Creatine monohydrate administration delayed muscle glycolysis of antemortem-stressed broilers by enhancing muscle energy status, increasing antioxidant capacity and regulating muscle metabolite profiles

Abstract

Preslaughter stress induced a negative energy balance of broilers, resulted in an accelerated glycolysis and finally led to an inferior meat quality. The present study aimed to investigate the effects of creatine monohydrate (CMH) supplementation on muscle energy storage, antioxidant capacity, the glycolysis of postmortem muscle and the metabolite profiles in muscle of broilers subjected to preslaughter transport. Two hundred and forty broilers were chosen and randomly allocated into three treatments (group A, group B and group C), comprising 8 replicates (10 broilers each replicate). Broilers in group A and B as well as group C were fed with the basal diet or diets containing 1200 mg/kg CMH for 14 days, respectively. After 12 h feed deprivation, broilers in group B (T_3h group) and group C (T_3h +CMH₁₂₀₀ group) were both subjected to a preslaughter transportation (3 h), but those in group A were treated with a 0.5 h-transport (refined as the control group). The results showed that preslaughter stress led to a lower pH_24h value, a bigger L* value and a higher drip loss of muscle compared with the control group (P < 0.05). In addition, transport stress accelerated glycolysis in postmortem muscle, decreased energy storage and the antioxidant capacities of muscle (P < 0.05). However, CMH administration ameliorated energy status, delayed muscle glycolysis, elevated mRNA expression involved in Cr metabolism and inhibited AMPK signaling of broilers experienced preslaughter transport stress. Moreover, significant differences in glycine, serine and threonine metabolism, cysteine and methionine metabolism, purine metabolism, arginine and proline metabolism, ABC transporters, carbon metabolism, lysine metabolism and sulfur metabolism were observed using pathway enrichment analysis. Additionally, the contents of Cr and ATP were positively correlated with branched amino acids (L-valine and l-leucine), l-asparagine, inosine, PCr and d-ribose by metabolomics analysis. Taken together, CMH ameliorated energy status, delayed muscle glycolysis and improved meat quality of antemortem-stressed broilers by the regulation of pathways and key metabolites involved in energy metabolism of postmortem muscle.

Introduction

Chicken meat is considered as a healthy-benefit and cheapest commercially animal produced meat due to its high protein content, a low portion of fat content and cholesterol as well as less in calories, which has a great demand both locally and globally making it more superior to the modern health-conscious consumers across the world (Petracci et al., 2014; Kim et al., 2020). With the continuous increase in its consumption, consumers pay attention to the high quality and safety of broiler production (Marchewka et al., 2023). It was reported that chicken meat quality could be affected by several and complex factors, including rearing environment factors in production system (housing type, rearing facilities and stocking density) and stress before and during slaughter (transport stress, catching, feed withdrawal handling and stunning techniques) (Mir et al., 2017; Muroya et al., 2020; Zhang et al., 2022). Moreover, stress can affect the behavioral and physiological status of broilers and impact biochemical changes and metabolic functions influencing the meat quality of postmortem muscles (Jung et al., 2022). It has been demonstrated that antemortem stress accelerated energy expenditure, led to a lower energy status and induced rapid glycolysis in postmortem muscle, finally resulted in inferior meat quality (Xu et al., 2022). Therefore, it may be a feasible way to enhance the energy reserve by exogenous energy compounds administration to ameliorate energy expenditure induced by antemortem stress and furtherly improve meat quality.

Creatine (Cr) functions as an energy-boosting compound, which can contribute to increasing the stores of Cr and phosphocreatine (PCr) (Kamel et al., 2023) and serving as a regulator and backup of adenosine triphosphate (ATP) in tissues with high energy demand via Cr/PCr shuttle (Pearlman and Fielding, 2006; Kamel et al., 2023). Cr is mainly located in skeletal muscle, in which the primary form is PCr (approximately accounting for 60 %−70 %) and the remaining form is free Cr (approximately accounting for 30-40 %) (Kamel et al., 2023). The de novo synthesis of Cr consists of two steps (Kamel et al., 2023). The first step is the formation of guanidinoacetic acid (GAA) catalyzed by l-arginine: glycine amidino transferase (AGAT), followed by the yield of Cr catalyzed by guanidinoacetate methyltransferase (GAMT) (Duan et al., 2022). Subsequently, Cr enters bloodstream and is delivered into skeletal muscle against its concentration gradient via a Na⁺/Cl^–-dependent transporter known as creatine transporter (CrT), and exerts its effects on energy metabolism (Brudnak, 2004). The primary dietary source of Cr is animal protein ingredients, while plant-originated foods are typically poor sources of this nutrient (Souza et al., 2024). It has been demonstrated that creatine monohydrate (CMH) and GAA (an immediate precursor of Cr) supplementation in diet could be effective in enhancing muscle energy reserve of broilers receiving the corn-soybean basal diet (Michiels et al., 2012; Zhang et al., 2014; 2021a). Moreover, it was reported that CMH administration improved meat quality and delayed muscle glycolysis in muscle of transported-stressed broiler (Zhang et al., 2017b). The information mentioned above indicated that CMH administration regulated energy metabolism in postmortem muscle. However, to the best of our knowledge, the regulations of CMH administration on the related pathways involved in energy metabolism of muscle and the key metabolites associated with energy status and meat quality of broilers experienced antemortem transport stress is still not well-known.

