing TOPreal™ qPCR 2x preMIX (SYBR Green with low ROX) in a 20 μL reaction volume. The reactions were carried out on a Qiagen Rotor-Gene Q 5plex system (Germany) under standard conditions, with the variflex option used to adjust annealing temperatures for different genes on the same plate. Each sample was tested in triplicate, using gene-specific primers, as listed in Table 1. Relative expression (RQ) values were calculated using the 2^−ΔΔCt method, normalized to a reference gene, and control treatment [40].
Table 1.
Primer sequences obtained from the studied gene were used in quantitative RT-PCR.
| Gene name | Sequence (5′ to 3′) | |
|---|---|---|
| Forward primer | Reverse primer | |
| Spem1 | GCTGCTCTTGGGTCTTATCG | TGGACTTTGGGGTAGGTCTG |
| Cdk2 | TCATGGATGCCTCTGCTCTCAC | TGAAGGACACGGTGAGAATGGC |
| Fbxo47 | GCATAGCAAATGCTTTTGCCTGTG | GAGATAGCGTTCATGGTCAGATAC |
| Dnmt3b | TTGGTGCTCAAGGAGTTGGGTATTA | GGGCAGGATTGACGTTAGAGAGA |
| Tet1 | GAGCCTGTTCCTCGATGTGG | CAAACCCACCTGAGGCTGTT |
| GAPDH | TGCACCACCAACTGCTTAG | GATGCAGGGATGATGTTC |
Spem1: Spermatid Maturation 1, Cdk2: Cyclin-Dependent Kinase 2, Fbxo47: F-Box Protein 47, Dnmt3b: DNA Methyltransferase 3 Beta, Tet1: Ten-Eleven Translocation Methylcytosine Dioxygenase 1, GAPDH: Glyceraldehyde-3-Phosphate Dehydrogenase.
Data analysis
We first used GraphPad Prism 8’s one-way ANOVA and Tukey’s honestly significant difference (HSD) test as a first step in statistical analysis. Mean ± standard error of the mean is how the data is presented, and significance is determined as P < 0.05.
Results
Total phenolic compounds in corn silk (stigma maydis) and A. officinalis
HPLC investigation of aqueous extracts of Corn silk is recorded in Table 2 and illustrated in Figs S1 and S2. HPLC analysis of corn silk revealed the presence of (16) compounds. The significant components are Gallic (159.69 μg/g) surveyed by Syringic (41.57 μg/g), Vanillic (15.76 μg/g), Ferulic (15.56 μg/g), Quercetin (10.96 μg/g), Catechin (10.22 μg/g), Caffeic (9.58 μg/g), p-hydroxybenzoic (4.81 μg/g) While lowest compounds are Chrysin (0.85 μg/g) and Rutin (1.21 μg/g). While HPLC analysis of A. officinalis revealed the presence of (17) compounds. The major components are Syringic (85.59 μg/g) followed by Caffeic (84.06 μg/g), Ferulic972.32 μg/g), Vanillic (54.06 μg/g), Rutin (50.61 μg/g), Sinapic (18.92 μg/g) While lowest compounds are Chrysin(0.31 μg/g) and Quercetin (2.20 μg/g).
Table 2.
Phenolic compounds in aqueous extracts of corn silk and Asparagus officinalis (μg/g).
| Phenolic Compounds | Corn silk (μg/g) | A. officinalis (μg/g) |
|---|---|---|
| Gallic | 159.69 | 10.72 |
| p-hydroxybenzoic | 4.81 | 4.12 |
| Cateachin | 10.22 | 10.68 |
| Chlorogenic | 3.67 | 10.13 |
| Caffeic | 9.58 | 84.06 |
| Syringic | 41.57 | 85.59 |
| Vanillic | 15.76 | 54.06 |
| Ferulic | 15.56 | 72.32 |
| Sinapic | 1.42 | 18.92 |
| p-coumaric | 3.82 | 17.23 |
| Rutin | 1.21 | 50.61 |
| Rosmarinic | – | 7.16 |
| Apigenin-7-glucoside | – | 12.95 |
| Cinnamic | 2.82 | 3.23 |
| Qurecetin | 10.96 | 2.20 |
| Apigenin | 4.42 | – |
| Kaempferol | 1.32 | 5.33 |
| Chrysin | 0.85 | 0.31 |
Body and testes weights
According to Table 3, rats injected with formaldehyde exhibited a significant reduction (P < 0.05) in both body weight gain and testicular weight percentage compared to the normal control group. Conversely, rats treated with Corn Silk and A. officinalis aqueous extracts showed a significant improvement (P < 0.05) in weight gain. Additionally, rats treated with the extracts demonstrated a notable increase in testicular weight, indicating recovery from formaldehyde-induced toxicity. The results further suggest that a higher concentration of Corn Silk extract was more effective in mitigating the adverse effects of formaldehyde than a lower concentration.
Table 3.
Protective effect of corn silk and Asparagus officinalis aqueous extracts on body weight gain (BWG) and relative testes weight in rats treated with formaldehyde for 28 days.
| BWG (g) | Relative testes weight % | |
|---|---|---|
| Normal control | 48.34±1.07a | 1.95±0.03a |
| formaldehyde | 26.13± 2.03e | 1.30±0.05e |
| Corn silk 200 mg | 37.31±1.00d | 1.50±0.05d |
| Corn Silk 400 mg | 42.85±2.00b | 1.70±0.03b |
| Asparagus 200 mg +FA | 36.18±2.52d | 1.45±0.03d |
| Asparagus 400 mg +FA | 39.63±1.00c | 1.60±0.03c |
Means with different superscript letters (a –f) in the same column are significantly different at P < 0.05. Data are presented as Mean ± SE (n = 6 / group).
Reproductive hormones
The effect of formaldehyde on reproductive hormones was evident, with exposed animals showing significantly reduced serum levels of FSH (P < 0.001), LH (P < 0.001), and testosterone (P < 0.001) compared to the control group. In contrast, rats treated with aqueous extracts of A. officinalis and Corn Silk exhibited significantly higher hormone levels than the formaldehyde group. Specifically, FSH levels were (P = 0.008) for Corn Silk 200 mg and (P < 0.001) for Corn Silk 400 mg. LH levels were (P = 0.010) for Corn Silk 200 mg and (P < 0.001) for Corn Silk 400 mg. Testosterone levels reached (P = 0.012) at 200 mg and (P < 0.001) at 400 mg of cornsilk. The 400 mg Corn Silk extract provided the most pronounced improvement (P < 0.001), with hormone levels approaching those of the control group, as illustrated in Fig. 1.
Fig. 1.
Protective effects of aqueous extracts of corn silk (stigma maydis) and Asparagus officinalis on serum levels of reproductive hormones in male rats exposed to formaldehyde for 28 days. (A) Follicle-stimulating hormone (FSH) levels (mIU/mL), (B) luteinizing hormone (LH) levels (mIU/mL), and (C) testosterone levels (ng/mL). Data are presented as mean ± standard error (SE) for six rats per group (n = 6). Mean with different superscript letters (a–d) within the same column are significantly different (P < 0.05).
Sperm count, morphology, and motility
The formaldehyde group’s sperm count and motility were lower than the control group’s equivalent values. Both sperm count and motility were significantly improved in the groups treated with formaldehyde and aqueous extracts of A. officinalis and corn silk. Injected with formaldehyde significantly raised abnormal sperm morphology associated with the control rats. However, Corn Silk and A. officinalis aqueous extracts concomitant with formaldehyde injection improved sperm morphology when associated with formaldehyde-treated rats (Table 4). Corn silk and asparagus consumption could alleviate the side effects of formaldehyde. The high concentration of corn silk and asparagus had a positive impact compared to the low concentration. Various sperm defects are observed in the formaldehyde group, including detached heads, bent middle pieces, headless tails, coiled tails, and cytoplasmic droplets. There are improvements in the treatment with asparagus and silk corn with the appearance of some effects, including a bent middle piece with many cytoplasmic droplets in asparagus 200, twisted neck in corn silk 200, and few detached heads in Asparagus400. Meanwhile, corn silk (400) retained normal sperm morphology (Fig. 2).
