Identification of the SWEET gene family and functional characterization of PsSWEET1a and PsSWEET17b in the regulation of sugar accumulation in ‘Fengtang’ plum (Prunus salicina Lindl.)

Shan Liu; Xiaoshuang Nie; Hong Chen; Xinjie Shen

doi:10.1186/s12870-025-06407-y

. 2025 Apr 1;25:407. doi: 10.1186/s12870-025-06407-y

Identification of the SWEET gene family and functional characterization of PsSWEET1a and PsSWEET17b in the regulation of sugar accumulation in ‘Fengtang’ plum (Prunus salicina Lindl.)

Shan Liu ¹, Xiaoshuang Nie ¹, Hong Chen ^1,^✉, Xinjie Shen ^1,^✉

PMCID: PMC11959939 PMID: 40165087

Abstract

Background

‘Fengtang’ plum is a cultivar known for its significant sugar accumulation. Although various studies have been conducted on sugar metabolism, the specific molecular mechanisms underlying the high sugar accumulation in ‘Fengtang’ plum remain largely unexplored. Here, we present the role of the Sugars Will Eventually be Exported Transporters (SWEETs) family in regulating sugar accumulation in ‘Fengtang’ plum fruits.

Results

In this study, 18 PsSWEET genes were identified based on homology with Arabidopsis genes and the Pfam database (ID: PF03083). Alignment of multiple sequences revealed that the seven alpha-helical transmembrane regions (7-TMs) are largely conserved in the PsSWEET family. Phylogenetic analysis demonstrated that the 18 SWEET family members could be categorized into four clades. Nine predicted motifs were identified within the PsSWEET genes of plum. The PsSWEET genes were unevenly distributed across five chromosomes, and synteny analysis revealed three pairs of fragmented duplication events. PsSWEET1a and PsSWEET17b are pivotal in ‘Fengtang’ plum fruit development. Subcellular localization analyses indicated that PsSWEET1a is localized to the nucleus and cytoplasm, while PsSWEET17b is associated with the vacuolar membrane. Gene function was further validated through transient silencing and overexpression of the PsSWEET1a and PsSWEET17b genes in plum fruits, which significantly impacted their soluble sugar content. Heterologous expression of PsSWEET1a and PsSWEET17b in tomato resulted in an increase in soluble sugar content due to the modulation of sugar accumulation-related genes and enzyme activities.

Conclusion

The genes PsSWEET1a and PsSWEET17b, which regulate the content of soluble sugar in plum fruit, were successfully identified. This study provides a comprehensive insight into the SWEET gene family of plum, offering novel perspectives on the regulation of sugar accumulation in fruit and laying a critical foundation for further enhancement of plum fruit quality.

Supplementary Information

The online version contains supplementary material available at 10.1186/s12870-025-06407-y.

Keywords: SWEET gene family, Sugar accumulation, Fruit, ‘Fengtang’ plum

Introduction

As the main product of photosynthesis, sugars serve as a carbon and energy source for plant growth and development [1], and are crucial for fruit development and quality [2]. Numerous studies have explored fruit sugar accumulation and “source-sink” sugar transport pathways, in which photosynthetic products exported from source leaves of higher plants travel through the phloem long-distance transport system before reaching fruit cells [3], providing energy for cell metabolism or accumulating in cells, and these processes are inseparable from the participation of sugar transporters [4]. The distribution of carbohydrates is critical for crop yield. Therefore, exploring the SWEET function in plants is of great significance. To date, three types of sugar transporters have been identified: monosaccharide transporters (MSTs), sucrose transporters (SUTs), and bidirectional sugar transporters (SWEETs), categorized based on the types of sugars they transport [5–7].

The Sugars Will Eventually be Exported Transporters (SWEETs) family consists of key transporters that play essential roles in sugar transport pathways [8]. The first member of the SWEET family, MtN3, was first identified in Medicago truncatula [9]. SWEET proteins possess seven transmembrane helices and are recognized as a novel group of sugar transporters that facilitate the bidirectional transport of sugars, including glucose, fructose, and sucrose. They are present in a wide range of plant genomes [10]. Biochemical and functional analyses have demonstrated that SWEET proteins are involved in various metabolic and physiological processes in plants, including phloem loading [11], nectar secretion [12], pollen development [13], bacterial infection [14], aging [15], seed filling, and transportation [7].

In plants, the SWEET gene family plays an important role in sugar accumulation by regulating the transmembrane transport of molecules such as sucrose, glucose, and fructose. In tomato, the gene SlSWEET1a was found to play a role in glucose outflow from mature leaves to young leaves [16]; similarly, OsSWEET7 in rice has galactose transport activity [15]. In apples, molecular markers have identified MdSWEET9b and MdSWEET15a as key genes for sugar accumulation in fruits, regulating sugar content in fruits [17]. In addition, the gene AtSWEET16 in Arabidopsis transfers glucose from the vacuole to the cytoplasm at low temperatures [18], and AtSWEET17 is responsible for fructose transport in the vacuole [19]. Therefore, the SWEET gene family plays a decisive role in fruit sugar accumulation and the transport of sugars between source and reservoir organs. Sucrose is the main form of carbon transported from source to reservoir, which is important for sugar accumulation in fruits, and certain SWEET proteins can specifically transport sucrose [20]. PuSWEET15 shows a significant positive correlation with sucrose concentration. Sucrose content increased after the overexpression of PuSWEET15 in pear fruits, while sucrose content decreased after silencing, demonstrating its impact on sucrose accumulation in pear fruits [21]. GmSWEET10a and GmSWEET10b transport sucrose in soybeans, distributing sugars between the seed coat and embryo, thereby determining oil and protein content and seed size [22]. These studies highlight the role of the SWEET gene family in fruit sugar accumulation.

The ‘Fengtang’ plum is a regionally distinctive variety in Guizhou, known for its unique flavor, which is primarily due to its high sugar content [23]. Our team conducted a preliminary investigation into the physiological and molecular mechanisms of sugar accumulation in plum fruit [24], revealing the impact of the SWEET gene family on sugar accumulation. Therefore, a more comprehensive characterization of the SWEET gene family members was necessary to elucidate their role in sugar accumulation in plum fruit. This study identified members of the SWEET gene family within the entire genome of Prunus salicina plum and analyzed their expression patterns at different developmental stages through RNA-seq. Subsequently, the role of the SWEET genes in sugar accumulation in plum fruit was further clarified through transient expression in plum fruit and genetic transformation in tomato. This study enhances our understanding of the mechanisms behind plum sugar accumulation and provides a theoretical foundation for future enhancements to fruit quality, as well as potential increases in soluble sugar levels within plum fruit.

Materials and methods

Plant materials

All the plum germplasm used in this study was preserved at the ‘Fengtang’ plum base in Huishui County, Guiyang City, Guizhou Province, China. Material 1: The six-year-old ‘Fengtang’ plum tree was selected for the experiment. Samples were collected from 30 days to 110 days after flowering ‘Fengtang’ plum from April (average temperature 8–22℃, relative humidity 40–86%) to July (average temperature 24–33°, relative humidity 48–75%) 2023, with samples taken every 10 days. Nine fruits of uniform size were selected for each treatment, then stored at ultra-low temperatures. Various tissues and organs, including blooming flowers, functional leaves, roots, and fruit stalks, were also collected. Material 2: VIGS and transient overexpression tests of PsSWEET1a and PsSWEET17b were performed on 90 disease-free, uniformly growing fruits from nine plum trees. A 1 mL suspension was slowly injected into the equatorial region of the live plum fruit. Simultaneously, samples for RNA extraction and sugar composition analysis were taken from the pulp 0.5 cm from the injection site. The collected plums were peeled, cored, mixed, and quickly frozen with liquid nitrogen (-196℃), then stored in an ultra-low temperature freezer (-80℃) for RNA extraction and biochemical analysis. Material 3: Tomato (Solanum lycopersicum L. ‘Micro-Tom’) was provided by Wuhan Boyuan Company. Mature leaves from T2 plants and transgenic tomato fruits at the red ripening (RR) stage were collected to measure sugar content and analyze gene expression. At each sampling site, at least three fruits (excluding transgenic strains) or three mature leaves (from the same location on each plant) were randomly selected and collected together. All samples were immediately frozen in liquid nitrogen and kept at -80℃ until analysis was performed.

Determination of sugar content and enzyme activity

The contents of fructose, glucose, sucrose, and sorbitol in plum fruit were determined using high-performance liquid chromatography (HPLC) [25]. The activities of CWINV, VINV, NINV, SUSY, and SPS were determined using enzyme-linked immunosorbent assay (ELISA). The ELISA kit was obtained from Shanghai Zike Biotechnology Co., Ltd.

Identification of SWEET gene family and chromosomal localization of ‘fengtang’ Plum

The genome sequences of Prunus salicina Lindl. were obtained from the Rosaceae Genome Database (https://www.rosaceae.org/). Two methods were used to identify members of the SWEET family in ‘Fengtang’ plums: hidden Markov model search (HMMER) (http://pfam.xfam.org/) and BLASTp search using the MtN3/Saliva domain (PF03083) from the PFAM database, downloaded from the TAIR database (https://www.arabidopsis.org/) using Arabidopsis thaliana with an E-value < 1.0 as the query. The obtained candidate protein sequences were submitted to PFAM (http://pfam.xfam.org/) to verify the structure of the MtN3/Saliva domain. The SWEET genes identified from the Prunus salicina genome and those screened from the ‘Fengtang’ plum RNA-seq data (determined by Professor Huaming An’s research group at Guizhou University) were used as criteria for selecting candidate SWEET gene family members. ProtParam tools (http://www.expasy.org/tools) were used to analyze the physical and chemical properties of SWEET genes, including molecular weight and theoretical isoelectric point. Plant-mPLoc was used for subcellular localization prediction (http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/). The chromosomal locations of SWEET genes in Prunus salicina were identified from the genome database (https://www.rosaceae.org/). The positions of SWEET genes on the chromosomes of Prunus salicina were mapped using TBtools software (v1.113) [26] and used for collinearity analysis within the species.

