Abstract
Background
Adipocyte enhancer-binding protein 1 (AEBP1) regulates collagen fibrosis, extracellular matrix, and important oncogene pathways, but its regulation on hepatocellular carcinoma (HCC) is not known. This study aimed to investigate the effect of AEBP1 knockdown on HCC cell proliferation, apoptosis, migration, invasion and PI3K/AKT pathway.
Methods
MHCC-97 H and Huh7 cell lines were applied. Negative control or AEBP1 siRNA (siAEBP1) were transfected into cells, and cells without transfection were set as blank control. Quantitative polymerase chain reaction (qPCR), western blot, Cell Counting Kit-8 (CCK-8), 5-Ethynyl-2’-deoxyuridine (EdU) staining, Terminal-deoxynucleotidyl Transferase Mediated Nick End Labeling (TUNEL) staining, Transwell invasion, and cell scratch assays were performed.
Results
AEBP1 mRNA and protein expressions were lower after siAEBP1 transfection in MHCC-97 H and Huh7 cells. OD value of CCK-8 and EdU positive cell percentage were decreased, while TUNEL reflected cell apoptosis rate was increased, after siAEBP1 transfection in MHCC-97 H and Huh7 cells. However, invasive cell number and cell migration rate were only reduced after siAEBP1 transfection in Huh7 cells but not in MHCC-97 H cells. Expressions of p-PI3K/PI3K and p-AKT/AKT were downregulated after siAEBP1 transfection in MHCC-97 H and Huh7 cells. Subsequent rescue experiment revealed that th activation of PI3K/AKT pathway by 740Y-P attenuated the effect of siAEBP1 transfection in MHCC-97 H and Huh7 cells.
Conclusion
AEBP1 exhibits the potency to be a target for HCC treatment, reflected by its regulation on HCC proliferation, apoptosis and PI3K/AKT pathway, but its effect on HCC invasion and migration seems limited.
Supplementary Information
The online version contains supplementary material available at 10.1186/s12957-025-03750-0.
Keywords: AEBP1, Hepatocellular carcinoma, Proliferation and apoptosis, Invasion and migration, PI3K/AKT pathway
Introduction
Liver cancer ranks as one of the most common and fatal cancers, presenting with 865,269 new cases and 757,948 new deaths annually over the world, and predominantly 367,700 new cases and 316,500 new deaths annually in China [1–3]. As the majority type of liver cancer, hepatocellular carcinoma (HCC) is usually diagnosed at a late stage that losing the chance for radical treatment [4, 5]. Besides, systemic chemotherapy lacks enough efficiency therefore not commonly applied in the late-stage HCC patients, highlight the role of target agents such as sorafenib, lenvatinib, and apatinib [6–9]. Consequently, seeking for novel targets to improve the treatment of HCC is essential.
Adipocyte enhancer-binding protein 1 (AEBP1), as a controller of collagen fibrosis process, is implicated in the production of the extracellular matrix, and modifies MAP-kinase activity, phosphorylation of I-kappa-B-alpha, and PI3K/AKT pathway to participate in a vary of disease pathogenesis [10–13]. Apart from that, AEBP1 is found to promote cancer progression: it promotes breast cancer proliferation, migration, invasion, and activates ERK, Smad2/3, and AKT signaling [14], its knockdown represses papillary thyroid cancer growth, invasiveness and epithelial-mesenchymal transition (EMT) [15]; besides, its inhibition by a parthenolide-derived ACT001 restrains glioblastoma stem cell proliferation and sphere-formation ability via inactivating PI3K/AKT pathway [16]. Recently, a systemic review collected the published evidences and reported AEBP1 serving as a novel oncogene [17]. Regarding HCC, only a clinical study revealed that AEBP1 was upregulated in HCC tissues compared to normal liver tissues [18]. However, the regulation of AEBP1 on HCC cellular functions is not discovered.
This study investigated the effect of AEBP1 knockdown on HCC cell proliferation, apoptosis, migration, invasion and PI3K/AKT pathway, aiming to provide some evidence for the potency of AEBP1 as a target for HCC.