Table 4.
Protective effect of corn silk and Asparagus officinalis aqueous extracts on sperm count, sperm motility, and abnormal sperm morphology in rats treated with formaldehyde for 28 days.
| Sperm count (106/mL) | Sperm motility (%) | Abnormal sperm morphology (%) | |
|---|---|---|---|
| Normal control | 100.30±3.80a | 95.00±2.00a | 5.00±1.00d |
| formaldehyde | 52.10±2.80e | 67.50±2.50d | 22.50±2.50a |
| Corn silk 200 mg | 75.20±3.20d | 87.50±2.50b | 12.50±2.50c |
| Corn Silk 400 mg | 92.95±3.25b | 90.17±2.26ab | 7.50±2.50d |
| Asparagus 200 mg+FA | 69.45±2.65d | 79.33±5.03c | 17.50±2.50b |
| Asparagus 400 mg+ FA | 83.62±3.96c | 90.17±2.25ab | 7.50±2.50d |
Means with different superscript letters (a –d) in the same column are significantly different at P < 0.05. Data are presented as Mean ± SE (n = 6 / group).
Fig. 2.
Microscopic images of epididymal smears stained with 0.05% aqueous eosin-Y solution, illustrating sperm morphology in male rats under a light microscope at 400 × magnification. (A) The control group showed morphologically normal sperm. (B) Formaldehyde-treated group exhibiting various sperm defects, including detached heads (open arrowhead), bent middle pieces (black arrow), headless tails (red arrow), coiled tails (closed arrowhead), and cytoplasmic droplets (blue arrows). (C) The Asparagus officinalis (200 mg) treated group showed bent middle pieces (black arrow) with numerous cytoplasmic droplets (blue arrows). (D) Corn silk (stigma maydis) (200 mg) treated group displaying twisted necks (black arrowheads). (E) The asparagus officinalis (400 mg) treated group showed a few detached heads (black arrowheads). (F) Corn silk (stigma maydis) (400 mg) treated group retaining normal sperm morphology.
Serum TNF-α
The results indicated that the mean tumor necrosis factor-α (TNF-α) levels were significantly elevated in the formaldehyde group compared to the negative control. However, all treatment groups exhibited a significant reduction (P < 0.05) in TNF-α levels compared to the positive control group. Notably, the group treated with 400 mg/kg of aqueous corn silk extract showed the lowest TNF-α levels, as illustrated in Fig. 3.
Fig. 3.
Protective effects of aqueous corn silk (stigma maydis) extracts and Asparagus officinalis on tumor necrosis factor-alpha (TNF-α) levels in male rats exposed to formaldehyde for 28 days. TNF-α concentrations are expressed as pg/mg protein. Data are presented as mean ± standard error (SE) for six rats per group (n = 6). Means with different superscript letters (a–c) within the same column are significantly different (P < 0.05).
The role of antioxidant enzymes in preventing oxidative stress
As shown in Fig. 4, formaldehyde injection led to a substantial (P < 0.05) reduction of testicular SOD and GPx activities, respectively, assessed in the control group. Besides, the treatment groups with Corn Silk and A. officinalis aqueous extracts with formaldehyde prominently reversed formaldehyde-induced alterations in the enzymes above. Also, the administration of formaldehyde caused a pointed elevation (P < 0.05) in the testis tissue of MDA matched to the control group. Conversely, Corn Silk and A. officinalis aqueous extracts followed in a meaningful decline (P < 0.05) in MDA quantities compared to the formaldehyde—group. Again, Corn Silk 400 mg was more effective in reducing the side effects of formaldehyde.
Fig. 4.
Protective effects of aqueous corn silk (stigma maydis) extracts and Asparagus officinalis on antioxidant enzyme activities and lipid peroxidation in testicular tissues of male rats exposed to formaldehyde for 28 days. (A) Superoxide dismutase (SOD) activity (U/mg protein), (B) glutathione peroxidase (GPx) activity (μM/mg protein), and (C) malondialdehyde (MDA) levels (nmol/g protein). Data are presented as mean ± standard error (SE) for six rats per group (n = 6). Means with different superscript letters (a–fd) within the same column are significantly different (P < 0.05).
Gene expression
The study’s fertility genes are shown in Fig. 5 with their relative expression. Formaldehyde had a side effect on gene expression for the selected fertility-related genes. It significantly downregulated the expression of these genes. The highest inhibition rate in the expression level of CDK2, Spam1, Fbxo47, and Tet1 genes were 95%, 85%, 99%, and 92% respectively. Dnmt3b exhibited a less pronounced reduction than some other genes, such as Fbxo47 and CDK2, which were more drastically suppressed. In CDK2, all treatments improved the gene expression. The best treatments were Asparagus 200 and 400. In Spem1, the treatment with corn silk 200 increased the expression of the gene ~7 foldings compared with the control. This expression decreases with an increase in the dose of corn silk, ~ 2.1 foldings compared with control. The treatment with asparagus 200 was the nearest treatment to the negative control. In Fbxo47, asparagus 200 increased the gene expression ~3 folding in assessment with the control; when the dose increased, the gene expression was inhibited (50%) compared to the control. In corn silk, the gene expression increased with an increase in the dose. Tet1 expression increased with the treatment of corn silk and asparagus 200; with an increase in the dose, the gene expression decreased, and they were the nearest treatments to the negative control. The increased doses of con silk and asparagus were the nearest to the negative control than the low doses in Dnmt3b expression Fig. 5. Genes involved in immediate cellular responses, such as CDK2 and Fbxo47, were more drastically affected due to their acute sensitivity to DNA damage and stress, showing 95% and 99% reductions, respectively. In contrast, genes related to epigenetic regulation, like Tet1 and Dnmt3b, displayed differential responses, with Tet1 (demethylation) being more vulnerable than Dnmt3b (methylation), which was less affected and showed greater stability. The differential recovery patterns observed after Corn Silk and A. officinalis treatments suggest that phytochemicals in these extracts help restore gene function, particularly at higher doses. However, optimal dosing remains essential for achieving maximum therapeutic effects.
Fig. 5.
Gene expression profile changes in key fertility-related genes in testicular tissues of male rats under different treatment conditions. (A) Cyclin-dependent kinase 2 (CDK2), (B) spermatid maturation 1 (Spem1), (C) F-box protein 47 (Fbxo47), (D) ten-eleven translocation methylcytosine dioxygenase 1 (Tet1), and (E) DNA methyltransferase 3 beta (Dnmt3b). Experimental groups included the control, formaldehyde-exposed, and rats treated with aqueous extracts of corn silk (stigma maydis) (200 mg and 400 mg) and Asparagus officinalis (200 mg and 400 mg). Data are presented as means ± standard error (SE) of relative expression levels. Means with different superscript letters (a–f) are significantly different (P ≤ 0.05).
Histological investigation
The histology of the testis in the control rat proved the normal architecture of the testis, including spermatogonia, spermatocytes, spermatozoa, Sertoli cells, and myoid cells, in addition to normal interstitial cells. The formaldehyde-treated group showed an increase in the spaces between spermatogenic cells and separation of germinal epithelium in addition to the groove of the basement membrane of the seminiferous tubule and congestion of interstitial blood vessels. In addition, Formaldehyde with A. officinalis (200 and 400 mg) treated groups showed separation of germinal epithelium, congestion of interstitial blood vessels, desquamated germinal epithelium, and shrinkage and increased spaces between spermatogenic cells. The improvement was in the Formaldehyde with corn (400 mg) treated group, while 200 showed separation between different layers of germinal epithelium of some tubules and shrinkage of some spermatogenic cells. As shown in Fig. 6.