In order to fully understand the changes of the metabolites in muscle of antemortem-stressed broilers, a metabolomic approach was applied. Therefore, the present study was aimed to investigate the effect of CMH supplementation on muscle energy metabolism, the glycolysis in postmortem muscle, anti-oxidant capacity and reveal the changes in muscle metabolites of antemortem-stressed broilers, which may contribute to providing sights into the nutritional manipulation to high-quality meat production of chicken.

Materials and methods

Experimental design, diet and transportation

The study protocol and the experimental procedures followed the regulations of Jilin Agricultural University were approval by Experiment Ethics Committee (SYXK(Ji)2023-0021).

A total of 240 broilers (56 weeks of age) were obtained from the same commercial farm (Qinzhibao Langya Chicken breeding Co. Ltd., Qingdao, China) and randomly assigned into one of three treatments named separately with group A, B and C, comprising 8 replicates (10 broilers per each). The two diets contain the corn-soybean basal diet (Table 1) for birds in group A and B and the experiment diet containing 1200 mg/kg CMH (Tianjin Tiancheng Pharmaceutical Co. Ltd., Tianjin, China) for birds in group C, respectively. All broilers were kept in an environmentally controlled room. During the experiment period, birds were freely access to water and feed (mash form). The dose of CMH administration were chosen based on the results of our pervious report (Zhang et al., 2021b).

Table 1.

Ingredients and nutrient contents of the basal diet (%).

Items	Contents	Nutrient levels	Contents
Corn	68.69	Crude protein(%)	16.23
Soybean meal	16.00	Metabolic energy(MJ/kg)	13.21
Corn gluten meal	4.80	Lysine(%)	0.86
Dried distillers grains with solubles	2.00	Methionine(%)	0.65
Soybean oil	3.93	Calcuim(%)	0.80
L-Lysine HCl	0.32	Available phosphorus(%)	0.35
DL-Methionine	0.13
Calcuim monophosphate	1.32
Limestone	0.91
Salt	0.30
1 % Premix 1	1.00

¹Premix provided per kilogram of the diet: (1) vitamin provided per kilogram of the diet: vitamin A 11000 IU;vitamin D₃ 2800 IU;vitamin E 45 IU;vitamin K, 2.1 mg;thiamine 2.00 mg;riboflavin 9.0 mg;nicotinamide 28.00 mg;calcium pantothenate, 28.00 mg;pyidoxine·HCl, 3.00 mg;biotin, 0.15 mg;folic acid, 1.20 mg;vitamin B₁₂, 0.018 mg;(2) mineral provided per kilogram of the diet: ferrous 70 mg;copper 9.00 mg;manganese 90.00 mg;zinc 80.00 mg;iodine 0.15 mg;selenium 0.15 mg.

Transportation and sample collection

On day 15 of the experiment, after 12 h feed withdraw overnight, all broilers were treated as follows: (1) broilers in group A were subjected to a 0.5h transportation (defined as the control group); (2) broilers in group B (T_3h group) and group C (defied as CMH₁₂₀₀ + T_3h group) were subjected to a 3h transportation at an approximate speed of 80 km/h. During the transportation, ten birds within the same replicate were placed into one crate (0.73 m × 0.54 m × 0.26 m), and all twenty-four crates were randomly distributed in the same truck. After transportation and taking a rest for 45 min, eight birds closest to the average weight per treatment were selected and slaughtered with an electrical stunning (Zhang et al., 2022). Approximate10 mL blood samples were collected into heparin-coated tubes for plasma collection. Besides, 10.0 g liver samples were collected into sterile tube and stored in liquid nitrogen for further analysis. The entire left breast muscle was separated and stored at 4 ℃ for meat quality analysis. In addition, 10.0 g samples from the right breast muscle were collected into snap-frozen tubes and stored in liquid nitrogen for further analysis of muscle energy status, metabolomics analysis combined with extraction of total RNA.

Determination of muscle pH, the activities of glycolytic key enzymes and creatine kinase

The analysis of pH_{45 min} and pH_{24 h} value of postmortem breast muscle were conducted with portable pH meter (Xima Instrument Group Co., Ltd., Shenzhen, China). The activities of three key enzymes in the glycolytic pathway including hexokinase (HK), phosphofructokinase (PFK) and pyruvate kinase (PK) were determined using commercially available kits purchased from Nanjing Jiancheng Bioengineering Institute.

The contents of Cr, PCr and adenosine phosphate measurement

The determination of Cr, PCr and adenosine phosphate (ATP, adenosine diphosphate (ADP) and adenosine monophosphate (AMP) in muscle were performed using high performance liquid chromatography followed the procedures reported by Zhang et al. (2021a). The standards for analyzing Cr and PCr contents, as well as adenosine phosphates such as ATP, ADP and AMP, were obtained from a commercial company (Sigma-Aldrich Inc., St. Louis, MO, USA).