Phylogenetic analysis of the SWEET gene family in Arabidopsis thaliana,Prunus persica,Prunus avium, and ‘fengtang’ Plum

The Arabidopsis thaliana genome was downloaded from the TAIR database (https://www.arabidopsis.org/), and Prunus persica and Prunus avium SWEET protein sequences were obtained from the NCBI database (https://www.ncbi.nlm.nih.gov/guide/). MEGA 7 was used to construct the phylogenetic tree of the SWEET gene family with the following parameters: multiple alignments of SWEET protein sequences were generated using Clustal W, and the evolutionary tree was constructed using 1000 bootstrap replicates based on the neighbor-joining (NJ) method. The resulting file was submitted to the EvolView V2 website (http://www.evolgenius.info/evolview/) to visualize the evolutionary tree.

Conserved motif and gene structure analysis of SWEET genes in ‘fengtang’ Plum

TBtools v1.113 was used to map the exon–intron structure of the SWEET gene family members. The MEME online tool (https://meme-suite.org/meme/tools/meme) was used to predict highly conserved SWEET sequences, and TBtools was used for visualization.

Sequence and protein structure analysis of the SWEET gene family in ‘fengtang’ Plum

Online tool TMHMM (https://services.healthtech.dtu.dk/service.php) was used to predict the transmembrane domain of SWEET proteins, and MTN3/salivary predictive structure analysis of SWEET proteins was performed using TBtools v1.113.

Construction of the expression vector

Using primers (forward: 5’-GAGTAAGGTTACCGAATTCCAGTTCTCAGGCATTCCGTAT (EcoR I)-3’, reverse: 5’-TGAGCTCGGTACCGGATCCCTTGGTTCTGATCACTGTGC (BamH I)-3’), we amplified a 357 bp cDNA fragment of PsSWEET1a (112–468 bp); Using primers (forward: 5’-GAGTAAGGTTACCGAATTCCAAATAGCGTGCTGGTG (EcoR I)-3’, reverse: 5’-TGAGCTCGGTACCGGATCCCAAGAATGGCATAGAGTGTC (BamH I)-3’), we amplified a 360 bp cDNA fragment of PsSWEET17b (187–547 bp). The pTRV2 construct was prepared and digested with EcoR I and BamH I, and the vector and amplified fragment were ligated using the pEASY-Basic Seamless Cloning and Assembly Kit (TransGen Biotech, Beijing, China). Agrobacterium transformation was then performed. Agrobacterium strain GV3101 containing pTRV1, pTRV2, or the pTRV2 derivative pTRV2-PsSWEET1a/PsSWEET17b was used for virus-induced gene silencing (VIGS). The full-length open reading frames of PsSWEET1a and PsSWEET17b were amplified from the cDNA of ‘Fengtang’ plum. Primers with restriction sites were designed using SnapGene software. For transient overexpression of PsSWEET1a, the primers were: forward 5’-GAACACGGGGGACGAGCTCGGTACCATGCATATTCTCAAGGTCTTCTTTGG (Kpn I)-3’, reverse 5’-GCCAAATGTTTGAACGATCCTGCAGCTAGGGCTGCCCATCTTG (Pst I)-3’; For transient expression of PsSWEET17b, the primers were: forward 5’-GAACACGGGGGACGAGCTCGGTACCATGGCAATAAATTTCGTTGTCATTTTTGG (Kpn I)-3’, reverse 5’-GCCAAATGTTTGAACGATCCTGCAGTCACTCTGCAATGATGGGTTTTGAAG (Pst I)-3’. The overexpression construct pCambia1301-GFP was prepared, and the plasmid was isolated and digested with restriction enzymes Kpn I and Pst I. The digested vector and amplified fragment were ligated using the pEASY-Basic Seamless Cloning and Assembly Kit (TransGen Biotech, Beijing, China), and then transformed into Agrobacterium. Agrobacterium strain GV3101 containing pCambia1301-GFP or the pCambia1301-GFP derivative pCambia1301-GFP-PsSWEET1a/PsSWEET17b was used for transient gene overexpression.

RNA extraction and qRT-PCR validation

Total RNA was extracted from the samples using a polysaccharide and polyphenol plant total RNA extraction kit (Tian Gen, Beijing, China), and genomic DNA contamination was removed using DNase I (Takara, Dalian, China). Complementary DNA (cDNA) was synthesized using the PrimeScript RT reagent kit with gDNA Eraser (Takara, Dalian, China) according to the manufacturer’s instructions. Amplification was performed using the Applied Biosystems StepOnePlus Real-Time PCR system (Life Technologies Corporation, Carlsbad, CA, USA) in a total volume of 20 µL. The reaction mixture contained: TB Green Premix (2X) 10 µL; upstream primer (10 µmol/L) 0.4 µL; downstream primer (10 µmol/L) 0.4 µ; template 2 µL; ddH₂O 7.2 µL. Candidate gene primers were designed using Primer5, and the clathrin adaptor complex medium subunit family protein (CAC) was used as the internal reference gene [27]. The tomato housekeeping gene ACTIN was used as an internal control (Table S1). The primers were synthesized by Shanghai Shenggong Biotechnology Co., Ltd. The following conditions were used for the PCR procedures: pre-denaturation at 94℃ for 30 s, 94℃ for 5 s, 58℃ for 30 s, 72℃ for 1 min, for 40 cycles; final extension at 72℃ for 10 min. Three biological replicates were performed per sample. Relative quantitative analysis of the data was performed using the 2^−△△CT method.

Subcellular localization of PsSWEET1a and PsSWEET17b proteins

The coding regions of the PsSWEET1a and PsSWEET17b genes (without stop codons) with Kpn I and Pst I restriction sites were cloned into a pCAM35-GFP expression vector. The resulting constructs were then transformed into Agrobacterium tumefaciens strain GV3101 and used to infect Arabidopsis protoplasts. After 3–4 weeks, Arabidopsis seedlings were soaked in an enzymatic solution, vacuum infiltrated, and subjected to enzymatic hydrolysis at 23 °C for 3 h under low light. The protoplasts were filtered through 40 μm nylon mesh, washed several times with W5 solution, and diluted. For transfection: 10 µL target gene plasmid + 10 µL marker gene plasmid + 100 µL protoplast + 120 µL 40% PEG4000 solution. The mixture was gently inverted in a 22.5 °C water bath for 15–20 min. The protoplasts were then diluted with W5 solution, washed, centrifuged twice, resuspended in W5 solution, and cultured overnight at 23 °C under low light. Laser confocal microscopy (Laser confocal microscopy, Nikon, A1 HD25) was used for observation and imaging.

Genetic transformation of tomato

The CDS sequence of the candidate gene was cloned into the pCAMBIA-1301 vector after the removal of the stop codon. The recombinant plasmid was transformed into Agrobacterium strains by electroporation and preserved at -8℃. The method for Agrobacterium-mediated genetic transformation was as follows: Tomato (Solanum lycopersicum L. ‘Micro-Tom’) seeds were disinfected and grown in a sterile environment. The seeds were cultured in the dark for 3 days before being transferred to light. Remove the root, take the cotyledon with the backside up, and culture in darkness on KCMS solid medium with filter paper. Cotyledons were immersed in an Agrobacterium suspension containing 35 S::PsSWEET1a or 35 S::PsSWEET17b constructs, shaken for 2 min, and the bacterial suspension was poured out. The cotyledons were blotted dry with sterile filter paper to remove residual liquid, then returned to KCMS solid medium for 2 days in the dark. The cotyledons were then placed on co-culture medium and incubated in darkness for 3 days. The cotyledons were cleaned with cephalosporins and transferred to a screening medium under light conditions until callus formation. When the seedlings reached 4–5 cm in height, they were transferred to rooting medium. After 3 weeks of rooting, the seedlings were transplanted into the growing medium. Both wild-type and transgenic tomato plants were grown in greenhouses with a 16-hour/8-hour light/dark cycle, a temperature of 25 °C, and a relative humidity of 50–70%. The transgenic lines were verified by PCR. T2 transgenic tomato plants were used for analysis.

Statistical analysis

Data are expressed as mean ± SD (standard deviation). SPSS (v27, IBM, Armonk, NY) was used for significance testing, and the Student’s t-test was applied. The Pearson correlation coefficient (r) was used to analyze the correlation. Line charts were generated using Origin 9.0, and heat maps were produced using TBtools software.