Fig. 6.
Photomicrographs of testicular tissue sections stained with hematoxylin and eosin (H&E) showing histological changes in male rats under different treatment conditions (scale bar = 50 μm). (A) The control group displayed normal testicular architecture, including seminiferous tubules (asterisk) containing spermatogonia (green arrow), spermatocytes (black arrows), spermatozoa (yellow arrowheads), Sertoli cells (yellow arrow), myoid cells (red arrow), and interstitial cells (black arrowheads). (B) Formaldehyde-treated group showed increased spaces between spermatogenic cells (green arrow), separation of the germinal epithelium (black arrow), corrugation of the basement membrane of seminiferous tubules (red arrow), and congestion of interstitial blood vessels (arrowheads). (C) Formaldehyde with Asparagus officinalis (200 mg) treatment shows separation of the germinal epithelium (black arrow), congestion of interstitial blood vessels (arrowheads), and desquamation of the germinal epithelium (green arrow). (D) Formaldehyde with A. officinalis (400 mg) treatment displays separation between different layers of the germinal epithelium (black arrow), congestion of interstitial blood vessels (arrowhead), and shrinkage with increased spaces between spermatogenic cells (green arrow). (E) Formaldehyde with corn silk (stigma maydis) (200 mg) treatment showing separation between germinal epithelium layers of some tubules (black arrows) and shrinkage of specific spermatogenic cells (green arrows). (F) Formaldehyde with corn silk (stigma maydis) (400 mg) treatment showing normal testicular architecture with minor congestion of interstitial blood vessels (arrowhead).
Multivariate assessments
As shown in Fig. 7, The heatmap shows strong positive correlations between most reproductive hormones (FSH, LH, testosterone) and oxidative stress markers (TNF-α, SOD, GPx). Sperm-related mRNAs, such as CDK2 and Sperm1, also exhibit high correlations with these markers. In contrast, abnormal sperm morphology negatively correlates with sperm motility (−0.91) and sperm count (−0.90), indicating that higher abnormal morphology is linked to poorer sperm quality. Overall, a close interplay exists between hormones, oxidative stress, and sperm quality.
Fig. 7.
Comprehensive heatmap of Pearson correlation coefficients among hormonal levels, oxidative stress markers, gene expression profiles, and sperm quality parameters across different treatment groups. Red hues represent positive correlations, while negative correlations are shown in blue, with the intensity corresponding to the correlation strength.
The heatmap shows that the normal control group positively correlates with healthy reproductive parameters, while formaldehyde negatively impacts sperm quality and oxidative stress markers. Treatments with Corn Silk and Asparagus, particularly at higher doses, show positive effects on testosterone, SOD, and sperm motility, suggesting these treatments mitigate formaldehyde’s adverse effects on reproductive health Fig. 8
Fig. 8.
Hierarchical clustering heatmap illustrating the relationships among reproductive and oxidative stress parameters across different treatment groups. Color intensity represents the degree of correlation, with red indicating positive associations and blue representing negative associations, while dendrograms depict the hierarchical relationships among the measured parameters.
Fig. 9 showing the OPLS-DA plot shows clear group separation. The normal control clusters on the right, while the formaldehyde group deviates to the left, indicating adverse effects. Higher doses of Asparagus and Corn Silk cluster closer to the control, suggesting protective effects against formaldehyde-induced damage. The volcano plot illustrates the differentially expressed genes in the testis. Genes with significant upregulation are highlighted in yellow on the right, while significantly downregulated genes are shown in blue on the left. The x-axis represents the log2 fold gene expression change, and the y-axis represents the -log10(P-value), indicating the statistical significance. Genes further from the center are more significantly differentially expressed, with thresholds marked by dashed lines. The plot provides a clear distinction between upregulated and downregulated genes, helping to identify key genes affected by the experimental conditions (Fig. 10). Fig. 11 shows the importance (VIP scores) and heatmap of biological markers, including hormone levels (FSH, LH, Testosterone), oxidative stress indicators (SOD, GPx, MDA), and sperm health factors across different treatments (Control, Formaldehyde, and various doses). Higher VIP scores suggest more influence on abnormal sperm morphology. Heatmap colors indicate variations in marker levels, with red representing increased levels and blue for decreased levels.
Fig. 9.
Orthogonal partial least squares discriminant analysis (OPLS-DA) score plot comparing the effects of formaldehyde exposure and protective treatments on sperm parameters in male rats. The plot illustrates the distribution of six experimental groups based on key sperm parameters, including sperm count, motility, and morphology. Groups represented are the normal control, formaldehyde-treated, and rats treated with aqueous extracts of corn silk (stigma maydis) (200 mg and 400 mg) and Asparagus officinalis (200 mg and 400 mg). Each group is depicted using distinct colors and markers, with confidence ellipses indicating each group’s variance and clustering patterns along the principal component axes.
Fig. 10.
Volcano plot illustrating differentially expressed genes in testicular tissues under various experimental conditions. The x-axis represents the log2 fold change, while the y-axis shows the -log10 (p-value), highlighting the significance and magnitude of gene expression changes. Orange points indicate significantly upregulated genes (log2 fold change > 1, P-value < 0.05), while blue points represent significantly downregulated genes (log2 fold change < −1, P-value < 0.05). Grey points correspond to genes that do not meet these thresholds and are considered not significantly differentially expressed. Dashed lines denote the significance thresholds for log2 fold change and p-value, facilitating the identification of genes most affected by the treatments. This plot provides a comprehensive overview of gene expression alterations associated with formaldehyde exposure and the protective effects of corn silk (stigma maydis) and Asparagus officinalis extracts.
Figure 11.
Variable importance in projection (VIP) scores and Heatmap of key biomarkers across treatment groups. This figure presents the variable importance in projection (VIP) scores for key biomarkers related to hormonal levels, oxidative stress, gene expression, and sperm parameters alongside a heatmap showing their variation across six treatment groups: Control, formaldehyde, corn silk 200 mg, corn silk 400 mg, asparagus 200 mg, and asparagus 400 mg. Biomarker names are standardized in capitalization and formatting, while the heatmap color scale includes a clear title indicating normalized biomarker levels. The VIP scores panel is labeled as “panel a,” and the heatmap as “panel B” for clarity. Additionally, the dashed line in the VIP scores plot, representing the threshold VIP score of 1.0, is clearly defined to indicate the biomarkers with significant importance across treatment groups.
Discussion
Formaldehyde (FA) exposure via oral administration [41], intraperitoneal injection [6], or inhalation [42] significantly reduces sperm quality and quantity [43]. Specifically, 37% of FA intraperitoneal injection causes severe testicular damage and sperm impairment. In many developing countries, herbal medicines, including plant extracts, are commonly used to manage infertility [44]. This study explores the protective effects of Corn Silk and A. officinalis aqueous extracts against FA-induced testicular toxicity in male albino rats. Corn Silk, identified via HPLC analysis, contains polyphenols like pelargonidin, ferulic acid, apigenin, chlorogenic acid, and caffeic acid [45], with the ellagic group compounds being the most abundant [46]. A. officinalis contains phenolic compounds such as quercetin, kaempferide, and phenolic acids, including coumaric, chlorogenic, p-hydroxybenzoic, caffeic, and ferulic acids [47], with rutin identified as the primary phenolic component [48]. These phytochemicals suggest a potential role in mitigating FA-induced reproductive toxicity through antioxidant and protective mechanisms.
FA-treated groups exhibited significantly lower body and testis weights than controls, consistent with prior findings [49], where reductions were linked to seminiferous tubule shrinkage and decreased tubule diameters [32]. The decreased body weight was likely due to reduced feeding in FA-exposed rats. However, rats treated with Corn Silk and A. officinalis extracts showed marked improvements in testicular and body weights, aligning with previous studies [50, 51]. This improvement may result from the antioxidant properties of the extracts, which could stimulate appetite and promote weight gain [52].