Methods
Cell culture
The HCC cells, including MHCC-97 H (iCell-h143) and Huh7 (iCell-h080), were bought from iCell (Shanghai, China). Dulbecco’s Modified Eagle Medium (G4511, Servicebio, China) comprising 10% fetal bovine serum (G8802, Servicebio, China) was adopted for culture. Cells were cultivated at 37 °C under 5% CO2 and appropriate humidity.
SiRNA transfection
The siRNA (GenePharma, China) was used to inhibit the expression of AEBP1 in the MHCC-97 H and Huh7 cells. The sequence of negative control siRNA (siNC) and AEBP1 siRNA (siAEBP1) was listed (5’-3’): siNC (sense, UUCUCCGAACGUGUCACGUTT; antisense, ACGUGACACGUUCGGAGAATT) and siAEBP1 (sense, CCACACUGGACUACAAUGATT; antisense, UCAUUGUAGUCCAGUGUGGTT). The cells were seeded into 6-well plates and cultivated to 50% confluence. Then, the transfection working solution containing siRNA (75 pmol), transfection buffer (42.5 µL), siRNA-mate plus (7.5 µL) (G04026, GenePharma, China), and medium (2 mL) was added to cells. The cells were divided into three groups: Control, siNC, and siAEBP1 groups. Briefly, the siNC group and siAEBP1 group were transfected with negative control or AEBP1 siRNA. The cells without transfection were set as the Control group. After 48 h of culture, the cells were used for quantitative polymerase chain reaction (qPCR), western blot, Cell Counting Kit-8 (CCK-8), 5-Ethynyl-2’-deoxyuridine (EdU) staining, Terminal-deoxynucleotidyl Transferase Mediated Nick End Labeling (TUNEL) staining, Transwell invasion, and cell scratch assays.
qPCR
RNA extraction solution (G3013, Servicebio, China) was added to lyze cells. Total RNA was isolated according to the kit’s protocol. For the qPCR assay, reverse transcription and qPCR program was accomplished via RT-qPCR kit (G3352, Servicebio, China). The following primers were used (5’-3’): AEBP1 (forward: GAGGAGTTGGAGGAGGAGTGGAC, reverse: AGGAGGCTCGGATCTGGTTGTC) and GAPDH (forward: GAAAGCCTGCCGGTGACTAA, reverse: GCCCAATACGACCAAATCAGAGA).
Western blot
MHCC-97 H and Huh7 cells were harvested and lysed in the protein isolation solution (G2002, Servicebio, China) for 30 min. The protein quantitative kit (G2026, Servicebio, China) was adopted to assess the concentration of protein. Following that, electrophoresis and membrane transfer experiments were performed. Membranes were blocked with non-fat milk (GC310001, Servicebio, China), and incubated with antibodies against AEBP1 (DF2427), p-PI3K (AF3242), PI3K (AF6241), p-AKT (AF0016), AKT (AF6261), or GAPDH (AF7021) (Affinity, China) for 1.5 h and secondary antibody (GB23303, Servicebio, China) for 0.5 h at room temperature (RT). Signals were visualized via a Super ECL Kit (G2020, Servicebio, China).
CCK-8
MHCC-97 H and Huh7 cells were replated into 96-well plates. After being cultivated for 0 h, 24 h, 48 h, and 72 h, cells were added with 10 µL of CCK-8 reagent (G4103, Seivicebio, China) and incubated for 2 h. Then, the microplate reader (DG5035A, Huadong Electronics, China) was adopted to assess optical density value at 450 nm (OD450).
EdU staining
MHCC-97 H and Huh7 cells were treated with 10 µM of EdU staining buffer (G1601, Servicebio, China) for 2 h at RT. Next, cells were washed and blocked with 4% paraformaldehyde (P0099, Beyotime, China). The Click additive solution (G1601, Servicebio, China) was added for 15 min at RT. The 4’6-diamidino-2-phenylindole (DAPI) (HY-D0814, MCE, China) was applied for nuclei staining. The rate of EdU positive cells was evaluated under a fluorescence microscope (PX43 FS6, Motic, China).
TUNEL staining
MHCC-97 H and Huh7 cells were incubated with Triton X-100 (G1204, Servicebio, China) and fixed with 4% paraformaldehyde. The TUNEL working buffer (G1502, Servicebio, China) was prepared using the TdT enzyme, 5-dUTP labeling mix, and equilibration buffer. Subsequently, cells were treated with TUNEL working buffer for 1 h at RT. After staining with DAPI, the apoptosis rate was evaluated under the microscope.