Metabolomic sample preparation

The muscle samples weighed 20 mg were cut into a 1.5 mL Eppendorf tube along with 20 μL of an internal standard (0.3 mg/mL of 2‑chloro-l phenylalanine in methanol) and 600 μL of methanol /water extraction solvent at a ratio of 4:1 (v/v). The samples for subsequent metabolomic analysis were prepared according to the method reported by Zhang et al. (2022).

GC-MS analysis

GC-MS analysis was carried out according to a previously described method with some modification (Lu et al., 2018). A DB-5MS fused silica capillary column (30 m × 0.25 mm × 0.25 μm) was used for the separation of the derivatives. High-purity helium (purity >99.999 %) with a flow of 1 mL /min was used as the carrier gas. The injection port temperature was set to 260 °C and the injection volume was 1 μL. The oven temperature was programmed as follows: the initial temperature was 60 °C, ramped at 8 °C/min to 125 °C, further ramped at 5 °C/min to 210 °C, then at 10 °C/min to 270 °C, and finally ramped at 20 °C/min to 305 °C, holding for 5 min. The temperature of electron impact ionization source with an ion source and a quadrupole were set at 230 °C and 150 °C, respectively. The electron energy was set at 70 eV. The scan model was acquired in a full-scan mode with a mass scan range of 50–500 m/z.

Real-time quantitative polymerase chain reaction (qPCR)

Approximate 25 mg frozen muscle was collected into tubes containing 1 mL RNAiso Plus reagent (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China) to extract total RNA reported by Zhang et al. (2021a). The concentration of extracted RNA was determined using a ND-1000 spectrophotometer (NanoDrop, Thermo Fisher Scientific) and reversed into cDNA using PrimeScript RT Master Mix (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China). The real-time quantitative PCR was performed in a Real-Time CFX connect PCR System (Bio-Rad Laboratories Inc., USA) using SYBR Premix Ex Taq kits (Takara Biotechnology (Dalian) Co., Ltd., Dalian, China). All samples in RT-PCR analysis were performed in triplicate. The relative mRNA expression levels of target genes (Table 2) were calculated using the 2^−ΔΔCt method (Livak and Schmittgen, 2001) and β-actin was considered as the housekeeping gene.

Table 2.

Specific primer sequences for real-time quantitative PCR analysis.

Genes		Primers (5′→3′)	Amplicon size	Genebank accession
CrT	Sense: TGAACTACAAACCGCTGACG Antisense: GCTCGTAGATAACGGTGCAG		120 bp	JN628439.2
GAMT	Sense: CTGTGCTACGCCGTGCCGTTCTGCTCCA Antisense: CTCTTCTACAACTCCACTTGAGTCCACCGTG		108 bp	XM 001234062.3
β-actin		Sense: ATGGATGATGATATTGCTGCGCTCGTTG	203 bp	NM_205518.2
		Antisense: TTCAGGGTCAGGATACCTCTTTTGCTCT

CrT, creatine transporter; GAMT, S-adenosyl-l-methionine: guanidinoacetate N-methyltransferase.

Statistical analysis

The chromatographic peaks detected in different samples were processed by referencing the retention times and peak shape information of the standards. Based on a self-built targeted standard database, substance information and qualitative analysis were obtained. Principal component analysis (PCA) and orthogonal partial least squares discriminant analysis (OPLS-DA) were used to analyze the differences in metabolites. Metabolites with log2FC ≥ 1, VIP value > 1, and P-value < 0.05 were considered significantly altered. Functional enrichment analysis was carried out by MetaboAnalyst 3.0 software (Gavin et al., 2018; Wu et al., 2021).

Data analysis was performed using SPSS statistical software (version 20.0, SPSS Institute, Inc., Chicago) for one-way analysis of variance (ANOVA). Data of each treatment was expressed as mean values and standard error of the mean (SEM), and P < 0.05 indicated significant differences among treatments.

Results

Growth performance

As shown in Table 3, compared with broilers fed with the soybean-corn basal diet (group A and group B), broilers receiving diet supplemented with 1200 mg/kg CMH showed no differences in feed consumption, body weight gain or feed conversion ratio (P > 0.05).

Table 3.

Effect of creatine monohydrate administration on growth performance of broilers.

Items	Groups			SEM	P value
	A	B	C
Weight gain (g)	344.12	353.08	346.08	11.344	0.761
Feed consumption(g)	1540.84	1501.36	1536.36	17.740	0.650
FCR(g/g)	4.49	4.27	4.45	0.336	0.649

Data are represented as the mean value ±SEM. Broilers both in Group A or Group B received the soybean-corn basal diet; Group C, broilers in Group C were provided with diet containing creatine monohydrate at the level of 1200 mg/kg. FCR, feed conversion ratio. SEM, the standard error of the mean.