Results showed that formaldehyde (FA) injection significantly impaired sperm parameters (motility, morphology, and count) and testicular tissue health compared to controls. Consistent with previous studies [43], serum testosterone and LH levels decreased, attributed to Leydig cell deformation and lipid accumulation, indicating disrupted testosterone biosynthesis. However, Zahra et al. reported no significant testosterone changes with 2.5–10 mg/kg FA doses over 40 days [53]. FA-induced seminiferous tubule atrophy reduced sperm count by increasing ROS levels [54, 55], triggering germ cell apoptosis and impairing sperm motility through lipid peroxidation of the sperm membrane, disrupting Na/K-ATPase activity [56]. This peroxidation can also damage the mid-piece axoneme and hinder capacitation and the acrosomal response, further contributing to infertility [6, 57]. Notably, antioxidants in corn silk and asparagus officinalis extracts can neutralize free radicals, stabilize cell membranes, and protect tissues from oxidative damage [58, 59]. HPLC analysis identified gallic acid as the main antioxidant in Corn Silk, alongside alkaloids and flavonoids. Co-treatment with ω-3 fatty acids or gallic acid improved sperm count motility and reduced abnormalities, protecting against Mn-induced damage [60]. Gallic acid also mitigated aflatoxin B1-induced reproductive damage by enhancing antioxidant defenses and reducing histological alterations in reproductive tissues [61]. Formaldehyde exposure impaired sperm morphology, count, and motility, with increased apoptosis in spermatogenic cells due to oxidative stress and seminiferous tubule shrinkage [49, 62–64]. However, treatment with Corn Silk and A. officinalis extracts restored sperm structure and function, attributed to their antioxidant properties. Corn Silk contains flavonoids, alkaloids, phenols, and tannins [14, 65], while Asparagus is rich in steroidal saponins, known for reducing genitourinary toxicity and providing antioxidant protection [19, 66]
Formaldehyde exposure induces histological changes in the testes, including enlarged inter-spermatogenic cell gaps, germinal epithelium separation, seminiferous tubule basement membrane grooving, and interstitial blood vessel congestion, consistent with Zare et al. [62]. Common abnormalities include seminiferous tubule atrophy, reduced spermatogenic cells, and lumina oligozoospermia [66]. Corn silk extract mitigates these effects by restoring sex hormone levels and sperm count through lipid peroxidation reduction, aligning with Sa’adatzadeh et al. [67]. Rich in steroids, tannins, alkaloids, proteins, vitamins, and flavonoids, corn silk also counteracts nicotine-induced seminiferous epithelium damage [68]. Similarly, A. officinalis extract exhibits anti-inflammatory, antioxidant, immunomodulatory, and antiapoptotic properties [69].
The highly poisonous formaldehyde environment can enhance ROS generation in testicular tissues and diminish the efficacy of the testicular antioxidant system. [70]. Our study demonstrated that formaldehyde (FA) exposure significantly reduced the activities of key antioxidant enzymes, including superoxide dismutase (SOD) and glutathione peroxidase (GSH-Px), while markedly increasing malondialdehyde (MDA) levels. These alterations indicate heightened oxidative stress and lipid peroxidation, consistent with previous studies showing that prolonged FA exposure disrupts the pro-oxidant and antioxidant balance essential for cellular function [71, 72]. Specifically, MDA, a primary lipid peroxidation product, interferes with protein biosynthesis by forming DNA, RNA, and protein adducts, thereby compromising cellular integrity [30, 73]. Antioxidants reduce oxidative stress by neutralizing free radicals, inhibiting free radical-producing enzymes, and boosting antioxidant enzyme expression. For example, catalase (CAT) converts hydrogen peroxide into oxygen [74], while SOD neutralizes superoxide radicals, maintaining the oxidant-antioxidant balance [75]. Our findings align with these mechanisms, as treatment with A. officinalis and corn silk extracts restored SOD and GSH-Px activities, reduced MDA levels, and improved testicular structure and sperm quality. Previous studies have highlighted the antioxidant, anti-inflammatory, and anti-apoptotic properties of various natural substances derived from organic foods and herbal remedies [76]. Similar to our findings, antioxidants such as Matricaria chamomilla [76], proanthocyanidins [77], epigallocatechin-3-gallate from green tea [78], pumpkin oil [79], and Nigella sativa [80] have shown protective effects against oxidative stress. Comparative studies suggest that certain antioxidants, such as lycopene, are significantly more potent than others. Lycopene, in particular, has been described as having approximately ten times the antioxidant capacity of vitamin E (α-tocopherol) [81]. However, further research is required to establish these antioxidants’ precise classification and comparative efficacy. Melatonin, in particular, plays a noteworthy role in reproductive protection due to its ability to cross all body barriers, including the blood-testis barrier, owing to its hydrophilic nature [38, 73, 74]. Its lipophilic properties also allow it to penetrate cell membranes and organelles, where it stimulates DNA repair enzymes, preventing DNA damage [66, 74]. Melatonin has been reported to reduce oxidative stress and apoptosis in infertility cases, as it is synthesized from serotonin in Leydig cells, influencing androgen production and sperm formation [82]. Additionally, melatonin inhibits apoptosis in testicular cells through the activation of melatonin receptors MT1 and MT2 [83], providing further protection against testicular damage, even when administered post-exposure [30]. Antioxidants counteract this by neutralizing reactive oxygen species (ROS) and enhancing endogenous antioxidant defenses. For instance, vitamin E supplementation has been shown to protect against formaldehyde-induced testicular damage by enhancing antioxidant defenses [10].Similarly, Hedeoma drummondii extract has demonstrated protective effects on sperm quality and DNA integrity in formaldehyde-exposed rats [84].These findings suggest that antioxidants may offer protective benefits against formaldehyde-induced reproductive toxicity in male rats.
Our research demonstrated a significant decline in the expression of fertility-related genes (CDK2, Spam1, Fbxo47, Tet1, and Dnmt3b) in testicular tissue following formaldehyde (FA) exposure, indicating their association with FA-induced male reproductive damage [85]. Notably, Cdk2 expression was significantly impacted, emphasizing its critical role in male fertility, particularly in testes-resident premeiotic spermatocytes [86].
A. officinalis and corn silk supplementation positively influenced gene expression. Corn silk, recognized for its anti-inflammatory, anti-hypertensive, and anti-allergic properties [87], and A. officinalis, with potent antioxidant properties, mitigated oxidative stress, suggesting their potential as natural infertility remedies [88]. Their protective effects are attributed to their rich polyphenolic content, including gallic acid, syringic acid, quercetin, and ferulic acid, which possess potent antioxidant properties [89]. These bioactive compounds directly scavenge reactive oxygen species (ROS), reduce levels, and enhance the activities of endogenous antioxidant enzymes such as superoxide dismutase (SOD), catalase (CAT), and glutathione peroxidase (GSH-Px), thereby restoring oxidative balance [90, 91].