Transwell
MHCC-97 H and Huh7 cells were cultivated in serum-free medium for 12 h, and replated to a Matrigel matrix-coated Transwell insert (No. 356234, Corning, USA) in 24-well plates. Next, 600 µL of complete medium was dispensed to the lower chamber. After incubating for 24 h, invasive cells were stained with crystal violet (G1014, Servicebio, China) and counted under the microscope.
Cell scratch
MHCC-97 H and Huh7 cells were cultivated until they reached 100% confluence. Pipette tips were applied to produce scratches. Then, cells were cultivated without serum for 24 h. Images of scratches were taken at 0 h and 24 h. The cell migration rate was determined as follows: (scratch area at 0 h - scratch area at 24 h) / scratch area at 0 h.
740Y-P treatment
MHCC-97 H and Huh7 cells were transfected for 48 h, then cells were replated into 96-well plates and divided into four groups: the siNC group and the siAEBP1 group were set as indicated above. The 740Y-P group was transfected with siNC and treated with 10 µM of 740Y-P (an activator of the PI3K/AKT pathway) (HY-P0175, MCE, China). The siAEBP1 + 740Y-P group was transfected with siAEBP1 and treated with 10 µM of 740Y-P. After 0 h, 24 h, 48 h, and 72 h of 740Y-P treatment, the CCK-8 assay was carried out, respectively.
Public database
Gene Expression Profiling Interactive Analysis (http://gepia.cancer-pku.cn/) was used to analyze the expression of AEBP1 in HCC tissues, its correlation with stages and prognosis in HCC patients. In addition, the Human Protein Atlas (www.proteinatlas.org) was used to show the expression location of AEBP1 in HCC tissue, and its expression level in HCC cell lines.
Statistical analysis
The experiments were performed in triplicates. To analyze differences across multiple groups, we employed one-way Analysis of Variance (ANOVA) and Tukey’s test via GraphPad 9.0 software (GraphPad, USA). Statistical significance was set at P value < 0.05.
Results
AEBP1 expression after transfection
The relative expressions of AEBP1 mRNA (P < 0.001) and protein (P < 0.01) were both lower in siAEBP1 group compared to siNC group in MHCC-97 H cells (Fig. 1A-B). Similarly, both AEBP1 mRNA (P < 0.01) and protein (P < 0.01) expression were reduced in siAEBP1 group compared to siNC group in Huh7 cells (Fig. 1C-D).
Fig. 1.
Transfection efficiency. The expression of AEBP1 mRNA expression (A), western blot images and AEBP1 protein expression (B) after transfection in MHCC-97 H cells. The expression of AEBP1 mRNA expression (C), western blot images and AEBP1 protein expression (D) after transfection in Huh7 cells
HCC cell proliferation and apoptosis after transfection
OD value of CCK-8 was decreased in siAEBP1 group compared to siNC group (P < 0.01), so did EdU positive cell percentage (P < 0.05) in MHCC-97 H cells (Fig. 2A-B). Regarding Huh7 cells, OD value of CCK-8 (P < 0.01) and EdU positive cell percentage (P < 0.05) were both lower in siAEBP1 group compared to siNC group (Fig. 2C-D). TUNEL assay revealed that cell apoptosis rate was higher in siAEBP1 group compared to siNC group in both MHCC-97 H cells and Huh7 cells (both P < 0.05, Fig. 3A-B).
Fig. 2.
Cell proliferative detection after transfection. OD value by CCK-8 at 0 h, 24 h, 48 h, and 72 h (A), EdU staining images and positive cell percentage (B) after transfection in MHCC-97 H cells. OD value by CCK-8 at 0 h, 24 h, 48 h, and 72 h (C), EdU staining images and positive cell percentage (D) after transfection in Huh7 cells
Fig. 3.