Results

Identification and characterization of SWEET gene family members in ‘fengtang’ Plum

According to the Pfam database (ID: PF03083), 18 SWEET members were identified by combining the transcriptome with the genome of Prunus salicina Lindl. The physicochemical properties of the members of the SWEET gene family were determined via the online website ProtParam (Table. S2). The 18 SWEET genes varied in length, ranging from 364 bp (PsSWEET1c) to 901 bp (PsSWEET10 and PsSWEET12), and encoded amino acids ranging from 120 to 293. The molecular weight ranged from 13,595.40 Da (PsSWEET1c) to 33,080.55 Da (PsSWEET10 and PsSWEET12). The theoretical isoelectric points (pIs) of the presumed SWEET family members ranged from 5.97 (PsSWEET10/12) to 9.68 (PsSWEET1a), with 16 members having pIs higher than 7.0, indicating that these proteins were weakly alkaline, while PsSWEET10 and PsSWEET1c were acidic. Further analysis of the presumed subcellular localization revealed that SWEETs were located in the cell membrane. The TMHMM software was used to predict the transmembrane regions of SWEETs. The encoding proteins of 13 members had seven transmembrane regions. Two members had five transmembrane regions. PsSWEET1b/1c had only two or three transmembrane regions. Ten SWEET proteins (PsSWEET1a/1b/1c/2b/5d/10/14/17a/17b/17c) had an instability index of more than 40, indicating that they were not stable. The hydrophilicity of plum SWEET proteins was greater than 0, indicating that they were hydrophobic proteins.

Thirteen SWEET genes were distributed on five chromosomes (LG 01, LG 02, LG 03, LG 04 and LG 08), and five SWEET genes were located on the unplaced scaffolds Contig 1 and Contig 20. Among these chromosomes, LG 08 has up to six SWEET genes, including PsSWEET1a,PsSWEET1b,PsSWEET1c,PsSWEET5a,PsSWEET5b, and PsSWEET14. In addition, LG 03, LG 02, and LG 04 each have two SWEET genes, while LG 01 has only one SWEET gene on its chromosome (Fig. 1A). Gene duplication events the amplification of gene family members in the process of plant evolution plays an important role (Fig. 1B). Intra-species collinearity analysis showed that there were 3 collinear gene pairs, PsSWEET2a and PsSWEET2b fragment repeat events. PsSWEET1b and PsSWEET1c,PsSWEET5a and PsSWEET5b are thought to have evolved from tandem repeating events.

Fig. 1 — Chromosome localization and collinearity analysis in *SWEET* genes. (A) The relative locations of *SWEET* genes are marked on the chromosomes. Chromosome numbers are displayed on the left side of each chromosome, and a ruler on the left shows the physical distance of the chromosomes. (B) Collinearity analysis of *SWEET* genes. Gray lines represent all the syntenic blocks in the *Prunus salicina* Lindl. genome, and the red lines represent duplicated *SWEET* gene pairs

Phylogenetic tree analysis of SWEET genes in Arabidopsis thaliana,Prunus persica,Prunus avium, and ‘fengtang’ Plum

To explore the phylogenetic relationships among SWEET gene family members in plants, we analyzed 17 SWEET genes from Arabidopsis thaliana, 19 from Prunus persica L., 13 from Prunus avium L., and 18 from ‘Fengtang’ plum. The amino acid sequences of 67 SWEET proteins were compared, and an evolutionary tree was constructed (Fig. 2; Table S3). Based on studies of AtSWEET in Arabidopsis thaliana, the SWEET members of these four species were divided into four subfamilies (I, II, III, and IV). The majority of PsSWEET members in ‘Fengtang’ plum were grouped in subfamily II, with 6 PsSWEET members; subfamily I followed with 5 PsSWEET members; and there were 4 and 3 PsSWEET proteins in subfamilies III and IV, respectively. As shown by the evolutionary tree, most ‘Fengtang’ plum SWEET genes were more closely related to those in Prunus persica than to those in Prunus avium and Arabidopsis thaliana.

Fig. 2 — Phylogenetic relationship among *Arabidopsis thaliana,Prunus persica,Prunus avium* and ‘Fengtang’ plum. Based on the analysis of *PsSWEET* members in *Arabidopsis thaliana*, 18 *PsSWEET* are divided into four branches, labeled I, II, III, and IV, denoted by yellow, orange, pink, and blue, respectively. In the image, *Arabidopsis thaliana* is represented by a green circle; *Prunus persica* by a purple square; *Prunus avium* by a white star and the ‘Fengtang’ plum by a red triangle

Sequence and motif analysis of SWEET genes in ‘fengtang’ Plum

We constructed a phylogenetic tree using 18 PsSWEET proteins in ‘Fengtang’ plum and divided them into four classes (Fig. 3A), consistent with the results in Fig. 1. Nine highly conserved motifs were identified in PsSWEET proteins (Fig. 3B and D). PsSWEET1b and PsSWEET5a contained the fewest conserved motifs, with only four, while PsSWEET4 and PsSWEET5d contained nine motifs each. Motifs 2, 3, and 6 were present in all PsSWEET proteins. Introns, a characteristic feature of eukaryotic genes, provide genetic diversity through alternative splicing (Fig. 3C). Exon-intron structure analysis revealed that most PsSWEET genes had five or six exons, while PsSWEET1c contained only three exons and PsSWEET17c contained seven exons.

SWEET proteins in plant species contain seven transmembrane (TM) helices, and the presence of these seven TM regions in all SWEET members suggests that SWEET proteins function as membrane receptor proteins. Conserved domain analysis using NCBI-CDD confirmed that all SWEET proteins contained 1–2 MtN3/saliva domains (CDD accession No. pfam03083) or PQ-loop superfamily domains (CDD accession No. cl21610). These MtN3/saliva domains ranged from 70 to 91 amino acids, with most being approximately 85 amino acids in length. The positions of the MtN3/saliva domains in the protein are shown in Fig. S1. To obtain more detailed information about the PsSWEET1a and PsSWEET17b proteins, we performed multiple sequence alignments with SWEET sugar transporters from Arabidopsis thaliana. The results indicated that the conserved domains of PsSWEET1a and PsSWEET17b were highly consistent with those of the SWEET proteins in Arabidopsis thaliana, supporting their role in sugar transport (Fig. S2).

Analysis of cis-acting elements in SWEET genes

Cis-acting elements were analyzed in the 2 kb upstream sequences of SWEET genes (Fig. 4), and the results indicated that the cis-acting elements of the 18 SWEET members could be classified into five categories: plant hormone response elements, light response elements, plant growth and development-related elements, abiotic stress response elements, and transcription factor recognition and binding sites. Among these, light response elements constituted the highest proportion. Additionally, component analysis revealed that PsSWEET1a contains 6 photoresponsivity elements, 2 MeJA-responsive elements, 1 MYB-responsive element, and 1 gibberellin-responsive element. The PsSWEET17b gene contains 16 light-responsive elements, 1 MYB-responsive element, and 1 low-temperature-responsive element.

Analysis of SWEET gene expression patterns during the development of ‘Fengtang’ plum fruit based on RNA-seq.

Candidate genes were identified from transcriptome data using standard gene names and synonyms in functional annotations. A total of 18 SWEET genes showed different expression patterns (Fig. 5A). Among them, PsSWEET1b,1c,5d,5c,6,9, and 12 were not expressed at any of the three stages of fruit development. PsSWEET2a,4,10,14, and 17a expression gradually decreased with fruit ripening, while PsSWEET1a,2b,17b, and 17c expression steadily increased. PsSWEET5a showed high expression early in development. By combining RNA-seq data and metabolome data (Fig. 5B), SWEET genes highly correlated with plum sugar accumulation were identified as PsSWEET1a,2a,2b,4,7a,10, and 17b.

Fig. 5 — Analysis of the expression and correlation of *PsSWEET* genes in ‘Fengtang’ plum fruit based on RNA-seq and targeted metabolomics. RNA-seq and targeted metabolomics data were sampled from April (average temperature 8–18°, relative humidity 54–85%) to July (average temperature 21–28°, relative humidity 46–80%) 2021. (A) Heatmap of *SWEET* genes expression profile in ‘Fengtang’ plum fruit. Different colors represent standardized processing values for relative expression levels, ranging from low (blue) to high (orange). (B) Correlation analysis of *SWEET* genes and corresponding sugar components. High correlation corresponds to orange, low correlation corresponds to blue

qRT-PCR validation of SWEET genes during the development of ‘fengtang’ Plum fruit

To verify the reliability of the RNA-seq data, seven SWEET genes were selected for qRT-PCR verification. The gene expression patterns of these SWEETs in qRT-PCR exhibited trends consistent with the FPKM values observed in the RNA-seq data (Fig. 6A and B), indicating the reliability of the transcriptomic data. To investigate the relationship between SWEET gene expression and sugar accumulation, we further analyzed the correlation between SWEET gene expression and sugar components (Fig. 6C). PsSWEET1a,2b,10, and 17b exhibited a strong positive correlation with sucrose and sorbitol, whereas PsSWEET4,2a, and 17a displayed a strong negative correlation with these sugars. The expression of these genes was closely associated with sucrose and sorbitol content. These results suggest that SWEET genes may play a role in sugar accumulation during the development of ‘Fengtang’ plum.

Expression and correlation analysis of *SWEET* genes in ‘Fengtang’ plum fruit. (A) *SWEET* gene expression was verified by qRT-PCR analysis. The left Y-axis is the relative expression value of *SWEET* gene, and the expression amount of 30DAA samples is calculated as 1 (which can be seen in Fig. 6B), and the right Y-axis is FPKM. The error bars represent the standard deviation of three independent bioassays. Different uppercase letters showed significant differences in qRT-PCR p ≤ 0.05, and different lowercase letters showed significant differences in RNA-seq p ≤ 0.05. The error bar represents the standard deviation of the three biological replicates. (B) Heatmap of *SWEET* gene expression profiles in developing ‘Fengtang’ plum fruit. Different colors represent standardized processing values for relative expression levels, ranging from low (blue) to high (orange). (C) Correlation analysis of selected *SWEET* gene and corresponding sugar components. High correlation corresponds to orange, low correlation corresponds to blue

Expression profiles of SWEET genes in different ‘fengtang’ Plum tissues and organs

To study the influence of SWEET genes on ‘Fengtang’ plum fruit development, we extracted RNA from various plum tissues and performed qRT-PCR. Seven SWEET genes were detected in seven tissues (Fig. 7). Most SWEET genes were expressed across the tissues and organs of the ‘Fengtang’ plum, but their expression levels varied. PsSWEET1a showed the lowest transcript levels in roots and leaves, while PsSWEET2a,10, and 17a exhibited the highest transcript abundance in leaves. The expression levels of PsSWEET1a and 4 were dominant in flower organs compared to other tissues, suggesting that they may play a role in flower development. Additionally, PsSWEET1a and PsSWEET17b exhibited similar expression patterns during fruit development and were highly expressed in fruit, suggesting their involvement in sugar accumulation in ‘Fengtang’ plum fruit.