Corn silk and A. officinalis exhibit anti-inflammatory and anti-apoptotic effects by suppressing pro-inflammatory cytokines like tumor necrosis factor-alpha (TNF-α) and inhibiting mitochondrial apoptosis pathways, preventing germ cell death [92, 93]. Our findings also indicate that these extracts modulate the expression of fertility-related genes, possibly through epigenetic mechanisms such as DNA demethylation mediated by Tet1, restoring normal spermatogenesis and reproductive function [94, 95]. Moreover, these extracts protect Leydig cells from oxidative damage, ensuring testosterone biosynthesis and maintaining hormonal balance via the hypothalamic–pituitary-testicular (HPT) axis [86]. This study also presents the first investigation into formaldehyde’s impact on Spam1, Fbxo47, and Tet1. FA exposure reduced Dnmt3b expression, disrupting DNA methylation essential for development (Gagliardi et al., 2018). These findings align with previous research showing decreased DNMT3a and DNMT3b levels following FA exposure [95]. Interestingly, corn silk may regulate fertility-related genes, as it has been shown to increase GHR and IGF mRNA levels [96]. Collectively, these combined actions highlight the therapeutic potential of corn silk. The findings of this study have significant clinical relevance, particularly in the context of developing fertility treatments for individuals exposed to environmental toxins such as formaldehyde. The demonstrated ability of Corn Silk (Stigma maydis) and A. officinalis extracts to restore reproductive hormone levels, improve sperm quality, and regulate fertility-related gene expression suggests their potential as natural therapeutic agents in managing male infertility. Given their potent antioxidant, anti-inflammatory, and gene-modulatory properties, these extracts could be incorporated into fertility treatment regimens to counteract oxidative stress-induced reproductive damage. This translational potential is significant for individuals in occupational settings where formaldehyde exposure is standard, offering a natural, accessible, and potentially safe adjunct to conventional fertility therapies. Future clinical studies are warranted to explore the efficacy, safety, and dosage optimization of these plant extracts in human populations, potentially paving the way for novel, plant-based interventions in reproductive health management.paragus officinalis in mitigating FA-induced reproductive toxicity.
Conclusion
The study contributes significantly to toxicology and reproductive health by demonstrating the protective effects of Corn Silk (Stigma maydis) and A. officinalis against formaldehyde-induced reproductive toxicity. Specifically, it highlights how these natural extracts, rich in antioxidant compounds, can mitigate oxidative stress, restore reproductive hormone levels, improve sperm quality, and regulate fertility-related gene expression. These findings underscore the potential of Corn Silk and A. officinalis as promising natural therapeutic agents for addressing infertility and reproductive dysfunction caused by environmental toxins, offering a safer alternative to synthetic treatments. To enhance the translational impact of these results, future research should explore the efficacy and safety of these extracts in human cell lines and clinical trials. Additionally, mechanistic studies focusing on their gene-regulatory effects could provide deeper insights into their therapeutic potential, ultimately paving the way for developing novel, plant-based fertility treatments and protective agents in occupational toxicology.
Supplementary Material
Contributor Information
Amina Zedan, Department of Department of Agricultural Botany, Faculty of Agriculture (Girls Branch), Al-Azhar University, Nasr City, Cairo 11884, Egypt.
Mohamed H Abdelfattah, Genetic Department, Faculty of Agricultural, University of Tanta, Tanta 31732, Egypt.
Eman S EL-Gezawy, Nutrition and Food Science Department, Faculty of Home Economic, Al-Azhar University, Tanta 31732, Egypt.
Asmaa M EL-Gawish, Nutrition and Food Science Department, Faculty of Home Economic, Al-Azhar University, Tanta 31732, Egypt.
Amira M El-Moslemany, Nutrition and Food Science Department, Faculty of Home Economic, Al-Azhar University, Tanta 31732, Egypt.
Neveen M Zeima, Nutrition and Food Science Department, Faculty of Home Economic, Al-Azhar University, Tanta 31732, Egypt.
Ibrahim Albokhadaim, Department of Biomedical Sciences, College of Veterinary Medicine, King Faisal University, Saudi Arabia, P.O. Box 400 Al-Ahsa 31982, Saudi Arabia.
Sameer Alhojaily, Department of Biomedical Sciences, College of Veterinary Medicine, King Faisal University, Saudi Arabia, P.O. Box 400 Al-Ahsa 31982, Saudi Arabia.
Heba I Ghamry, Nutrition and Food Science, Department of Biology, College of Science, King Khalid University, P.O. Box 960, Abha,61421, Saudi Arabia.
Badriyah S Alotaibi, Department of Pharmaceutical Sciences, College of Pharmacy, Princess Nourah bint Abdulrahman University, P.O. Box 84428, Riyadh 11671, Saudi Arabia.
Mohamed Marzok, Department of Clinical Sciences, College of Veterinary Medicine, King Faisal University, Al-Ahsa, Saudi Arabia.
Mustafa Shukry, Physiology Department, Faculty of Veterinary Medicine, kafrelsheikh University, kafrelsheikh 33516, Egypt.
Author contributions
Conceptualization: Amina Zedan, Mohamed H. Abdelfattah, and Amira M. El-Moslemany. Investigation: Ibrahim Albokhadaim, Eman S. EL-Gezawy, Asmaa M. EL-Gawish Sameer Alhojaily, and Heba I. Ghamry, Methodology: Amina Zedan, Mohamed H. Abdelfattah, Mustafa Shukry, Mohamed Marzok and Amira M. El-Moslemany. Visualization: Ibrahim Albokhadaim, Neveen M. Zeima, Sameer Alhojaily, Badriyah S Alotaibi and Heba I. Ghamry Writing—Original Draft: Amina Zedan, Mohamed H. Abdelfattah, Eman S. EL-Gezawy, Asmaa M. EL-Gawish and Amira M. El-Moslem. Writing—Review, Editing & Final Approval: Mohamed H. Abdelfattah, Mustafa Shukry, Mohamed Marzok.
Funding
We appreciate the resources provided by Princess Nourah bint Abdulrahman University Researchers Supporting Project number (PNURSP2025R73), Princess Nourah bint Abdulrahman University, Riyadh, Saudi Arabia. The authors extend their appreciation to the Deanship of Research and Graduate Studies at King Khalid University for funding this work through a Large Research Project under grant number RGP2/383/45.
Ethics approval
All animals involved in the experiments were provided with appropriate care, and the study protocol adhered to the guidelines set forth by the National Institutes of Health and the Ethical Conduct for Use and Care of Animals in Research. Approval for the study was granted by the Faculty of Veterinary Medicine Ethics Committee at Kafr El-Sheikh University, Egypt (approval number: KFS-IACUC/122/2022). All procedures were carried out in compliance with the relevant guidelines (https://arriveguidelines.org).
Competing interests
The authors have no relevant financial or non-financial interests to disclose.
Availability of data and materials
Upon request from the corresponding authors
Consent to participate
Not applicable
Consent to publish
Not applicable.