Meat quality

As presented in Table 4, no differences in pH_{45 min} were observed among three experimental treatments (P > 0.05). But the value of pH_24h of broiler in T_3h group was lower than those in the control group and T_3h + CMH₁₂₀₀ group (P < 0.05). Compared with the control group, drip loss and the value of L* of muscle were increased by 3h pre-slaughter transportation (P < 0.05), whereas 1200 mg/kg CMH administration reduced the drip loss and L* value when compared with those in T_{3 h} group (P < 0.05). In addition, there were no differences in the value of a*, b* or cooking loss in muscle of broilers among three treatments (P > 0.05).

Table 4.

Effects of creatine monohydrate administration on meat quality of antemortem-stressed broilers.

Items	Experimental treatments			SEM	P value
	Control	T3h	T3h +CMH1200
pH45min	6.40	6.23	6.36	0.045	0.294
pH24h	5.85a	5.49b	5.87a	0.050	0.001
L*	52.65b	54.69a	52.86b	0.370	0.029
a*	1.25	1.18	1.23	0.018	0.280
b*	5.17	5.19	5.23	0.089	0.964
Drip loss (%)	3.01b	3.41a	3.11b	0.061	0.013
Cooking loss (%)	16.87	18.34	16.33	0.431	0.144

Data were expressed with the mean value ± SEM. Control, birds received the soybean-corn basal diet and treated with transport stress (0.5 h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with transport stress (3 h). SEM, the standard error of the mean. Mean within the same row with different superscripts differ significantly (P < 0.05).

Adenosine phosphate in muscle

It was shown that pre-slaughter transportation induced a reduction in ATP content of muscle, however, the contents of ADP and AMP as well as the AMP: ATP ratio were increased by transport stress (Fig. 1, P < 0.05). But CMH administration elevated the APT level and decreased the contents of ADP, AMP as well as AMP: ATP ratio by transport stress (P < 0.05).

Fig. 1.

Effect of creatine monohydrate administration on the contents of adenosine phosphate in muscle of broilers experienced transport stress. Data are expressed with the mean value ± SD. Control group, birds received the soybean-corn basal diet and treated with transport stress (0.5h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with a preslaughter transportation (3 h). CMH, creatine monohydrate; ATP, adenosine triphosphate; ADP, adenosine diphosphate; AMP, adenosine monophosphate. Different superscript above the column indicated different significantly (P < 0.05).

Cr and PCr contents

The results showed that preslaughter transportation stress indued the decreases in Cr and PCr contents of muscle in comparison with the control group (P < 0.05, Fig. 2). However, compared with broilers in T_{3 h} group, Cr and PCr contents in muscle of broilers fed with diet containing 1200 mg/kg CMH were higher (P < 0.05).

Fig. 2.

Effect of creatine monohydrate on the contents of Cr (A), PCr (B) as well as PCr : Cr ratio (C) in muscle of broilers experienced transport stress. Data were expressed with the mean value ± SD. Control group, birds received the soybean-corn basal diet and treated with transport stress (0.5h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with transport stress (3 h). CMH, creatine monohydrate; Cr, creatine; PCr, phosphocreatine. Different superscript above the column indicated different significantly (P < 0.05).

Antioxidant capacity of muscle

Antemortem-stressed broiler chickens showed a lower antioxidant capacity, exhibited by the decreased contents of T-AOC, CAT and SOD in muscle of broilers in comparison with the control group (Table 5, P < 0.05). In contrast, CMH administration elevated the contents of T-AOC and SOD compared with those in T_{3 h} group (P < 0.05). In addition, the contents of MDA in T_{3 h} broilers were higher than those in the control group (P < 0.05), but CMH addition at the dose of 1200 mg/kg led to a reduction in MDA content in comparison with T_{3 h} group (P < 0.05). Besides, no differences in the contents of GSH-Px were observed among three treatments (P > 0.05).

Table 5.

Effects of creatine monohydrate administration on antioxidant capacity in muscle of antemortem-stressed broilers.

Items	Experimental treatments			SEM	P value
	Control	T3h	T3h+CMH1200
T-AOC (U/mg protein)	0.10a	0.08b	0.10a	0.002	0.015
CAT (U/mg protein)	1.02a	0.87b	0.95ab	0.023	0.035
SOD (U/mg protein)	129.59a	119.60b	133.62a	2.027	0.008
GSH-Px (U/mg protein)	25.45	24.11	26.13	0.638	0.438
MDA (mmol/mg protein)	0.25b	0.41a	0.26b	0.016	<0.001

Data were expressed with the mean value ± SEM. Control, birds received the soybean-corn basal diet and treated with transport stress (0.5h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with transport stress (3 h). CMH, creatine monohydrate; T-AOC, total antioxidant capacity; CAT, catalase; SOD, superoxide dismutase; GSH-Px, glutathione peroxidase; MDA, malondialdehyde. SEM, the standard error of the mean. Means within the same row with different superscripts differ significantly (P < 0.05).