Fig. 7 — The relative expression levels of 7 *PsSWEET* genes in different tissues of ‘Fengtang’ plum were analyzed by real-time fluorescence quantitative PCR with the expression level of 1 in leaves. The horizontal coordinates from left to right are leaf, fruit, root, stalk, ovary, receptacle and petal. Different letters indicate significant differences. The error bar represents the standard deviation of the three biological replicates

Subcellular localization of PsSWEET1a and PsSWEET17b

To further investigate the potential role of PsSWEET1a and PsSWEET17b in soluble sugar accumulation in plum fruit, we analyzed their subcellular localization. PsSWEET1a-GFP and PsSWEET17b-GFP fusion constructs were transiently expressed under the control of the CaMV35S promoter in Arabidopsis thaliana protoplasts (Fig. 8). The PsSWEET1a-GFP construct was co-expressed in Arabidopsis protoplasts with a nuclear marker protein (SV40 NLS). Fluorescent signals revealed that PsSWEET1a was localized to the nucleus and cytoplasm. The PsSWEET17b-GFP construct was co-expressed in Arabidopsis thaliana protoplasts with a cell membrane marker protein (OsRac3), and the GFP fluorescence signal was observed on the vacuolar membrane (Fig. 8d). This signal was distinct from those of chloroplasts (Chlorophyll) and the cell membrane marker OsRac3-mCherry, confirming that PsSWEET17b is localized to the vacuolar membrane.

Fig. 8 — Subcellular localization of green fluorescent protein (GFP) fusion proteins of *PsSWEET1a* and *PsSWEET17b* in *Arabidopsis thaliana* protoplasts. (a) 35 S-GFP, red marked by nuclear Marker: SV40 NLS, green marked by GFP signal. (b) 35 S::*PsSWEET1a*-GFP. (c) 35 S-GFP, marked in red by cell membrane Marker: OsRac3, marked in green by GFP signal. (d) 35 S::*PsSWEET17b*-GFP. Scale bar = 10 μm

Functional characterization of PsSWEET1a and PsSWEET17b in ‘fengtang’ Plum fruit

To further investigate the role of PsSWEET1a and PsSWEET17b in sugar accumulation in plum fruit, recombinant VIGS-SWEETs and OE-SWEETs vectors were infiltrated into live fruit using Agrobacterium-mediated fruit injection (Fig. 9A). In the control fruit (VIGS), significant impregnation of sugar was observed, whereas only weak impregnation of sugar was noted in VIGS-PsSWEET1a and VIGS-PsSWEET17b. Conversely, the control fruit (CK) exhibited weak impregnation of sugar, while OE-PsSWEET1a and OE-PsSWEET17b showed significant impregnation of sugar (Fig. 9B).

Fig. 9 — Functional analysis of *PsSWEET1a* and *PsSWEET17b* in ‘Fengtang’ plum, respectively. (A) Location of injected fruit (left) and cross-section (right). (B) Silenced and overexpressed fruit phenotypes were observed in flesh: CK (silenced by injection of no-load TRV1 and TRV2, overexpressed by injection of no-load pCAMBIA1301), VIGS-*PsSWEET1a*, VIGS-*PsSWEET17b*, OE-*PsSWEET1a*,and OE-*PsSWEET17b* showed different degrees of impregnation of sugar. (C) Expression levels of *PsSWEET1a* and *PsSWEET17b.* (D) Soluble sugar content in fruit after gene silencing. (E) Expression levels of *PsSWEET1a* and *PsSWEET17b.* (F) Soluble sugar content in fruit after gene overexpression. (G) Relative expression levels of genes related to sugar accumulation in fruit after silencing *PsSWEET1a* and *PsSWEET17b*. (H) Relative expression levels of genes related to sugar accumulation in fruit after overexpression *PsSWEET1a* and *PsSWEET17b.* The error bar represents the standard deviation of the three biological replicates. “*”, “**” and “***” indicate significant differences at p < 0.05, 0.01 and 0.001, respectively

To confirm that PsSWEET1a and PsSWEET17b expression was inhibited at the molecular level, qRT-PCR analysis was performed on the silenced and control fruit. When PsSWEET1a and PsSWEET17b were silenced in ‘Fengtang’ plum fruit, their expression levels were significantly lower than in the control group (Fig. 9C). Soluble sugar components were also measured, revealing that sucrose, fructose, glucose, and sorbitol contents were significantly reduced in comparison to the control (CK) (Fig. 9D). Notably, sucrose content in PsSWEET1a- and PsSWEET17b-silenced fruit was reduced from 34.14 mg/g to 13.01 mg/g and 12.50 mg/g, respectively, representing decreases of 61.9% and 63.4% compared to the control (CK). Additionally, the expression levels of sugar metabolism-related genes PsSPS2,PsSUS4, PsINV3, and PsINV4 were significantly reduced in the silenced fruits (Fig. 9G). Transient overexpression of PsSWEET1a and PsSWEET17b in ‘Fengtang’ plum fruit was achieved using Agrobacterium tumefaciens-mediated transformation, with an empty vector pCAMBIA1301 as the control (CK). Higher expression levels of PsSWEET1a and PsSWEET17b were detected compared to the CK (Fig. 9E). Correspondingly, higher concentrations of sucrose, fructose, and glucose were observed compared to the CK (Fig. 9F). The expression of PsSPS2,PsSUS4,PsINV3, and PsINV4 in fruits overexpressing PsSWEET1a and PsSWEET17b was significantly higher than in the CK (Fig. 9H). These results suggest that changes in PsSWEET1a and PsSWEET17b expression may affect the content of sucrose, glucose, and fructose by altering the expression levels of genes involved in sugar metabolism in ‘Fengtang’ plum.

Overexpression of PsSWEET1a and PsSWEET17b altered the phenotype and sugar content of tomato plants

To further understand the regulatory role of PsSWEET1a and PsSWEET17b in sugar accumulation, we expressed these genes heterologously in tomato plants and obtained four homozygous lines (OE1a-L8, OE1a-L15, OE17b-L4, and OE17b-L13). Wild-type Micro-Tom plants were used as a negative control (WT). Target bands were detected in all four transgenic lines (Fig. S3), indicating that PsSWEET1a and PsSWEET17b were successfully inserted into the tomato genome. Compared to WT plants, the transgenic tomato plants showed no significant changes in fruit size or vertical and horizontal length. However, the transgenic plants exhibited a significant dwarfing phenotype, characterized by reduced height, stem diameter, and internode length (Fig. 10; Table S4). These results suggest that overexpression of PsSWEET1a and PsSWEET17b can induce specific phenotype changes in tomato plants.

Fig. 10 — Phenotypic comparison between wild type (WT) and transgenic tomato plants. (A) Phenotypes of ripe fruits from WT and transgenic tomato lines; The scale corresponds to 2 cm. (B) Phenotypes of plant structure in WT and transgenic tomato plants. The transgenic lines that overexpressed *PsSWEET1a* were OE1a-L8 and OE1a-15. The transgenic lines that overexpressed *PsSWEET17b* were OE17b-L4 and OE17b-L13

To further confirm the transcription levels of PsSWEET1a and PsSWEET17b in the fruits of transgenic strains, we performed quantitative real-time PCR (qRT-PCR) analyses (Fig. 11A, B). qRT-PCR confirmed high transcription levels in the four overexpressing transgenic lines OE1a-L8, OE1a-L15, OE17b-L4, and OE17b-L13 in red ripe fruit (RR). We analyzed the concentrations of soluble sugars (fructose, glucose, and sucrose) in tomato leaves overexpressing PsSWEET1a or PsSWEET17b (Fig. 11C). Compared to WT, sucrose content in the tomato leaves of transgenic lines OE1a-L15 and OE17b-L13 was significantly increased. Only transgenic line OE17b-L4 showed an increase in fructose levels, while the other transgenic lines showed no significant change. In the fruit tissue of RR, the content of soluble sugars (sucrose, fructose, and glucose) was significantly increased in all overexpressing lines compared to WT (Fig. 11D). Sucrose levels in fruit increased by 25.36%, 20.28%, 45.84%, and 33.17%. Fructose and glucose levels increased by 14.39–24.43% and 4.85–12.41%, respectively.