Cell apoptotic detection after transfection. TUNEL images and cell apoptosis rate by TUNEL after transfection in MHCC-97 H cells (A) and Huh7 cells (B)
HCC cell invasion and migration after transfection
Invasive cell number (P > 0.05) and cell migration rate (P > 0.05) were not statistically changed between siAEBP1 group and siNC group in MHCC-97 H cells (Fig. 4A-B). In the terms of Huh7 cells, invasive cell number (P < 0.01) and cell migration rate (P < 0.01) were both lower in siAEBP1 group compared to siNC group (Fig. 4C-D).
Fig. 4.
Cell mobility after transfection. Transwell staining images and invasive cell count (A), cell scratch images and cell migration rate (B) after transfection in MHCC-97 H cells. Transwell staining images and invasive cell count (C), cell scratch images and cell migration rate (D) after transfection in Huh7 cells
PI3K/AKT pathway after transfection
Expressions of p-PI3K/PI3K (P < 0.05) and p-AKT/AKT (P < 0.01) were both lower in siAEBP1 group compared to siNC group in MHCC-97 H cells (Fig. 5A). Similar trends of p-PI3K/PI3K (P < 0.05) and p-AKT/AKT (P < 0.05) were observed in Huh7 cells (Fig. 5B).
Fig. 5.
PI3K/AKT pathway after transfection. Expressions of p-PI3K, PI3K, p-AKT, AKT after transfection in MHCC-97 H cells (A) and Huh7 cells (B)
Rescue experiments
The rescue experiments were performed via using 740Y-P (an activator of the PI3K/AKT pathway) treatment along with siAEBP1, to detect whether siAEBP1 functions via inactivating PI3K/AKT. OD value of CCK-8 was increased in 740Y-P group compared with siNC group (P < 0.01), and elevated in siAEBP1 + 740Y-P group compared to siAEBP1 group (P < 0.001) in MHCC-97 H cells (Fig. 6A). In addition, OD value of CCK-8 was also raised in 740Y-P group compared with siNC group (P < 0.01), and enhanced in siAEBP1 + 740Y-P group compared to siAEBP1 group (P < 0.01) in Huh7 cells (Fig. 6B).
Fig. 6.
740Y-P treatment. OD value by CCK-8 at 0 h, 24 h, 48 h, and 72 h after 740Y-P treatment along with or without siAEBP1 transfection in MHCC-97 H cells (A) and Huh7 cells (B)
Analysis derived from public database
According to the Gene Expression Profiling Interactive Analysis, AEBP1 expression tended to be increased in HCC tumor tissues compared to non-tumor tissues (Supplementary Fig. 1A); however, AEBP1 was not correlated with tumor stages or overall survival in HCC patients (Supplementary Fig. 1B-C). In addition, according to the Human Protein Atlas, AEBP1 was mainly expressed in cytoplasm and membrane of HCC tissues (Supplementary Fig. 1D), and its expression was highest in Huh-7 cell line among all liver cancer cell lines (Supplementary Fig. 1E).
Discussion
AEBP1 has been reported to promote cancer progression via multiple ways. For instance, AEBP1 facilitates cell viability, mobility and EMT by NF-κB signaling, and its high expression is correlated with poor differentiation, larger tumor size and lymph node metastasis in colon cancer [19]. AEBP1 can also induce glioblastoma progression both in vitro and in vivo, and its high expression predicts poor outcomes in glioblastoma patients [20]. Furthermore, AEBP1 enhances cervical cancer proliferation, migration, and invasion, and it upregulated in human cervical cancer tissues [21]. Due to the above-mentioned pro-oncogene function of AEBP1, it’s recently considered to be a potential target for cancer treatment [17, 18]. Targeting AEBP1 by shRNA reduces gastric cancer growth, metastasis and EMT [22], and targeting AEBP1 by shRNA represses oral cancer growth in vitro and in vivo [23]. In addition, targeting AEBP1 by a parthenolide-derived ACT001 treatment decreases glioma stemness and viability [16]. But until the study completion, no study reports the function of targeting AEBP1 in HCC. Correspondingly, this study targeted AEBP1 by siRNA, and explored its effect on attenuating the malignant behaviors of two HCC cell lines (MHCC-97 H and Huh7). The rationale for selecting MHCC-97 H and Huh7 cells was as follows: (1) MHCC-97 H was a cell line derived from Chinese patients with HCC [24]; since the investigators of this study were in China, this cell line from Chinese patients was meaningful. (2) Via The Human Protein Atlas database (http://www.proteinatlas.org/), the expression of AEBP1 was highest in Huh7 cell line among liver cancer cell lines.