References
- 1. Moline JM et al. Exposure to hazardous substances and male reproductive health: a research framework. Environ Health Perspect. 2000:108:803–813. 10.1289/ehp.00108803 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2. Rosenstock L. Work organization research at the National Institute for Occupational Safety and Health. J Occup Health Psychol. 1997:2:7–10. 10.1037/1076-8998.2.1.7 [DOI] [PubMed] [Google Scholar]
- 3. Organization, W.H . Air quality guidelines: global update 2005: particulate matter, ozone, nitrogen dioxide, and sulfur dioxide. Copenhagen, Denmark: World Health Organization; 2006 [PubMed] [Google Scholar]
- 4. Sarsilmaz M et al. Effects of postnatal formaldehyde exposure on pyramidal cell number, volume of cell layer in hippocampus and hemisphere in the rat: a stereological study. Brain Res. 2007:1145:157–167. 10.1016/j.brainres.2007.01.139 [DOI] [PubMed] [Google Scholar]
- 5. Xing S, YE L, Wang N. Toxic effect of formaldehyde on reproduction and heredity in male mice. Journal of Jilin University (Medicine Edition) Jilin University Press, Changchun, China; 2006 [Google Scholar]
- 6. Askaripour M et al. The effect of aqueous extract of Rosa damascena on formaldehyde-induced toxicity in mice testes. Pharm Biol. 2018:56:12–17. 10.1080/13880209.2017.1413663 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7. Köse E et al. Rose oil inhalation protects against formaldehyde-induced testicular damage in rats. Andrologia. 2012:44:342–348. 10.1111/j.1439-0272.2011.01187.x [DOI] [PubMed] [Google Scholar]
- 8. Ismail TF, Othman GO, Othman NH, Hassan BA. Study the effects of formaldehyde and xylene vapor on lung and testicular tissue with sperm morphology of adult albino rats. Polytech J. 2021:11:46–51. 10.25156/ptj.v11n1y2021.pp46-51 [DOI] [Google Scholar]
- 9. Parvez KF, Hussain SS. The role of industrial chemicals and occupational hazards in male infertility: a comprehensive review. Metall Mater Eng. 2025:31:52–65 [Google Scholar]
- 10. Ungureanu LB et al. Antioxidants as protection against reactive oxygen stress induced by formaldehyde (FA) exposure: a systematic review. Biomedicines. 2024:12:1820. 10.3390/biomedicines12081820 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11. Rivera J, Loya A, Ceballos R. Use of herbal medicines and implications for conventional drug therapy medical sciences. Altern Integ Med. 2013:2:1–6 [Google Scholar]
- 12. Azevedo ASD et al. Chemical constituents, antioxidant potential, antibacterial study and photoprotective activity of Brazilian corn silk extract. Food Sci Technol. 2022:42:e98421. 10.1590/fst.98421 [DOI] [Google Scholar]
- 13. Hasanudin K, Hashim P, Mustafa S. Corn silk (stigma maydis) in healthcare: a phytochemical and pharmacological review. Molecules. 2012:17:9697–9715. 10.3390/molecules17089697 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14. Limmatvapirat C et al. Phytochemical analysis of baby corn silk extracts. J Ayurveda Integr Med. 2020:11:344–351. 10.1016/j.jaim.2019.10.005 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 15. Liu J et al. The antioxidant and free-radical scavenging activities of extract and fractions from corn silk (Zea mays L.) and related flavone glycosides. Food Chem. 2011:126:261–269. 10.1016/j.foodchem.2010.11.014 [DOI] [Google Scholar]
- 16. Huang YC, Sridhar K, Tsai PJ. Enzymatically hydrolysed asparagus (Asparagus officinalis L.) hard-stem exhibits the ability to inhibit angiotensin-converting enzyme (ACE). Int J Food Sci Technol. 2022:57:3196–3203. 10.1111/ijfs.15653 [DOI] [Google Scholar]
- 17. Sarabi B et al. Evaluation of morphological characteristics of Iranian edible wild asparagus (Asparagus officinalis L.). Iran J Horticultural Sci. 2010;41:197–207. [Google Scholar]
- 18. Lee EJ, Yoo KS, Patil BS. Development of a rapid HPLC-UV method for simultaneous quantification of protodioscin and rutin in white and green asparagus spears. J Food Sci. 2010:75:C703–C709. 10.1111/j.1750-3841.2010.01824.x [DOI] [PubMed] [Google Scholar]
- 19. Jashni HK et al. Effects of aqueous extract from Asparagus officinalis L. roots on hypothalamic-pituitary-gonadal axis hormone levels and the number of ovarian follicles in adult rats. Int J Reprod BioMed. 2016:14:75–80. 10.29252/ijrm.14.2.75 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20. Negi J et al. Chemical constituents of asparagus. Pharmacogn Rev. 2010:4:215–220. 10.4103/0973-7847.70921 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21. Chotiner JY, Wolgemuth DJ, Wang PJ. Functions of cyclins and CDKs in mammalian gametogenesis. Biol Reprod. 2019:101:591–601. 10.1093/biolre/ioz070 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22. Li C et al. Spem2, a novel testis-enriched gene, is required for spermiogenesis and fertilization in mice. Cell Mol Life Sci. 2024:81:108. 10.1007/s00018-024-05147-w [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23. Zhuang X, Ruan J, Zhou C, Li Z. The emerging and diverse roles of F-box proteins in spermatogenesis and male infertility. Cell Regener. 2024:13:13. 10.1186/s13619-024-00196-9 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24. Adamczyk M et al. Assessment of TET1 gene expression, DNA methylation and H3K27me3 level of its promoter region in eutopic endometrium of women with endometriosis and infertility. Biomed Pharmacother. 2022:150:112989. 10.1016/j.biopha.2022.112989 [DOI] [PubMed] [Google Scholar]
- 25. Saheed S et al. Toxicological evaluations of stigma maydis (corn silk) aqueous extract on hematological and lipid parameters in Wistar rats. Toxicol Rep. 2015:2:638–644. 10.1016/j.toxrep.2015.04.001 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26. Pal S et al. Bisphenol S impairs blood functions and induces cardiovascular risks in rats. Toxicol Rep. 2017:4:560–565. 10.1016/j.toxrep.2017.10.006 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27. Kim K-H et al. Phenolic acid profiles and antioxidant activities of wheat bran extracts and the effect of hydrolysis conditions. Food Chem. 2006:95:466–473. 10.1016/j.foodchem.2005.01.032 [DOI] [Google Scholar]
- 28. Reeves PG, Nielsen FH, Fahey GC Jr. AIN-93 purified diets for laboratory rodents: final report of the American Institute of Nutrition ad hoc writing committee on the reformulation of the AIN-76A rodent diet. J Nutr. 1993:123:1939–1951. 10.1093/jn/123.11.1939 [DOI] [PubMed] [Google Scholar]
- 29. Zararsiz I et al. Effects of v-3 essential fatty acids against formaldehyde-induced nephropathy in rats. Toxicol Ind Health. 2006:22:223–229. 10.1191/0748233706th260oa [DOI] [PubMed] [Google Scholar]
- 30. Ozen OA, Kus MA, Kus I, Alkoc OA, Songur A. Protective effects of melatonin against formaldehyde-induced oxidative damage and apoptosis in rat testes: an immunohistochemical and biochemical study. Syst Biol Reprod Med. 2008:54:169–176. 10.1080/19396360802422402 [DOI] [PubMed] [Google Scholar]
- 31. Zararsiz I et al. Melatonin prevents formaldehyde-induced neurotoxicity in prefrontal cortex of rats: an immunohistochemical and biochemical study. Cell Biochem Funct. 2007:25:413–418. 10.1002/cbf.1315 [DOI] [PubMed] [Google Scholar]
- 32. Hegazy AA, Elsayed NEA, Ahmad MM, Omar NM. Effect of formaldehyde on rat testis structure. Acad Anat Int. 2017:3:15–23. 10.21276/aanat.2017.3.2.4 [DOI] [Google Scholar]