Fig. 11 — Analysis of relative expression levels and sugar content between WT and transgenic tomato fruits. (A) Analysis of relative expression levels of *PsSWEET1a* in red ripe tomato fruits between WT and transgenic tomato plants. (B) Analysis of relative expression levels of *PsSWEET17b* in ripe tomato fruits between WT and transgenic tomato plants. The expression data of wild type (WT) plants were used as a control. (C) Changes in the content of sugar components in mature leaves between WT and transgenic tomato plants. (D) Changes in the content of sugar components in ripe tomato fruits between WT and transgenic tomato plants. The error bars represent the standard deviation of the three biological replicates. “*”, “**”, and “***” indicate significant differences at p < 0.05, 0.01, and 0.001, respectively

We studied both gene transcription and enzyme activity related to sugar metabolism to better understand changes in sucrose, fructose, and glucose content. We analyzed specific genes involved in tomato sugar metabolism, including sucrose synthase (SISUS4), hexokinase (SIHXK), invertase (SIINV5 and SIINV6), sucrose phosphate synthase (SISPS), and fructokinase (SIFK). Transcription levels of all sugar-metabolizing genes were upregulated in transgenic lines compared to WT (Fig. 12A). To further understand the increase in sucrose, fructose, and glucose content in transgenic lines, we measured enzyme activities related to sugar metabolism. As shown in Fig. 12B, the activity changes of the three types of invertases (cell wall invertases, neutral invertases, and vacuolar invertases) were distinct. The activity of cell wall invertase (CWINV), which is involved in sucrose breakdown, was significantly increased in ripe tomato fruits of transgenic lines compared to WT. The activities of neutral invertase (NINV) and vacuolar invertase (VINV) were significantly decreased. The activities of sucrose phosphate synthase (SPS) and sucrose synthase (SUSY), both involved in intracellular sucrose synthesis, were significantly increased (Fig. 12B). These findings suggest that PsSWEET1a and PsSWEET17b regulate sucrose metabolism by modulating the expression of specific genes involved in sucrose degradation and synthesis, as well as by influencing related enzyme activities.

Fig. 12 — Relative expression levels and enzyme activity of genes related to sugar accumulation in the ripe fruits of transgenic tomato plants overexpressing *PsSWEET1a* (OE1a-L8 and OE1a-L15) and *PsSWEET17b* (OE17b-L4 and OE17b-L13), respectively. (A) Relative expression levels of genes associated with sugar accumulation. (B) Enzyme activity determines ripe tomato fruit. CWINV cell wall invertase, NINV neutral invertase, VINV vacuole invertase, SUSY sucrose synthase (synthetic direction), SPS sucrose phosphate synthase. The data represent an average SDs of at least three biological replicates. “*”, “**” and “***” indicate significant differences p < 0.05, 0.01 and 0.001, respectively

Discussion

The PsSWEET gene family of ‘fengtang’ Plum

Sucrose, glucose, and fructose are the predominant soluble sugars in plum fruit. Their content is a crucial determinant of the quality of ‘Fengtang’ plums, significantly influencing flavor. Sugar transporters control the loading and unloading of sugars in the phloem of plant tissues and play a key role in plant growth and development by regulating the translocation of sucrose, glucose, and fructose across the plasma membrane [28]. To date, the SWEET gene family has been identified in numerous plant species, including Arabidopsis thaliana [29], rice [10], wheat [30], European grape [31], cucumber [32], kale [15], and apple [17]. In this study, 18 members of the SWEET gene family were identified in the genome of Prunus salicina Lindl., which differs from the 15 members reported by Jiang [33]. This difference may be attributed to the varying criteria used in identifying candidate genes. Alternatively, the number of gene families identified in the genomes of different varieties may be inconsistent [34]. Studies have shown that variations in gene size are often caused by intron insertion [35]. SWEET genes exhibit structural differences, with minor variations in exon number and significant variations in intron length. Thirteen members of the SWEET gene family are unevenly distributed across five chromosomes. Collinearity analysis revealed that SWEET gene duplication events occurred during the evolution of the SWEET gene family in plum. SWEET proteins structurally contain seven transmembrane helices (TMHs), of which four show low conservation and serve as linkers with the remaining three, forming a 3-1-3 structure [27]. The MtN3 subfamily is involved in glucose transport, while the PQ-loop subfamily is involved in amino acid transport [36, 37]. The conserved structure indicates that most SWEET proteins possess two MtN3 or PQ-loop superfamily domains, similar to most other plants. These results suggest that the SWEET gene family of plum is relatively conserved during evolution.

Expression and functional diversity of PsSWEET genes in ‘fengtang’ Plum

Plant SWEET genes exhibit tissue-specific expression patterns and are involved in various sugar transport processes [38, 39]. Differential expression analysis of SWEET genes in ‘Fengtang’ plum enabled us to identify the specialized functions of each SWEET protein in sugar accumulation. In this study, PsSWEET genes were expressed at varying levels in leaves, fruits, roots, stems, and flower organs, with PsSWEET1a and PsSWEET17b showing high expression levels in fruits. This suggests that these genes play a crucial role in sugar accumulation in fruits. The role of SWEET genes in storage organ function, particularly in fleshy fruits, has been increasingly highlighted in recent studies. Tian et al. [40] discovered that FanSWEET1,2a,3b,4c,5a,7a,9b, and 17a were predominantly expressed in leaves, while FanSWEET10a,14, and 15a were mainly expressed in fruits. Temporal and spatial expression analyses revealed that AnmSWEET5 and AnmSWEET11 are important in the development of pineapple fruit [41]. The distribution and transmembrane transport of sugars between source and sink organs are crucial for sugar accumulation in fruit. Previous studies have shown that members of the SWEET gene family are primarily localized to the plasma membrane [42]. However, other localization patterns have been observed, such as SWEET9 expression in the nectar gland and subcellular localization in the trans-Golgi network [43], as well as SWEET6 in the endoplasmic reticulum [44]. In this study, PsSWEET1a was localized to the nucleus and cytoplasm, representing a novel finding that suggests it may have dual roles in regulation and transport. Potential post-translational modification sites in SWEET proteins were identified using computational tools, indicating that SWEET transporters may be regulated by phosphorylation [45]. StSP6A specifically binds to StSWEET11, which blocks sucrose leakage to exosomes and promotes plastid sucrose transport [46, 47]. In vacuolar sugar storage, SWEET16 plays a crucial role as a fructose transporter within vacuoles [48]. Similarly, PsSWEET17b is located in the vacuolar membrane and is involved in intracellular sugar transport and accumulation, as well as in maintaining intracellular hexose homeostasis. These results suggest that the roles of PsSWEET1a and PsSWEET17b in sugar accumulation in Fengtang plum fruit warrant further investigation.

PsSWEET1a and PsSWEET17b participate in the accumulation of sugar in ‘fengtang’ Plum fruit

The SWEET gene family is among the most important sugar transporters, capable of enhancing the accumulation of sugar in fruit. Transient overexpression of PsSWEET1a and PsSWEET17b in Fengtang plum fruit resulted in an increase in soluble sugar content. Similar results were observed in loquat [49] and grape [50], further underscoring the important role of the SWEET gene family in enhancing fruit sweetness. The overexpression of VvSWEET10 enhanced hexose accumulation in grape callus and tomato fruit. Overexpression of MdSWEET12a and MdSWEET23 in apples led to a significant increase in sugar content. Silencing MdSWEET12a and MdSWEET23 was associated with a reduction in sugar content [11, 51]. In this study, we observed a decrease in the concentration of soluble sugar in ‘Fengtang’ plum fruit following the silencing of PsSWEET1a or PsSWEET17b. Conversely, overexpression of PsSWEET1a or PsSWEET17b exhibited the opposite trend. SWEET genes are more likely to be involved in the translocation of the sugars. These results suggest that PsSWEET1a and PsSWEET17b directly or indirectly regulate the change of soluble sugar content.

Heterologous expression of PsSWEET1a and PsSWEET17b altered sugar concentration and metabolism in tomato fruit

Altered expression of SWEET genes has been reported to affect plant height. For example, rice plants exhibit dwarfism compared to wild-type rice plants when OsSWEET14 is overexpressed [52]. In this study, we found that overexpression of PsSWEET1a and PsSWEET17b resulted in transgenic tomato plants exhibiting dwarfism and shorter internodes compared to wild-type plants, which may contribute to the observed increase in sugar content. Similarly, in tomatoes, SlSWEET7a and SlSWEET14 are key regulators of sucrose discharge from tomato fruits, and their silencing leads to reduced plant height [53]. In this study, heterologous overexpression of PsSWEET1a and PsSWEET17b in tomato significantly increased the sucrose, fructose, and glucose contents of tomato fruit. Previous studies have reported that silencing CWINV inhibitors leads to an increase in CWINV activity post-translation, resulting in elevated hexose levels in tomato fruits [54, 55]. In transgenic tomatoes, the expression of key CWINV protein-coding genes SlINV5 and SlINV6 was upregulated in tomato fruits, and the increase in CWINV activity in the cell wall space was consistent with the elevated fructose and glucose content in the fruit. Modifying a gene involved in sucrose metabolism often leads to corresponding changes in gene expression, ultimately affecting the plant’s sugar content. Ma et al. [56] found that the sucrose transporter MdSUT2 can affect the expression of sucrose metabolism genes. For example, overexpression of MdSWEET17a in tomato alters the expression of SlLin5,Fk1,Fk2, and other genes, thereby affecting the sugar content of the tomato [57]. In the current study, overexpression of PsSWEET1a and PsSWEET17b in Fengtang plum and tomato resulted in the upregulation of SUSY,INV, and SPS genes. In summary, our findings indicate that heterologous overexpression of PsSWEET1a and PsSWEET17b determines sugar content in fruit by modulating sugar transport, metabolism-related gene expression, and enzyme activity.