CCK-8 and EdU are commonly used to detect cell proliferation, but there are some differences in their principle of action. In detail, CCK-8 is a cell proliferation reagent based on WST-8. In the presence of electron-coupled reagents, WST-8 can be reduced by dehydrogenases within mitochondria to yield an orange-yellow formazan product. The number of viable cells can be indirectly reflected by the OD value measured at 450 nm using a microplate reader. EdU is a thymidine analogue that can be incorporated into replicating DNA molecules in place of thymidine during cellular proliferation. Proliferating cells are visually detected by click chemistry with fluorescently labeled azide. This study applied these two methods (CCK-8 AND EdU) to double check the effect of siAEBP1 on HCC cell proliferation, and found that siAEBP1 could reduce the HCC cell proliferation; besides, via TUNEL assay reflection, siAEBP1 was able to elevate the HCC cell apoptosis rate. The following aspects might explain this phenomenon: (1) AEBP1 was an important factor regulating collagen fibrosis process, the latter was closely engaged in HCC development and progression [25]. (2) AEBP1 modified DNA damage to participate the regulation of cell proliferation and apoptosis [26]. (3) AEBP1 was able to regulate several well-known oncogene-related pathways, such as PI3K/AKT, NF-κB, MAP-kinase [10–14, 16, 17].
However, via Transwell and cell scratch assays, this study found that siAEBP1 lacked an enough impact on repressing cell invasion and migration in MHCC-97 H cells, who only reduced cell invasion and migration statistically in Huh7 cells. This condition indicated the effect of siAEBP1 on HCC invasion and migration was restricted to the specific HCC cell heterogeneity, therefore a solid conclusion could not be made in this study. The possible explanation was that AEBP1 mainly modified cancer cell growth via its regulation on collage fibrosis process and DNA damage [25, 26], while cell mobility was less affected.
Since previous studies have revealed the implication of PI3K/AKT pathway in the regulatory function of AEBP1 on cancer progression [14, 16, 17], this study further detected the activation of PI3K/AKT pathway after siAEBP1 transfection in HCC, which observed that siAEBP1 inactivated PI3K/AKT pathway in HCC cells. PI3K/AKT pathway is a well-known oncogene signaling in various cancers including HCC [27, 28]. For instance, the activation of PI3K/AKT pathway by 740Y-P accelerates HCC growth and metastasis both in vitro and in vivo [29]. This finding provided further explanation for the effect of siAEBP1 in HCC progression.
This study further performed rescue experiments, and observed that the activation of PI3K/AKT pathway by 740Y-P treatment enhanced both MHCC-97 H and Huh7 cell proliferation, and attenuates the effect of siAEBP1 on the cell proliferation. These implied siAEBP1 functioned via inactivating PI3K/AKT in HCC. In addition, regarding the in-depth interaction between AEBP1 and PI3K/AKT pathway, a recent review reported that [17]: (1) AEBP1 augmented PI3K/AKT pathway via TNF-α; (2) AEBP1 interacted with PI3KCB (a specific PI3K enzyme) to activate PI3K/AKT pathway; (3) AEBP1 might mediate a crosstalk between PI3K-Akt pathway and the canonical NF-κB pathway.
Conclusions
Collectively, AEBP1 exhibits the potency to be a target for HCC treatment, via its regulation on HCC proliferation, apoptosis and PI3K/AKT pathway, but its effect on HCC invasion and migration seems limited. In addition, a future study that investigate targeting AEBP1 in HCC animal models is needed for verification.
Electronic supplementary material
Below is the link to the electronic supplementary material.
Supplementary figure 1: Publica database analyses. The AEBP1 TPM between HCC tumor tissues and non-tumor tissues (A), the AEBP1 TPM among HCC patients with different stages (B), the correlation of AEBP1 expression with overall survival in HCC patients (C). The data in A-C were derived from the Gene Expression Profiling Interactive Analysis (http://gepia.cancer-pku.cn/). The expression location of AEBP1 in HCC tissue (D), and AEBP1 nTPM among liver cancer cell lines (E). The data in D-E were derived from the Human Protein Atlas (www.proteinatlas.org)
Acknowledgements
Not applicable.