- 33. Chowdhury AR, Gautam AK, Patel KG, Trivedi HS. Steroidogenic inhibition in testicular tissue of formaldehyde exposed rats. Indian J Physiol Pharmacol. 1992:36:162–162, 168 [PubMed] [Google Scholar]
- 34. Golalipour M et al. Formaldehyde exposure induces histopathological and morphometric changes in the rat testis. Folia Morphol (Warsz). 2007:66:167–171 [PubMed] [Google Scholar]
- 35. Sepehri G, Derakhshanfar A, Yazdi Zadeh F. Protective effects of corn silk extract administration on gentamicin-induced nephrotoxicity in rat. Comp Clin Pathol. 2011:20:89–94. 10.1007/s00580-009-0943-3 [DOI] [Google Scholar]
- 36. El-Aarag B et al. Thymoquinone improves anti-diabetic activity of metformin in streptozotocin-induced diabetic male rats. J Diabetes Metab. 2017:8:2–8 [Google Scholar]
- 37. Ulfanov O, Cil N, Adiguzel E. Protective effects of vitamin E on aluminium sulphate-induced testicular damage. Toxicol Ind Health. 2020:36:215–227. 10.1177/0748233720919663 [DOI] [PubMed] [Google Scholar]
- 38. Aebi H. [13] catalase in vitro, in Methods in enzymology. New York, NY: Academic Press. Elsevier; 1984. pp. 121–126 10.1016/S0076-6879(84)05016-3 [DOI] [PubMed] [Google Scholar]
- 39. Aboul-Soud MAM et al. Hepatoprotective effects of vitamin E/selenium against malathion-induced injuries on the antioxidant status and apoptosis-related gene expression in rats. J Toxicol Sci. 2011:36:285–296. 10.2131/jts.36.285 [DOI] [PubMed] [Google Scholar]
- 40. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2− ΔΔCT method. Methods. 2001:25:402–408. 10.1006/meth.2001.1262 [DOI] [PubMed] [Google Scholar]
- 41. Rasekh A, Karimi Jas H, Rahmanian K, Sotoodeh J A. Effect of palm pollen on sperm parameters of infertile man. Pak J Biol Sci. 2015:18:196–199. 10.3923/pjbs.2015.196.199 [DOI] [PubMed] [Google Scholar]
- 42. Vosoughi S, Khavanin A, Salehnia M, Mahabadi HA, Soleimanian A. Effects of simultaneous exposure to formaldehyde vapor and noise on mouse testicular tissue and sperm parameters. Health Scope. 2012:1:110–117. 10.17795/jhealthscope-7973 [DOI] [Google Scholar]
- 43. Afrigan L et al. The effect of hydroethanolic extract of Matricaria chamomilla on the reproductive system of male rats exposed to formaldehyde. Andrologia. 2019:51:e13362. 10.1111/and.13362 [DOI] [PubMed] [Google Scholar]
- 44. Abarikwu SO, Onuah CL, Singh SK. Plants in the management of male infertility. Andrologia. 2020:52:e13509. 10.1111/and.13509 [DOI] [PubMed] [Google Scholar]
- 45. Aires A, Carvalho R. Compositional study and antioxidant potential of polyphenols extracted from corn by-products, using ultrasound extraction method. Austin Chromatog. 2016:3:1–5 [Google Scholar]
- 46. Fahmy TS. Potential ameliorative effects of corn silk on hepatic damage induced by carbon tetrachloride in experimental rats The Scientific Journal of Specific Education and Applied Sciences, 2021:4:200–223. [Google Scholar]
- 47. Chen X et al. Evaluation of the differences in phenolic compounds and antioxidant activities of five green asparagus (Asparagus officinalis L.) cultivars. Quality Assurance and Safety of Crops & Foods. 2017:9:479–487. 10.3920/QAS2017.1082 [DOI] [Google Scholar]
- 48. Solana M, Boschiero I, Dall’Acqua S, Bertucco A. A comparison between supercritical fluid and pressurized liquid extraction methods for obtaining phenolic compounds from Asparagus officinalis L. J Supercrit Fluids. 2015:100:201–208. 10.1016/j.supflu.2015.02.014 [DOI] [Google Scholar]
- 49. Razi M et al. Adverse effects of long-time exposure to formaldehyde vapour on testicular tissue and sperm parameters in rats. in veterinary research forum: an international quarterly journal Faculty of Veterinary Medicine. Urmia, Iran: Urmia University; 2013 [PMC free article] [PubMed] [Google Scholar]
- 50. Kim SR et al. Corn silk extract improves benign prostatic hyperplasia in experimental rat model. Nutr Res Pract. 2017:11:373–380. 10.4162/nrp.2017.11.5.373 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 51. Ikpeazu VO et al. Evaluation of the safety of oral intake of aqueous extract of stigma maydis (corn silk) in rats. Acta Sci Pol Technol Aliment. 2018:17:387–397 [DOI] [PubMed] [Google Scholar]
- 52. Sabiu S, O’Neill F, Ashafa A. Membrane stabilization and detoxification of acetaminophen-mediated oxidative onslaughts in the kidneys of Wistar rats by standardized fraction of Zea mays L.(Poaceae), stigma maydis. Evid Based Complement Alternat Med. 2016:2016:1–14. 10.1155/2016/2046298 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 53. Zahra T, Parviz T, Simin F, Mehdi T. Effect of formaldehyde injection in mice on testis function. Int J Pharmacol. 2007:3:421–424. 10.3923/ijp.2007.421.424 [DOI] [Google Scholar]
- 54. Tang M, Xie Y, Yi Y, Wang W. Effects of formaldehyde on germ cells of male mice. Wei Sheng yan jiu. 2003:32:544–548 [PubMed] [Google Scholar]
- 55. Gules O, Eren U. The effect of xylene and formaldehyde inhalation on testicular tissue in rats. Asian Australas J Anim Sci. 2010:23:1412–1420. 10.5713/ajas.2010.90519 [DOI] [Google Scholar]
- 56. Özen OA et al. Effect of formaldehyde inhalation on Hsp70 in seminiferous tubules of rat testes: an immunohistochemical study. Toxicol Ind Health. 2005:21:249–254. 10.1191/0748233705th235oa [DOI] [PubMed] [Google Scholar]
- 57. Bilaspuri GS, Bansal AK. Mn2+: a potent antioxidant and stimulator of sperm capacitation and acrosome reaction in crossbred cattle bulls. Archives Animal Breeding. 2008:51:149–158. 10.5194/aab-51-149-2008 [DOI] [Google Scholar]
- 58. Wans EM, Ahmed MM, Mousa AA, Tahoun EA, Orabi SH. Ameliorative effects of corn silk extract on acetaminophen-induced renal toxicity in rats. Environ Sci Pollut Res. 2021:28:1762–1774. 10.1007/s11356-020-10588-4 [DOI] [PubMed] [Google Scholar]
- 59. Poormoosavi SM, Najafzadehvarzi H, Behmanesh MA, Amirgholami R. Protective effects of Asparagus officinalis extract against bisphenol A- induced toxicity in Wistar rats. Toxicol Rep. 2018:5:427–433. 10.1016/j.toxrep.2018.02.010 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 60. Owumi SE, Danso OF, Nwozo SO. Gallic acid and omega-3 fatty acids mitigate epididymal and testicular toxicity in manganese-treated rats. Andrologia. 2020:52:e13630. 10.1111/and.13630 [DOI] [PubMed] [Google Scholar]
- 61. Owumi SE, Adedara IA, Akomolafe AP, Farombi EO, Oyelere AK. Gallic acid enhances reproductive function by modulating oxido-inflammatory and apoptosis mediators in rats exposed to aflatoxin-B1. Exp Biol Med. 2020:245:1016–1028. 10.1177/1535370220936206 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 62. Zare M et al. The prophylactic effect of date palm (Phoenix dactylifera L.) fruit extract on testicular toxicity induced by formaldehyde: an experimental study. Int J Reprod Biomed. 2020:18:275–286. 10.18502/ijrm.v13i4.6890 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 63. Rasyidah T, Suhana S, Nur-Hidayah H, Kaswandi MA, Noah RM. Evaluation of antioxidant activity of Zingiber officinale (ginger) on formalin-induced testicular toxicity in rats. J Med Bioeng. 2014:3:149–153. 10.12720/jomb.3.3.149-153 [DOI] [Google Scholar]
- 64. Nna VU, Abu Bakar AB, Ahmad A, Eleazu CO, Mohamed M. Oxidative stress, NF-κb-mediated inflammation and apoptosis in the testes of streptozotocin–induced diabetic rats: combined protective effects of malaysian propolis and metformin. Antioxidants. 2019:8:465. 10.3390/antiox8100465 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 65. Thoudam B et al. Phytochemical constituents and antioxidant activity of various extracts of corn silk (Zea mays L). Res J Pharm, Biol Chem Sci. 2011:2:986–993 [Google Scholar]