Conclusion

In this study, 18 candidate PsSWEET genes were identified, and the evolutionary relationships, conserved motifs, gene structure, and chromosome localization of these PsSWEET gene family members were characterized. PsSWEET1a and PsSWEET17b were highly expressed in ‘Fengtang’ plum fruits; PsSWEET1a was localized in the nucleus and cytoplasm, while PsSWEET17b was found in the vacuolar membrane. Transient overexpression of PsSWEET1a and PsSWEET17b in ‘Fengtang’ plum fruit and heterologous expression in tomato altered the expression of genes associated with sucrose metabolism, resulting in changes in soluble sugar content. These results strongly support the role of PsSWEET1a and PsSWEET17b in sugar accumulation in ‘Fengtang’ plum fruit and lay the groundwork for further elucidating the internal mechanisms of sugar transport mediated by the PsSWEET genes in ‘Fengtang’ plum fruit.

Electronic supplementary material

Below is the link to the electronic supplementary material.

12870_2025_6407_MOESM1_ESM.jpg^{(1MB, jpg)}

Supplementary Material 1: SWEETs sequence analysis.

12870_2025_6407_MOESM2_ESM.tif^{(1.2MB, tif)}

Supplementary Material 2: Homologous sequence alignment of PsSWEET1a and PsSWEET17b

12870_2025_6407_MOESM3_ESM.tif^{(2MB, tif)}

Supplementary Material 3: PCR detection of transgenic tomato plants.

Supplementary Material 4^{(10.9KB, xlsx)}

Supplementary Material 5^{(11.7KB, xlsx)}

Supplementary Material 6^{(17.2KB, xlsx)}

Supplementary Material 7^{(10.9KB, xlsx)}

Acknowledgements

We are grateful to Professor Huaming An(Guizhou University, China) for providing transcriptome, metabolome data sets and pCambia1301 and pTRV2 expression vectors.We thank Let Pub (www.letpub.com) for its linguistic assistance during the preparation of this manuscript.

Abbreviations

SUT: Sucrose transporter
TST: Tonoplast sugar transporter
SPS: Sucrose phosphate synthase
SUSY: Sucrose synthase
STP: Sugar transporter protein
INV: Invertase
HXK: Hexokinase gene
DAA: Days after flowering
qRT-PCR: Quantitative real time PCR
HPLC: High performance liquid chromatography
cDNA: Complementary DNA
SWEETs: Sugar Will Eventually be Exported transporters

Author contributions

H.C. constructed the project; H.C. and S.L. designed the experiments; S.L. X.S. and X.N. performed the experiments and analyzed the data; S.L. and X.S. wrote the paper. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by the Guizhou Science and Technology Plan Project (QKHBZ [2022] Key 018).

Data availability

The datasets supporting the conclusions of this article are available in the NCBI Bioproject repository, accession number: PRJNA968060 and was publicly released on May 7, 2024.

Ethics approval and consent to participate

Not applicable.

Consent for publication

Not applicable.

Competing interests

The authors declare no competing interests.

Footnotes

The original online version of this article was revised: the authors identified an error in Figure 2, unfortunately, Figure 2 and Figure 3 are the same.

Publisher’s note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Change history

4/23/2025

The original online version of this article was revised: the authors identified an error in Figure 2, unfortunately, Figure 2 and Figure 3 are the same

Change history

4/23/2025

A Correction to this paper has been published: 10.1186/s12870-025-06561-3

Contributor Information

Hong Chen, Email: Chenhcn1996@163.com.

Xinjie Shen, Email: xjshen@gzu.edu.cn.