Author contributions
Liyou Liu and Jianxing Zheng contributed to study design and data analysis. Qingshan Cai, Dongyang Wu, Shudong Li, Dong Liu collected the data. Liyou Liu, Qingshan Cai, Dongyang Wu, Shudong Li, Dong Liu and Jianxing Zheng wrote and revised the the manuscript. All authors read and approved the final manuscript.
Funding
No funding available for this work.
Data availability
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.
Declarations
Ethics approval and consent to participate
Not applicable.
Consent for publication
Not applicable.
Competing interests
The authors declare no competing interests.
Footnotes
Publisher’s note
Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.
References
- 1.Bray F, Laversanne M, Sung H, et al. Global cancer statistics 2022: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin. 2024;74(3):229–63. [DOI] [PubMed] [Google Scholar]
- 2.Han B, Zheng R, Zeng H, et al. Cancer incidence and mortality in China, 2022. J Natl Cancer Cent. 2024;4(1):47–53. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Sergi CM, editor. Brisbane (AU): Exon Publications; 2021.
- 4.Vogel A, Meyer T, Sapisochin G, Salem R, Saborowski A. Hepatocellular carcinoma. Lancet. 2022;400(10360):1345–62. [DOI] [PubMed] [Google Scholar]
- 5.Brown ZJ, Tsilimigras DI, Ruff SM, et al. Management of hepatocellular carcinoma: A review. JAMA Surg. 2023;158(4):410–20. [DOI] [PubMed] [Google Scholar]
- 6.Xie D, Shi J, Zhou J, Fan J, Gao Q. Clinical practice guidelines and real-life practice in hepatocellular carcinoma: A Chinese perspective. Clin Mol Hepatol. 2023;29(2):206–16. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Llovet JM, Ricci S, Mazzaferro V, et al. Sorafenib in advanced hepatocellular carcinoma. N Engl J Med. 2008;359(4):378–90. [DOI] [PubMed] [Google Scholar]
- 8.Kudo M, Finn RS, Qin S, et al. Lenvatinib versus Sorafenib in first-line treatment of patients with unresectable hepatocellular carcinoma: a randomised phase 3 non-inferiority trial. Lancet. 2018;391(10126):1163–73. [DOI] [PubMed] [Google Scholar]
- 9.Qin S, Li Q, Gu S, et al. Apatinib as second-line or later therapy in patients with advanced hepatocellular carcinoma (AHELP): a multicentre, double-blind, randomised, placebo-controlled, phase 3 trial. Lancet Gastroenterol Hepatol. 2021;6(7):559–68. [DOI] [PubMed] [Google Scholar]
- 10.Blackburn PR, Xu Z, Tumelty KE, et al. Bi-allelic alterations in AEBP1 lead to defective collagen assembly and connective tissue structure resulting in a variant of Ehlers-Danlos syndrome. Am J Hum Genet. 2018;102(4):696–705. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Kim SW, Muise AM, Lyons PJ, Ro HS. Regulation of adipogenesis by a transcriptional repressor that modulates MAPK activation. J Biol Chem. 2001;276(13):10199–206. [DOI] [PubMed] [Google Scholar]
- 12.Majdalawieh A, Ro HS. Regulation of IkappaBalpha function and NF-kappaB signaling: AEBP1 is a novel Proinflammatory mediator in macrophages. Mediators Inflamm. 2010;2010:823821. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Jin R, Li C, Yang Y, Xie J. AEBP1 restores osteoblastic differentiation under dexamethasone treatment by activating PI3K/AKT signalling. Clin Exp Pharmacol Physiol. 2024;51(11):e13923. [DOI] [PubMed] [Google Scholar]
- 14.Li J, Ruan Y, Zheng C, et al. AEBP1 contributes to breast Cancer progression by facilitating cell proliferation, migration, invasion, and blocking apoptosis. Discov Med. 2023;35(174):45–56. [DOI] [PubMed] [Google Scholar]