Determination of the activities of HK, PFK and PK

Antemortem transport stress led to increases in the activities of HK, PFK and PK involved the glycolytic process of postmortem muscle (Fig. 3, P < 0.05). However, broilers received diet with CMH supplementation showed lower activities of HK, PFK and PK in muscle (P < 0.05). In addition, no differences in the activities of HK, PFK or PK in muscle were observed in CMH treated group when compared with the control group (P > 0.05).

Fig. 3.

Effect of creatine monohydrate administration on the activities of hexokinase (A), fructose-2,6-diphosphate (B) and pyruvate kinase (C) in muscle of broilers experienced transport stress. Data were expressed with the mean value ± SD. Control group, birds received the soybean-corn basal diet and treated with transport stress (0.5h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with transport stress (3 h). CMH, creatine monohydrate. Different superscript above the column indicated different significantly (P < 0.05).

GC-MS profiles

Total 406 different metabolites were identified among three treatments, mainly concentrated in organic acids and derivatives (86), organic oxygen compounds (62), lipids and lipid like molecules (58), organic heterocyclic compounds (36), benzenoids (26), nucleosides, nucleotides, and analogues (15), phenylpropanoids and polyketides (13) (Fig. 4A). Both PCA and OPLS-DA score plots exhibited a clear separation among three treatments (Fig. 4B–D), indicating significant differences between groups and high intra group repeatability.

Fig. 4.

The metabolite pie chart of the measured metabolites calculated based on primary classification (A), the discriminating metabolites identified principal component analysis (PCA) score plots (B) and orthogonal projections to latent structure-discriminant analysis (OPLS-DA) score plots (C and D). Control group, birds received the soybean-corn basal diet and treated with transport stress (0.5h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with transport stress (3 h). CMH, creatine monohydrate.

It was showed that the diagrams of permutation test of OPLS-DA (R²X (cum)=0.601, R²Y(cum)=0.938, Q²Y(cum)=0.842) was observed between the control group vs. T_3h group. Similarly, the diagrams of permutation test of OPLS-DA (R²X (cum)=0.603, R²Y(cum)=0.817, Q²Y(cum)=0.591) was observed between T_3h group vs T_3h+CMH₁₂₀₀ group.

Volcano plot and cluster heat map of different metabolites in muscle

The different metabolites were identified based on the first principal component of OPLS-DA model (VIP>1, P < 0.05 for t-test). Sixty-nine significantly different metabolites were detected in the control group and T_3h group, which included twenty upregulated and forty-nine downregulated metabolites (Fig. 5A). The heat map of differential metabolites of these two groups (the control group VS T_3h) was shown in Fig. 5B. Meanwhile, one hundred and thirty-six significant metabolites were identified in the T_3h and T_3h+CMH₁₂₀₀ group (Fig. 5C), including eleven upregulated and one hundred and twenty-five downregulated metabolites. The heat map of differential metabolites of these two groups (T_3h vs T_3h+CMH₁₂₀₀) was shown in Fig. 5D.

Fig. 5.

Different metabolite volcano plot and different metabolite cluster heat map of muscle. Control group, birds received the soybean-corn basal diet and treated with transport stress (0.5h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with transport stress (3 h). CMH, creatine monohydrate.

Pathway enrichment analysis and venn diagram of metabolites

As shown in Fig. 6A and B, twenty metabolic pathways were mapped to the KEGG database for different metabolites in the control group and T_3h group. The same quantity metabolic pathways were also observed in T_3h and T_3h+CMH₁₂₀₀ group. The significant represented pathways (the control group VS T_3h group) were gap junction, carbon metabolism, propanoate metabolism, ABC transporters, neuroactive ligand-receptor interaction, glyoxylate and dicarboxylate metabolism, purine metabolism, cysteine and methionine metabolism and citrate cycle (TCA cycle). The differentiated pathways between T_3h and T_3h+CMH₁₂₀₀ group identified by the discriminating metabolites were biosynthesis of amino acids, glycine, serine and threonine metabolism, ABC transporters, cysteine and methionine metabolism, purine metabolism, arginine and proline metabolism, necroptosis, aminoacytl-tRNA biosynthesis, carbon metabolism, lysine metabolism and sulfur metabolism. Moreover, twenty-eight (the control group VS T_3h) and ninety-five (T_3h VS T_3h+CMH₁₂₀₀) significantly different metabolites were found by Venn diagram analysis, respectively (Fig. 6C). Besides, forty-one common metabolites were also found among three treatments.

Fig. 6.

Pathway enrichment analysis of differentiated metabolites identified using the pathway enrichment statistical scatterplot (A and B) and venn diagram of metabolites (C). Control group, birds received the soybean-corn basal diet and treated with transport stress (0.5h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with transport stress (3 h). CMH, creatine monohydrate.

Correlations heat map

As presented in Fig. 7, the concentrations of ADP and AMP combined with the AMP:ATP ratio were negatively correlated with the levels of creatine phosphate, d-ribose, l-leucine, l-asparagine, inositol and aminomalonate. However, there is a positive correlation between ATP and Cr contents with the creatine phosphate, d-ribose and d-ribose-5-phosphate. In addition, a positive correlation was also observed with pH_{24 h} in postmortem muscle and the contents of creatine phosphate and d-ribose.