References

1.Chen LQ, Cheung LS, Feng L, Tanner W, Frommer WB. Transport of sugars. Annu Rev Biochem. 2015;84:865–94. 10.1146/annurev-biochem-060614-033904. [DOI] [PubMed] [Google Scholar]
2.Wang ZY, Ma BQ, Yang NX, Jin L, Wang L, Ma SY, Ruan YL, Ma FW, Li MJ. Variation in the promoter of the sorbitol dehydrogenase gene MdSDH2 affects binding of the transcription factor MdABI3 and alters Fructose content in Apple fruit. Plant J. 2022;109(5):1183–98. 10.1111/tpj.15624. [DOI] [PubMed] [Google Scholar]
3.Wen SY, Neuhaus HE, Cheng JT, Bie ZL. Contributions of sugar transporters to crop yield and fruit quality. J Exp Bot. 2022;73(8):2275–89. 10.1093/jxb/erac043. [DOI] [PubMed] [Google Scholar]
4.Ren Y, Sun HH, Zong M, Guo SG, Ren ZJ, Zhao JY, Li MY, Zhang J, Tian SW, Wang JF, Yu YT, Gong GY, Zhang HY, He HJ, Li LG, Zhang XL, Liu F, Fei ZJ, Xu Y. Localization shift of a sugar transporter contributes to phloem unloading in SWEET watermelons. New Phytol. 2020;227(6):1858–71. 10.1111/nph.16659. [DOI] [PubMed] [Google Scholar]
5.Ruan YL. Sucrose metabolism: gateway to diverse carbon use and sugar signaling. Annu Rev Plant Biol. 2014;65:33–67. 10.1146/annurev-arplant-050213-040251. [DOI] [PubMed] [Google Scholar]
6.Slewinski TL. Diverse functional roles of monosaccharide transporters and their homologs in vascular plants: A physiological perspective. Mol Plant. 2011;4(4):641–62. 10.1093/mp/ssr051. [DOI] [PubMed] [Google Scholar]
7.Chen LQ, Qu XQ, Hou BH, Sosso D, Osorio S, Fernie AR, Frommer WB. Sucrose efflux mediated by SWEET proteins as a key step for phloem transport. Science. 2012;335(6065):207–11. 10.1126/science.1213351. [DOI] [PubMed] [Google Scholar]
8.Chen LQ. SWEET sugar transporters for phloem transport and pathogen nutritio. New phytol. 2014; 201(4): 1150-5. 10.1111/nph.12445 [DOI] [PubMed]
9.Yuan M, Wang SP. Rice MtN3/saliva/SWEET family genes and their homologs in cellular organisms. Mol Plant. 2013;6(3):665–74. 10.1093/mp/sst035. [DOI] [PubMed] [Google Scholar]
10.Xue XY, Wang J, Shukla D, Cheung LS, Chen LQ. When SWEETs turn tweens: updates and perspectives. Annu Rev Plant Biol. 2022;73:379–403. 10.1146/annurev-arplant-070621-093907. [DOI] [PubMed] [Google Scholar]
11.Zhang B, Li YN, Wu BH, Yuan YY, Zhao ZY. Plasma membrane-localized transporter MdSWEET12 is involved in sucrose unloading in Apple fruit. J Agric Food Chem. 2022;70(49):15517–30. 10.1021/acs.jafc.2c05102. [DOI] [PubMed] [Google Scholar]
12.Lin IW, Sosso D, Chen LQ, Gase K, Kim SG, Kessler D, Klinkenberg PM, Gorder MK, Hou BH, Qu XQ. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9. Nature. 2014;508(7497):546–9. 10.1038/nature13082. [DOI] [PubMed] [Google Scholar]
13.Sun MX, Huang XY, Yang J, Guan YF, Yang ZN. Arabidopsis RPG1 is important for primexine deposition and functions redundantly with RPG2 for plant fertility at the late reproductive stage. Plant Reprod. 2013;26(2):83–91. 10.1007/s00497-012-0208-1. [DOI] [PubMed] [Google Scholar]
14.Cox KL, Meng F, Wilkins KE, Li F, Wang P, Booher NJ, Carpenter SCD, Chen LQ, Zheng H, Gao XQ, Zheng Y, Fei ZJ, Yu JY, Isakeit T, Wheeler T, Frommer WB, He P, Bogdanove AJ, Shan LB. TAL effector driven induction of a SWEET gene confers susceptibility to bacterial blight of cotton. Nat Commun. 2017;8:15588. 10.1038/ncomms15588. [DOI] [PMC free article] [PubMed] [Google Scholar]
15.Zhou Y, Liu L, Huang WF, Yuan M, Zhou F, Li XG, Lin YJ. Overexpression of OsSWEET5 in rice causes growth retardation and precocious senescence. PLoS ONE. 2014;9(4):e94210. 10.1371/journal.pone.0094210. [DOI] [PMC free article] [PubMed] [Google Scholar]
16.Ho LH, Klemens PAW, Neuhaus HE, Ko HY, Hsieh SY, Guo WJ. SlSWEET1a is involved in glucose import to young leaves in tomato plants. J Exp Bot. 2019;70(12):3241–54. 10.1093/jxb/erz154. [DOI] [PMC free article] [PubMed] [Google Scholar]
17.Zhen QL, Fang T, Peng Q, Liao L, Zhao L, Owiti A, Han YP. Developing gene-tagged molecular markers for evaluation of genetic association of Apple SWEET genes with fruit sugar accumulation. Hortic Res. 2018;5(1):14. 10.1038/s41438-018-0024-3. [DOI] [PMC free article] [PubMed] [Google Scholar]
18.Klemens PAW, Patzke K, Deitmer J, Spinner L, Le HR, Bellini C, Bedu M, Chardon F, Krapp A, Neuhaus HE. Overexpression of the vacuolar sugar carrier AtSWEET16 modifies germination, growth, and stress tolerance in Arabidopsis. Plant Physiol. 2013;163(3):1338–52. 10.1104/pp.113.224972. [DOI] [PMC free article] [PubMed] [Google Scholar]
19.Chardon F, Bedu M, Calenge F, Klemens PAW, Spinner L, Clement G, Chietera G, Léran S, Ferrand M, Lacombe B, Loudet O, Dinant S, Bellini C, Neuhaus HE, Daniel-Vedele F, Krapp A. Leaf Fructose content is controlled by the vacuolar transporter SWEET17 in Arabidopsis. Curr Biol. 2013;23(8):697–702. 10.1016/j.cub.2013.03.021. [DOI] [PubMed] [Google Scholar]
20.Liu B, Du HW, Rutkowski R, Gartner A, Wang XC. LAAT-1 is the lysosomal lysine/arginine transporter that maintains amino acid homeostasis. Science. 2012;337(6092):351–4. 10.1126/science.1220281. [DOI] [PMC free article] [PubMed] [Google Scholar]
21.Li XY, Guo W, Li JC, Yue PT, Bu HD, Jiang J, Liu WT, Xu YX, Yuan H, Li T, Wang A. Histone acetylation at the promoter for the transcription factor PuWRKY31 affects sucrose accumulation in Pear fruit. Plant Physiol. 2020;182(4):2035–46. 10.1104/pp.20.00002. [DOI] [PMC free article] [PubMed] [Google Scholar]
22.Wang S, Liu S, Wang J, Yokosho K, Zhou B, Yu YC, Liu Z, Frommer WB, Ma JF, Chen LQ. Simultaneous changes in seed size, oil content and protein content driven by selection of SWEET homologues during soybean domestication. Natl Sci Rev. 2020;7(11):1776–86. 10.1093/nsr/nwaa110. [DOI] [PMC free article] [PubMed] [Google Scholar]
23.Zhang Y, Li YQ, Xiao W, Wu JL, Cheng L. Breeding and cultivation techniques of a new Li variety ‘fengtang’ Plum. China North Fruits. 2018;47(6):146–8. 10.13938/j.issn.1007-1431.20180194. [Google Scholar]
24.Nie XS, Chen H, Wang QY, Lu M, An HM. Sugar composition and transcriptome analysis in developing ‘fengtang’ Plum (Prunus salicina Lindl.) reveal candidate genes regulating sugar accumulation. Plant Physiol Biochem. 2023;202:107955. 10.1016/j.plaphy.2023.107955. [DOI] [PubMed] [Google Scholar]
25.Wang XH, Chen H, Dong XQ. The change of organic acid content and its relationship with malic acid metabolism related enzymes during the development of ‘fengtang’ Plum fruit. J Sci Food Agric. 2018;35(3):293–300. 10.1016/j.scienta.2009.11.001. [Google Scholar]
26.Chen C, Wu Y, Li J, Wang X, Zeng Z, Xu J, Liu Y, Feng J, Chen H, He Y, Xia R. TBtools-II: A one for all, all for one bioinformatics platform for biological big-data mining. Mol Plant. 2023;16:1733–42. 10.1016/j.molp.2023.09.010. [DOI] [PubMed] [Google Scholar]
27.You YH, Zhang L, Li PM, Yang CQ, Ma FW. Selection of reliable reference genes for quantitative real-time PCR analysis in Plum (Prunus salicina Lindl.) under different postharvest treatments. Sci Hortic. 2016;210(10):285–93. 10.1016/j.scienta.2016.07.031. [Google Scholar]
28.Gao Y, Zhang C, Han X, Wang ZY, Ma L, Yuan DP, Wu JN, Zhu XF, Liu JM, Li DP, Hu YB, Xuan YH. Inhibition of OsSWEET11 function in mesophyll cells improves resistance of rice to sheath blight disease. Mol Plant Pathol. 2018;19(9):2149–61. 10.1111/mpp.12689. [DOI] [PMC free article] [PubMed] [Google Scholar]
29.Chen LQ, Hou BH, Lalonde S, Takanaga H, Hartung ML, Qu XQ, Guo WJ, Kim JG, Underwood W, Chaudhuri B, Chermak D, Antony G, White FF, Somerville SC, Mudgett MB, Frommer WB. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature. 2010;468(7323):527–32. 10.1038/nature09606. [DOI] [PMC free article] [PubMed] [Google Scholar]
30.Gautam T, Saripalli G, Gahlaut V, Kumar A, Sharma PK, Balyan HS, Gupta PK. Further studies on sugar transporter (SWEET) genes in wheat (Triticum aestivum L). Mol Biol Rep. 2019;46(2):2327–53. 10.1007/s11033-019-04691-0. [DOI] [PubMed] [Google Scholar]
31.Chong J, Piron MC, Meyer S, Merdinoglu D, Bertsch C, Mestre P. The SWEET family of sugar transporters in grapevine: VvSWEET4 is involved in the interaction with botrytis cinerea. J Exp Bot. 2014;65(22):6589–601. 10.1093/jxb/eru375. [DOI] [PubMed] [Google Scholar]
32.Li Y, Feng S, Ma S, Sui X, Zhang Z. Spatiotemporal expression and substrate specificity analysis of the cucumber SWEET gene family. Front Plant Sci. 2017;8:1855. 10.3389/fpls.2017.01855. [DOI] [PMC free article] [PubMed] [Google Scholar]
33.Jiang C, Zeng S, Yang J, Wang X. Genome-Wide identification and expression profiling analysis of SWEET family genes involved in fruit development in Plum (Prunus salicina Lindl). Genes. 2023;14(9):1679. 10.3390/genes14091679. [DOI] [PMC free article] [PubMed] [Google Scholar]
34.Lin W, Pu Y, Liu S, Wu Q, Yao Y, Yang Y, Zhang X, Sun W. Genome-Wide identification and expression patterns of AcSWEET family in pineapple and AcSWEET11 mediated sugar accumulation. Int J Mol Sci. 2022;23(22):13875. 10.3390/ijms232213875. [DOI] [PMC free article] [PubMed] [Google Scholar]
35.Hu W, Hua X, Zhang Q, Wang J, Shen Q, Zhang X, Wang K, Yu Q, Lin YR, Ming R, Zhang JS. New insights into the evolution and functional divergence of the SWEET family in saccharum based on comparative genomics. BMC Plant Biol. 2018;18(1):270. 10.1186/s12870-018-1495-y. [DOI] [PMC free article] [PubMed] [Google Scholar]
36.Jeena GS, Kumar S, Shukla RK. Structure, evolution and diverse physiological roles of SWEET sugar transporters in plants. Plant Mol Biol. 2019;100(4–5):351–65. 10.1007/s11103-019-00872-4. [DOI] [PubMed] [Google Scholar]
37.Liu DD, Chao WM, Turgeon R. Transport of sucrose, not hexose, in the phloem. J Exp Bot. 2012;63(11):4315–20. 10.1093/jxb/ers127. [DOI] [PMC free article] [PubMed] [Google Scholar]
38.Eom JS, Chen LQ, Sosso D, Julius BT, Lin IW, Qu XQ, Braun DM, Frommer WB. SWEETs, transporters for intracellular and intercellular sugar translocation. Curr Opin Plant Biol. 2015;25:53–62. 10.1016/j.pbi.2015.04.005. [DOI] [PubMed] [Google Scholar]
39.Verdier V, Triplett LR, Hummel AW, Corral R, Cernadas RA, Schmidt CL, Bogdanove AJ, Leach JE. Transcription activator-like (TAL) effectors targeting OsSWEET genes enhance virulence on diverse rice (Oryza sativa) varieties when expressed individually in a TAL effector-deficient strain of Xanthomonas oryzae. New Phytol. 2012;196(4):1197–207. 10.1111/j.1469-8137.2012.04367.x. [DOI] [PubMed] [Google Scholar]
40.Tian R, Xu J, Xu Z, Li J, Li H. Genome-Wide identification and expression analysis of SWEET gene family in strawberry. Horticulturae. 2024;10:191. 10.3390/horticulturae10020191. [Google Scholar]
41.Guo C, Li H, Xia X, Liu X, Yang L. Functional and evolution characterization of SWEET sugar transporters in Ananas comosus. Biochem Biophys Res Commun. 2018;496(2):407–14. 10.1016/j.bbrc.2018.01.024. [DOI] [PubMed] [Google Scholar]
42.Han L, Zhu YP, Liu M, Zhou Y, Lu GY, Lan L, Wang XP, Zhao YF, Zhang XJ. Molecular mechanism of substrate recognition and transport by the AtSWEET13 sugar transporter. Proc Natl Acad Sci U S A. 2017;114(38):10089–94. 10.1073/pnas.1709241114. [DOI] [PMC free article] [PubMed] [Google Scholar]
43.Lin IW, Sosso D, Chen LQ, Gase K, Kim SG, Kessler D, Klinkenberg PM, Gorder MK, Hou BH, Qu XQ, Carter CJ, Frommer WB. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9. Nature. 2014; 508: 546– 49. 10.1038/nature13082 [DOI] [PubMed]
44.Lee J, Lee H, Kim J, Lee S, Kim DH, Kim S, wang I. Both the hydrophobicity and a positively charged region flanking the C-terminal region of the transmembrane domain of signal-anchored proteins play critical roles in determining their targeting specificity to the Endoplasmic reticulum or endosymbiotic organelles in Arabidopsis cells. Plant Cell. 2011;23:1588–607. 10.1105/tpc.110.082230. [DOI] [PMC free article] [PubMed] [Google Scholar]
45.Anjali A, Fatima U, Manu MS, Ramasamy S, Senthil-Kumar M. Structure and regulation of SWEET transporters in plants: an update. Plant Physiol Biochem. 2020;156:1–6. 10.1016/j.plaphy.2020.08.043. [DOI] [PubMed] [Google Scholar]
46.Abelenda JA, Bergonzi S, Oortwijn M, Sonnewald S, Du M, Visser RG, Sonnewald U, Bachem CW. Source-sink regulation is mediated by interaction of an FT homolog with a SWEET protein in potato. Curr Biol. 2019;29(7):1178–e11861176. 10.1016/j.cub.2019.02.018. [DOI] [PubMed] [Google Scholar]
47.Herik V, Bergonzi S, Bachem CW, Ten Tusscher K. Modelling the physiological relevance of sucrose export repression by an flowering time homolog in the long-distance phloem of potato. Plant Cell Environ. 2021;44(3):792–806. 10.1111/pce.13977. [DOI] [PMC free article] [PubMed] [Google Scholar]
48.Klemens PA, Patzke K, Deitmer JW, Spinner L, Le Hir R, Bellini C, Bedu M, Chardon F, Krapp A, Neuhaus HE. Overexpression of the vacuolar sugar carrier AtSWEET16 modifies germination, growth and stress tolerance in Arabidopsis Thaliana. Plant Physiol. 2013;163:1338–52. 10.1104/pp.113.224972. [DOI] [PMC free article] [PubMed] [Google Scholar]
49.Li J, Chen D, Jiang G, Song H, Tu M, Sun S. Molecular cloning and expression analysis of EjSWEET15, encoding for a sugar transporter from Loquat. Sci Hortic. 2020;272:109552. 10.1016/j.scienta.2020.109552. [Google Scholar]
50.Zhang Z, Zou LM, Ren C, Ren F, Wang Y, Fan P, Li SH, Liang ZC. VvSWEET10 mediates sugar accumulation in grapes. Genes(Basel). 2019;10(4):255. 10.3390/genes10040255. [DOI] [PMC free article] [PubMed] [Google Scholar]
51.Nie P, Wang L, Li M, Lyu D, Qin S, Xue X. MdSWEET23, a sucrose transporter from Apple (Malus ×domestica Borkh.), influences sugar metabolism and enhances cold tolerance in tomato. Front Plant Sci. 2023;14:1266194. 10.3389/fpls.2023.1266194. [DOI] [PMC free article] [PubMed] [Google Scholar]
52.Kim P, Xue CY, Song HD, Gao Y, Feng L, Li Y, Xuan YH. Tissue-specific activation of DOF11 promotes rice resistance to sheath blight disease and increases grain weight via activation of SWEET14. Plant Biotechnol J. 2021;19(3):409–11. 10.1111/pbi.13489. [DOI] [PMC free article] [PubMed] [Google Scholar]
53.Zhang XS, Feng CY, Wang MN, Li TL, Liu X, Jiang J. Plasma membrane-localized SlSWEET7a and SlSWEET14 regulate sugar transport and storage in tomato fruits. Hortic Res. 2021;8(1):186. 10.1038/s41438-021-00624-w. [DOI] [PMC free article] [PubMed] [Google Scholar]
54.Jin Y, Ni DA, Ruan YL. Posttranslational elevation of cell wall invertase activity by Silencing its inhibitor in tomato delays leaf senescence and increases seed weight and fruit hexose level. Plant Cell. 2009;21(7):2072–89. 10.1105/tpc.108.063719. [DOI] [PMC free article] [PubMed] [Google Scholar]
55.Wan H, Wu L, Yang Y, Zhou G, Ruan YL. Evolution of sucrose metabolism: the dichotomy of invertases and beyond. Trends Plant Sci. 2018;23(2):163–77. 10.1016/j.tplants.2017.11.001. [DOI] [PubMed] [Google Scholar]
56.Ma QJ, Sun MH, Lu J, Zhu XP, Gao WS, Hao YJ. Ectopic expression of Apple MdSUT2 gene influences development and abiotic stress resistance in tomato. Sci Hortic. 2017;220(36):259–66. 10.1016/j.scienta.2017.04.013. [Google Scholar]
57.Lu J, Sun MH, Ma QJ, Kang H, Liu YJ, Hao YJ, You CX. MdSWEET17, a sugar transporter in Apple, enhances drought tolerance in tomato. J Integr Agric. 2019;18(9):2041–51. 10.1016/s2095-3119(19)62695-x. [Google Scholar]