- 15.Ju G, Xing T, Xu M, et al. AEBP1 promotes papillary thyroid cancer progression by activating BMP4 signaling. Neoplasia. 2024;49:100972. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hou Y, Sun B, Liu W, et al. Targeting of glioma stem-like cells with a parthenolide derivative ACT001 through Inhibition of AEBP1/PI3K/AKT signaling. Theranostics. 2021;11(2):555–66. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 17.Majdalawieh AF, Massri M, Ro HS. AEBP1 is a novel oncogene: mechanisms of action and signaling pathways. J Oncol. 2020;2020:8097872. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 18.Mabrouk NMK, Elkaffash DM, Abdel-Hadi M, et al. Identification of the possible therapeutic targets in the insulin-like growth factor 1 receptor pathway in a cohort of Egyptian hepatocellular carcinoma complicating chronic hepatitis C type 4. Drug Target Insights. 2020;14:1–11. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Xing Y, Zhang Z, Chi F, et al. AEBP1, a prognostic indicator, promotes colon adenocarcinoma cell growth and metastasis through the NF-kappaB pathway. Mol Carcinog. 2019;58(10):1795–808. [DOI] [PubMed] [Google Scholar]
- 20.Guo K, Song L, Chang J, Cao P, Liu Q. AEBP1 promotes glioblastoma progression and activates the classical NF-kappaB pathway. Behav Neurol. 2020;2020:8890452. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Liu S, Gu Y, Shi Y, Yu S, Li W, Lv W. AEBP1 upregulation contributes to cervical cancer progression by facilitating cell proliferation, migration, and invasion. J Obstet Gynaecol Res. 2024;50(7):1166–74. [DOI] [PubMed] [Google Scholar]
- 22.Liu JY, Jiang L, Liu JJ, et al. AEBP1 promotes epithelial-mesenchymal transition of gastric cancer cells by activating the NF-kappaB pathway and predicts poor outcome of the patients. Sci Rep. 2018;8(1):11955. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 23.Zhou Q, Wang X, Zhang Y, Wang L, Chen Z. Inhibition of AEBP1 predisposes cisplatin-resistant oral cancer cells to ferroptosis. BMC Oral Health. 2022;22(1):478. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Li Y, Tang ZY, Ye SL, et al. Establishment of cell clones with different metastatic potential from the metastatic hepatocellular carcinoma cell line MHCC97. World J Gastroenterol. 2001;7(5):630–6. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Dhar D, Baglieri J, Kisseleva T, Brenner DA. Mechanisms of liver fibrosis and its role in liver cancer. Exp Biol Med (Maywood). 2020;245(2):96–108. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Sinha S, Renganathan A, Nagendra PB, Bhat V, Mathew BS, Rao MRS. AEBP1 down regulation induced cell death pathway depends on PTEN status of glioma cells. Sci Rep. 2019;9(1):14577. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Glaviano A, Foo ASC, Lam HY, et al. PI3K/AKT/mTOR signaling transduction pathway and targeted therapies in cancer. Mol Cancer. 2023;22(1):138. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Bang J, Jun M, Lee S, Moon H, Ro SW. Targeting EGFR/PI3K/AKT/mTOR signaling in hepatocellular carcinoma. Pharmaceutics. 2023;15(8). [DOI] [PMC free article] [PubMed]
- 29.Sun C, Zhang Z, He P, Zhou Y, Xie X. Involvement of PI3K/Akt pathway in the Inhibition of hepatocarcinoma cell invasion and metastasis induced by SASH1 through downregulating Shh-Gli1 signaling. Int J Biochem Cell Biol. 2017;89:95–100. [DOI] [PubMed] [Google Scholar]
Associated Data
This section collects any data citations, data availability statements, or supplementary materials included in this article.
Supplementary Materials
Supplementary figure 1: Publica database analyses. The AEBP1 TPM between HCC tumor tissues and non-tumor tissues (A), the AEBP1 TPM among HCC patients with different stages (B), the correlation of AEBP1 expression with overall survival in HCC patients (C). The data in A-C were derived from the Gene Expression Profiling Interactive Analysis (http://gepia.cancer-pku.cn/). The expression location of AEBP1 in HCC tissue (D), and AEBP1 nTPM among liver cancer cell lines (E). The data in D-E were derived from the Human Protein Atlas (www.proteinatlas.org)
Data Availability Statement
The datasets used and/or analysed during the current study are available from the corresponding author on reasonable request.