- 66. Han SP et al. Formaldehyde exposure induces autophagy in testicular tissues of adult male rats. Environ Toxicol. 2015:30:323–331. 10.1002/tox.21910 [DOI] [PubMed] [Google Scholar]
- 67. Sa'adatzadeh M et al. Protective effect of aqueous and methanolic extracts of corn silk on nicotine-induced reproductive system disorders in male mice. JBRA Assisted Reprod. 2023:27:644–650. 10.5935/1518-0557.20230034 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 68. Ebrahimzadeh MA, Pourmorad F, Hafezi S. Antioxidant activities of Iranian corn silk. Turk J Biol. 2008:32:43–49 [Google Scholar]
- 69. Almeer R, Alyami NM. Renal-protective effect of Asparagus officinalis aqueous extract against lead-induced nephrotoxicity mouse model. Environ Sci Pollut Res. 2023:30:112745–112757. 10.1007/s11356-023-30280-7 [DOI] [PubMed] [Google Scholar]
- 70. Zhou DX, Qiu SD, Zhang J, Tian H, Wang HX. The protective effect of vitamin E against oxidative damage caused by formaldehyde in the testes of adult rats. Asian J Androl. 2006:8:584–588. 10.1111/j.1745-7262.2006.00198.x [DOI] [PubMed] [Google Scholar]
- 71. Lü JM, Lin PH, Yao Q, Chen C. Chemical and molecular mechanisms of antioxidants: experimental approaches and model systems. J Cell Mol Med. 2010:14:840–860. 10.1111/j.1582-4934.2009.00897.x [DOI] [PMC free article] [PubMed] [Google Scholar]
- 72. Aly HA, Domènech Ò, Abdel-Naim AB. Aroclor 1254 impairs spermatogenesis and induces oxidative stress in rat testicular mitochondria. Food Chem Toxicol. 2009:47:1733–1738. 10.1016/j.fct.2009.03.019 [DOI] [PubMed] [Google Scholar]
- 73. Doreswamy K, Shrilatha B, Rajeshkumar T, Muralidhara. Nickel-induced oxidative stress in testis of mice: evidence of DNA damage and genotoxic effects. J Androl. 2004:25:996–1003. 10.1002/j.1939-4640.2004.tb03173.x [DOI] [PubMed] [Google Scholar]
- 74. Akkoc R, Ogeturk M, Aydin S, Kuloglu T, Aydin S. Effects of carnosine on apoptosis, transient receptor potential melastatin 2, and betatrophin in rats exposed to formaldehyde. Biotech Histochem. 2021:96:223–229. 10.1080/10520295.2020.1783571 [DOI] [PubMed] [Google Scholar]
- 75. Ahmed HH, Morsy FA, el-Nabarawy SK, Ahmed MA, Ali NA. Lycopene: an effective neuroprotective option against neurodeterioration induced by formaldehyde inhalation. Comp Clin Pathol. 2016:25:1171–1184. 10.1007/s00580-016-2323-0 [DOI] [Google Scholar]
- 76. Sayyar Z, Yazdinezhad A, Hassan M, Jafari Anarkooli I. Protective effect of Matricaria chamomilla ethanolic extract on hippocampal neuron damage in rats exposed to formaldehyde. Oxidative Med Cell Longev. 2018:2018:6414317. 10.1155/2018/6414317 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 77. Ulucam E, Bakar E. The effect of proanthocyanidin on formaldehyde-induced toxicity in rat testes. Turk J Med Sci. 2016:46:185–193. 10.3906/sag-1411-13 [DOI] [PubMed] [Google Scholar]
- 78. Huang J et al. Antagonistic effect of epigallocatechin-3-gallate on neurotoxicity induced by formaldehyde. Toxicology. 2019:412:29–36. 10.1016/j.tox.2018.10.022 [DOI] [PubMed] [Google Scholar]
- 79. Paul M et al. Pumpkin (Cucurbita maxima) seeds protect against formaldehyde-induced major organ damages. Heliyon. 2020:6:e04587. 10.1016/j.heliyon.2020.e04587 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 80. Salem N, Mahmoud OM, al Badawi MH, Gab-Alla AA. Role of Nigella sativa seed oil on corneal injury induced by formaldehyde in adult male albino rats. Folia Morphol (Warsz). 2016:75:518–526. 10.5603/FM.a2016.0010 [DOI] [PubMed] [Google Scholar]
- 81. Przybylska S, Tokarczyk G. Lycopene in the prevention of cardiovascular diseases. Int J Mol Sci. 2022:23:1957. 10.3390/ijms23041957 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 82. Bonnefont-Rousselot D, Collin F. Melatonin: action as antioxidant and potential applications in human disease and aging. Toxicology. 2010:278:55–67. 10.1016/j.tox.2010.04.008 [DOI] [PubMed] [Google Scholar]
- 83. Li Z, Zhao J, Liu H, Wang J, Lu W. Melatonin inhibits apoptosis in mouse Leydig cells via the retinoic acid-related orphan nuclear receptor α/p53 pathway. Life Sci. 2020:246:117431. 10.1016/j.lfs.2020.117431 [DOI] [PubMed] [Google Scholar]
- 84. Betancourt-Martínez ND et al. Protective effect of Hedeoma drummondii against formaldehyde-induced testicular toxicity and genotoxicity in Wistar rats. Andrologia. 2023:2023:1–10. 10.1155/2023/6631345 [DOI] [Google Scholar]
- 85. Ge P, Zhang X, Yang YQ, Lv MQ, Zhou DX. Long-term exposure to formaldehyde induced down-regulation of SPO11 in rats. Inhal Toxicol. 2021:33:8–17. 10.1080/08958378.2020.1859652 [DOI] [PubMed] [Google Scholar]
- 86. Su TT, Stumpff J. Promiscuity rules? The dispensability of cyclin E and Cdk2. Sci STKE. 2004:2004:pe11-pe11. 10.1126/stke.2242004pe11 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 87. Singh J, Rasane P, Nanda V, Kaur S. Bioactive compounds of corn silk and their role in management of glycaemic response. J Food Sci Technol. 2023:60:1695–1710. 10.1007/s13197-022-05442-z [DOI] [PMC free article] [PubMed] [Google Scholar]
- 88. Alyami NM, Almeer R, Alyami HM. Protective effects of Asparagus officinalis (asparagus) against lead toxicity in mice. Environ Sci Pollut Res. 2023:30:18718–18730. 10.1007/s11356-022-23540-5 [DOI] [PubMed] [Google Scholar]
- 89. Mitra S et al. Polyphenols: a first evidence in the synergism and bioactivities. Food Rev Int. 2023:39:4419–4441. 10.1080/87559129.2022.2026376 [DOI] [Google Scholar]
- 90. Fujii J, Iuchi Y, Matsuki S, Ishii T. Cooperative function of antioxidant and redox systems against oxidative stress in male reproductive tissues. Asian J Andrology. 2003:5:231–242 [PubMed] [Google Scholar]
- 91. Doreswamy K, Muralidhara. Genotoxic consequences associated with oxidative damage in testis of mice subjected to iron intoxication. Toxicology. 2005:206:169–178 [DOI] [PubMed] [Google Scholar]
- 92. Singh A, Rappolee DA, Ruden DM. Epigenetic reprogramming in mice and humans: from fertilization to primordial germ cell development. Cells. 2023:12:1874. 10.3390/cells12141874 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 93. Kumar S et al. Pharmacological evaluation of different extracts of Asparagus officinalis (Asparagaceae) as an analgesic, anti-inflammatory and anti-arthritic agent in rats. Pharm Res. 2023:15:184–205. 10.5530/097484900333 [DOI] [Google Scholar]
- 94. Gagliardi M, Strazzullo M, Matarazzo MR. DNMT3B functions: novel insights from human disease. Front cell Dev Biol. 2018:6:140. 10.3389/fcell.2018.00140 [DOI] [PMC free article] [PubMed] [Google Scholar]
- 95. Liu Q et al. Effects of long-term low-dose formaldehyde exposure on global genomic hypomethylation in 16HBE cells. Toxicol Lett. 2011:205:235–240. 10.1016/j.toxlet.2011.05.1039 [DOI] [PubMed] [Google Scholar]
- 96. Kirrella AA et al. Use of corn silk meal in broiler diet: effect on growth performance, blood biochemistry, immunological responses, and growth-related gene expression. Animals. 2021:11:1170. 10.3390/ani11041170 [DOI] [PMC free article] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Data Availability Statement
Upon request from the corresponding authors