Fig. 7.

Correlations heat map based on Pearson`s correlations of pH value in postmortem muscle, muscle energy status and some important metabolites linked to energy metabolism in broilers. ATP, adenosine triphosphate; ADP, adenosine diphosphate; AMP, adenosine monophosphate; AMP_ATP, the ratio of adenosine monophosphate to adenosine triphosphate; L*, lightness, Cr, creatine; PCr, phosphocreatine; PCr_Cr, the ratio of phosphocreatine to creatine; pH_45min, pH at 45 min postmortem; pH_24h, pH at 24 h postmortem.

GMAT and CrT mRNA expression levels in liver and muscle

From the data presented in Table 6, it was found that CMH administration upregulated relative mRNA expression levels of GAMT and CrT in liver when compared with those in the control group (P < 0.05). Moreover, CMH addition also increased CrT mRNA expression in muscle compared with the control group and T_3h group (P < 0.05). But no differences in GAMT mRNA expression of muscle among three treatments were observed (P > 0.05).

Table 6.

Effects of creatine monohydrate administration on mRNA expression related to creatine transportation in liver and muscle of antemortem-stressed broilers.

Items	Experimental treatments			SEM	P value
	Control	T3h	T3h+CMH1200
Liver
GAMT	1.00b	0.98b	1.21a	0.041	0.036
CrT	0.97b	1.12b	1.40a	0.053	0.001
Muscle
GAMT	1.07	0.91	1.08	0.042	0.185
CrT	1.03b	0.97b	1.21a	0.025	<0.001

Data were expressed with the mean value ± SEM. Control group, birds received the soybean-corn basal diet and treated with transport stress (0.5h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with transport stress (3 h). CMH, creatine monohydrate; GAMT, S-adenosyl-L methionine: guanidinoacetate N-methyltransferas; CrT, creatine transporter. SEM, the standard error of the mean. Means within the same row with different superscripts differ significantly (P < 0.05).

Related gene mRNA expression of AMPK signaling pathway

The results showed that preslaughter transport stress induced the increases in the levels of LKB1 mRNA (Fig. 8A) and AMPKα2 mRNA (Fig. 8C) (P < 0.05). In contrast, both LKB1 and AMPKα2 mRNA expression levels in muscle of broilers receiving diets treated with CMH addition were downregulated compared with broilers in T_3h group (P < 0.05). But no differences in AMPKα1 (Fig. 8B) mRNA expression were observed among three treatments (P > 0.05).

Fig. 8.

Effect of creatine monohydrate administration on the level of LKB1 (A), AMPKα1 (B) and AMPKα2 (C) mRNA in muscle of antemortem-stressed broilers. Data were expressed with the mean value ± SD. Control group, birds received the soybean-corn basal diet and treated with transport stress (0.5h); T_3h or T_3h+CMH₁₂₀₀, birds received the soybean-corn basal diet or the diet containing 1200 mg/kg creatine monohydrate and treated with transport stress (3 h). CMH, creatine monohydrate;LKB1, liver kinase B1; AMPKa1, adenosine 5`-monophosphate-activated protein kinase a1; AMPKa2, adenosine 5`-monophosphate -activated protein kinase a2. Different superscript above the column indicated different significantly (P < 0.05).

Discussion

A previous study suggested that 1000 mg/kg CMH supplementation for 42 days increased body weight gain and lowered FCR of broilers in comparison with those fed the basal diet with no CMH supplementation (Kawathe et al., 2023). Similarly, Ahmed et al. (2018) suggested that broilers received diets containing 500–1000 mg/kg CMH for 42 days showed a significant increase in body weight. However, our results showed that, in comparison with broilers receiving the soybean-corn basal diet, 1200 mg/kg CMH administration before slaughter did not affect the feed consumption, body weight gain or FCR of broilers. In consistent the results of ours, it was reported that CMH supplementation at the levels of 600 and 1200 mg/kg for 14 days had no significant effect on average daily feed intake, average daily weight gain or the ratio of feed to gain of broilers (Zhang et al., 2014). The differences in the growth performance of broilers received diet containing CMH might be ascribed to the amount of CMH addition and the experimental duration.

Stress caused by physical exertion during transportation can disrupt the homeostasis and metabolism of animals (Wolmarans, 2011). Accumulated evidences revealed that the pre-slaughter transport stress indued negative effects on meat quality of broilers (Xing et al., 2016; Wang et al., 2017; Huang et al., 2018). Our results showed that antemortem transport stress led to a lower pH_24h value, and higher L* value and more drip loss of postmortem meat. In our previous study, it was found that antemortem-stressed broilers exhibited a significant reduction in pH_24h value as well as increases in L* value and drip loss (Zhang et al., 2022). Similarly, 3h antemortem transportation induced an increase in drip loss and a decrease in pH_24h, indicating that pre-slaughter transport stress strengthened muscle glycolysis, led to lactic acid accumulation and ultimately resulted in the reduction in muscle pH (Xu et al., 2022). However, dietary 1200 mg/kg CMH addition reversed the negative effects on meat quality induced by antemortem transport stress, evidenced as an increase in postmortem pH_{24 h} as well as decreases in drip loss and L* value. In previous studies, it was demonstrated that dietary supplementation with creatine nitrate (a new form of creatine) and GAA improved postmortem meat quality at a certain extent (Zhang et al., 2021a; Xu et al., 2022). Accordingly, compared with the control group, the activities of key enzymes (HK, PFK and PK) involved in the glycolysis of postmortem muscle were increased in T_3h group, suggesting that muscle glycolysis was initiated by transport stress. But the decreased activities of the enzymes aforementioned were observed in response to CMH addition. The information mentioned above indicated that CMH administration could contribute to delaying the glycolysis of postmortem muscle of transport-stressed broilers.

Accumulated evidences revealed that pre-slaughter transportation could cause alterations in the oxidative state of muscle and induce strong oxidative stress in broilers, leading to excessive production of free radicals and resulting in protein oxidation and lipid peroxidation (Zhang et al., 2010; Zheng et al., 2020). Our results revealed that antemortem transport stress induced the reductions in antioxidant capacity of muscle, exhibited by the decreased T-AOC, CAT and SOD in muscle as well as the increased MDA contents. In agreement with this, Zhang et al. (2017a) also suggested that antemortem transportation elevated MAD contents in muscle and led to the reductions in the contents of T-AOC and SOD in muscle. Similarly, it was also reported that broilers subjected to 2h transportation and 4h transportation exhibited increases in MDA contents in thigh and breast muscle (Zheng et al., 2020), indicating that antemortem transport stress induced the decreases of antioxidant enzyme activities and the acceleration of muscle lipid peroxidation and ultimately resulted in oxidative damage to muscle of broilers. However, 1200 mg/kg CMH supplementation reversed the negative effects on oxidative damage induced by transport stress, evidenced by the increases in the contents of SOD, T-AOC and CAT combined with the decreases in the contents of MDA in muscle. A previous study in rat suggested that creatine administration could induce a significant reduction of plasma lipid peroxidation biomarkers (Deminice et al., 2008). In addition, it was also demonstrated that GAA (a precursor of Cr) supplementation could ameliorate the antioxidant capacity of broilers to some extent (due to the increased level of Cr in the body induced by GAA supplementation (Majdeddin et al., 2023). Accordingly, 1200 mg/kg CMH supplementation indeed elevated the concentration of Cr in muscle in our present study. Taken together, CMH supplementation could beneficially increase antioxidant capacity of broilers and decrease lipid peroxidation based on improved muscle Cr loading (Majdeddin et al., 2023).

The characterized profiles of metabolites in muscle were analyzed using metabolomics. The results provided a fully comprehensive understanding of CMH supplementation on the metabolism of postmortem muscle. The results of PCA analysis revealed that there were three principal components of metabolites in postmortem muscle from three treatments, indicating that CMH administration induced the alterations in postmortem muscle have arisen. A total of 406 differential metabolites in postmortem muscle were identified in three treatments, in which 136 metabolites (11 metabolites upregulated and 125 metabolites downregulated) were identified between T_3h and T_3h+CMH₁₂₀₀ group. Besides, muscle metabolomics profiling demonstrated that CMH addition dramatically altered numerous metabolic pathways including glycine, serine and threonine metabolism, cysteine and methionine metabolism, purine metabolism, arginine and proline metabolism, ABC transporters and biosynthesis of amino acids. The TCA cycle is the most effective way to oxidize sugar or other substances to obtain energy (Wang et al., 2019). In our study, the significant differences in TCA cycle were observed between the control group and T_3h group, indicating that partial energy could be obtained from TCA cycle to meet the requirement of energy consumption induced by transport stress. Comparing the different metabolic pathways between T_3h and T_3h+ CMH_1200, several metabolism pathways were related with amino acid metabolism, such as glycine, serine and threonine metabolism, cysteine and methionine metabolism, purine metabolism, arginine and proline metabolism and lysine metabolism. It has been reported that the energy requirements of cellular could be met by the catabolism of amino acid as an energy source through a series of highly integrated chemical reactions in the context of lack of energy supply to meet energy needs (de Sousa Neto et al., 2020), suggesting that amino acids might be involved in decomposition for energy under stress conditions (Lu et al., 2018).

As displayed in Fig. 6, there was a significant positive correlation between the concentration of PCr in metabolites by metabolomics analysis and Cr and ATP concentrations in muscle, while a negative correlation between the concentration of PCr in metabolites and ADP and AMP contents was observed. In consistent with this, our study showed that CMH supplementation increased ATP content in muscle of broilers. However, ADP and AMP contents in muscle of broilers in T_3h+CMH₁₂₀₀ group were lowered. Similarly, in previous studies in pigs and broilers, it was demonstrated that CMH addition elevated the levels of Cr and PCr (Zhang et al., 2017b; Li et al., 2018). Moreover, ATP content was significantly and positively with the levels of l-valine and l-leucine in metabolites by metabolomics analysis, whereas ADP and AMP contents were significantly negative with the levels of l-valine and l-leucine. l-valine and l-leucine, known as branched-chain amino acids, could be converted into α-keto acids through the removal of their amino acids. The final product of l-leucine is acetyl-CoA and the final product of l-valine is succinyl-CoA, which finally enters the TCA cycle (Kimball and Jefferson, 2006). The results mentioned above indicated that TCA cycle was accelerated to produce ATP to meet the requirement of ATP for smooth muscle contraction (Wang et al., 2019). Besides, there was a positive relationship between d-ribose and ATP content in muscle. Tai et al. (2024) suggested that d-ribose, as its exclusive source of carbon and energy, could rapidly provide substrate for ATP synthesis and contribute to ATP synthesis. Besides, a positive correlation between inosine and the contents of ATP was observed. In the presence of inosine led to a higher ATP level in vivo and immediately retarded the decline of ATP (Jurkowitz et al., 1998). Additionally, the substances aforementioned involved in energy metabolism revealed a significant positive correlation with the value of pH_24h in muscle. In consistent with this, our results demonstrated that CMH supplementation increased energy store in postmortem muscle and elevated the value of pH_24h, suggesting that CMH administration could regulate energy metabolism pathways and key metabolites involved in postmortem muscle, which contributed to delaying the glycolysis in postmortem muscle and ameliorating meat quality.

CMH functions as an energy-boosting compound, which benefits for elevating Cr/PCr stores and increasing ATP production (Ipsiroglu et al., 2001). Cr synthesis and transport in mammalian cells requires GAMT and CrT, respectively. GAMT is responsible for the methylated GAA to form Cr, and Cr traverses the muscle cell membrane against its concentration gradient via CrT (Wyss et al., 2000; Brault et al., 2003). In our present study, it was found that 3h preslaughter transportation led to the reductions in Cr and PCr levels as well as ATP content in muscle. Similarly, Wang et al. (2017) reported that a 3h antemortem transport stress led to a lower ATP content in muscle. Moreover, Zhang et al. (2021a) also suggested that Cr and PCr concentrations were decreased by preslaughter transport stress, implying that preslaughter transport stress caused a great effect on skeletal muscle energy metabolism. In previous studies, it was reported that dietary CMH addition could effectively increase Cr/PCr stores in muscle of broilers or finishing pigs (Li et al., 2015; Wang et al., 2015). In accordance with this, higher Cr and PCr contents in muscle as well as lower ADP and AMP contents were observed in T_3h + CMH₁₂₀₀ group than those in T_3h group. Accordingly, GAMT and CrT mRNA levels were also elevated accompanied by the increased Cr and PCr load in muscle. Meanwhile, CMH supplementation also increased GATM mRNA expression in liver, indicating that the synthesis of Cr was enhanced by CMH supplementation. In accordance, it was suggested that GAA administration increased CrT mRNA expression in muscle (Liu et al., 2015). Therefore, CMH supplementation was able to promote muscle bioenergetics and benefit cellular energy status of broilers experienced preslaughter transport stress.

AMPK is a key regulator involved in cellular energy balance and the regulation of glycolysis process, which can be activated in response to ATP depletion and an increase in AMP to ATP ratio (Sakamoto et al., 2004). AMPK is a αβγ heterotrimer, among which α2 subunit not α1 subunit is required for the stimuli of AMPK signaling (Gowans and Hardie, 2014). LKB1 is the main upstream regulator of AMPKα and can active the signals of AMPK (Sakamoto et al., 2004). Previous studies also found that AMPKα2 knockoff not AMPKα1 knockoff induced the reduction in pH and the accumulation of lactate, suggesting that AMPKα2 mainly mediated the glycolysis in muscle (Liang et al., 2013; Zhang et al., 2021a). In similar with this, our results revealed that mRNA expressions of LKB1 and AMPKα2 were both increased by pre-slaughter transport stress, however, AMPKα1 mRNA expression was not affected. Nevertheless, it was observed that CMH supplementation decreased the mRNA expressions of LKB1 and AMPKα2 in muscle, indicating that CMH could contribute to alleviating muscle glycolysis and decreasing the formation of lactic acid through inhibiting the LKB1/AMPK signaling pathway.

In conclusion, pre-slaughter transport stress resulted in a negative energy balance, accelerated muscle glycolysis and an inferior meat quality. However, CMH supplementation positively ameliorated energy status in postmortem muscle through regulating the pathways and metabolites associated with the energy metabolism in postmortem muscle. Moreover, CMH supplementation elevated energy store in muscle, delayed glycolysis in postmortem muscle, improved meat quality and inhibited AMPK signaling pathway via the regulation CMH on pathways and key metabolites involved in energy metabolism of postmortem muscle.

Disclosures

The authors declare that they have no known competing financial interests or personal relationships that could have appeared to influence the work reported in this paper.