Associated Data

This section collects any data citations, data availability statements, or supplementary materials included in this article.

Supplementary Materials

12870_2025_6407_MOESM1_ESM.jpg^{(1MB, jpg)}

Supplementary Material 1: SWEETs sequence analysis.

12870_2025_6407_MOESM2_ESM.tif^{(1.2MB, tif)}

Supplementary Material 2: Homologous sequence alignment of PsSWEET1a and PsSWEET17b

12870_2025_6407_MOESM3_ESM.tif^{(2MB, tif)}

Supplementary Material 3: PCR detection of transgenic tomato plants.

Supplementary Material 4^{(10.9KB, xlsx)}

Supplementary Material 5^{(11.7KB, xlsx)}

Supplementary Material 6^{(17.2KB, xlsx)}

Supplementary Material 7^{(10.9KB, xlsx)}

Data Availability Statement

The datasets supporting the conclusions of this article are available in the NCBI Bioproject repository, accession number: PRJNA968060 and was publicly released on May 7, 2024.

[CR1] 1.Chen LQ, Cheung LS, Feng L, Tanner W, Frommer WB. Transport of sugars. Annu Rev Biochem. 2015;84:865–94. 10.1146/annurev-biochem-060614-033904. [DOI] [PubMed] [Google Scholar]

[CR2] 2.Wang ZY, Ma BQ, Yang NX, Jin L, Wang L, Ma SY, Ruan YL, Ma FW, Li MJ. Variation in the promoter of the sorbitol dehydrogenase gene MdSDH2 affects binding of the transcription factor MdABI3 and alters Fructose content in Apple fruit. Plant J. 2022;109(5):1183–98. 10.1111/tpj.15624. [DOI] [PubMed] [Google Scholar]

[CR3] 3.Wen SY, Neuhaus HE, Cheng JT, Bie ZL. Contributions of sugar transporters to crop yield and fruit quality. J Exp Bot. 2022;73(8):2275–89. 10.1093/jxb/erac043. [DOI] [PubMed] [Google Scholar]

[CR4] 4.Ren Y, Sun HH, Zong M, Guo SG, Ren ZJ, Zhao JY, Li MY, Zhang J, Tian SW, Wang JF, Yu YT, Gong GY, Zhang HY, He HJ, Li LG, Zhang XL, Liu F, Fei ZJ, Xu Y. Localization shift of a sugar transporter contributes to phloem unloading in SWEET watermelons. New Phytol. 2020;227(6):1858–71. 10.1111/nph.16659. [DOI] [PubMed] [Google Scholar]

[CR5] 5.Ruan YL. Sucrose metabolism: gateway to diverse carbon use and sugar signaling. Annu Rev Plant Biol. 2014;65:33–67. 10.1146/annurev-arplant-050213-040251. [DOI] [PubMed] [Google Scholar]

[CR6] 6.Slewinski TL. Diverse functional roles of monosaccharide transporters and their homologs in vascular plants: A physiological perspective. Mol Plant. 2011;4(4):641–62. 10.1093/mp/ssr051. [DOI] [PubMed] [Google Scholar]

[CR7] 7.Chen LQ, Qu XQ, Hou BH, Sosso D, Osorio S, Fernie AR, Frommer WB. Sucrose efflux mediated by SWEET proteins as a key step for phloem transport. Science. 2012;335(6065):207–11. 10.1126/science.1213351. [DOI] [PubMed] [Google Scholar]

[CR8] 8.Chen LQ. SWEET sugar transporters for phloem transport and pathogen nutritio. New phytol. 2014; 201(4): 1150-5. 10.1111/nph.12445 [DOI] [PubMed]

[CR9] 9.Yuan M, Wang SP. Rice MtN3/saliva/SWEET family genes and their homologs in cellular organisms. Mol Plant. 2013;6(3):665–74. 10.1093/mp/sst035. [DOI] [PubMed] [Google Scholar]

[CR10] 10.Xue XY, Wang J, Shukla D, Cheung LS, Chen LQ. When SWEETs turn tweens: updates and perspectives. Annu Rev Plant Biol. 2022;73:379–403. 10.1146/annurev-arplant-070621-093907. [DOI] [PubMed] [Google Scholar]

[CR11] 11.Zhang B, Li YN, Wu BH, Yuan YY, Zhao ZY. Plasma membrane-localized transporter MdSWEET12 is involved in sucrose unloading in Apple fruit. J Agric Food Chem. 2022;70(49):15517–30. 10.1021/acs.jafc.2c05102. [DOI] [PubMed] [Google Scholar]

[CR12] 12.Lin IW, Sosso D, Chen LQ, Gase K, Kim SG, Kessler D, Klinkenberg PM, Gorder MK, Hou BH, Qu XQ. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9. Nature. 2014;508(7497):546–9. 10.1038/nature13082. [DOI] [PubMed] [Google Scholar]

[CR13] 13.Sun MX, Huang XY, Yang J, Guan YF, Yang ZN. Arabidopsis RPG1 is important for primexine deposition and functions redundantly with RPG2 for plant fertility at the late reproductive stage. Plant Reprod. 2013;26(2):83–91. 10.1007/s00497-012-0208-1. [DOI] [PubMed] [Google Scholar]

[CR14] 14.Cox KL, Meng F, Wilkins KE, Li F, Wang P, Booher NJ, Carpenter SCD, Chen LQ, Zheng H, Gao XQ, Zheng Y, Fei ZJ, Yu JY, Isakeit T, Wheeler T, Frommer WB, He P, Bogdanove AJ, Shan LB. TAL effector driven induction of a SWEET gene confers susceptibility to bacterial blight of cotton. Nat Commun. 2017;8:15588. 10.1038/ncomms15588. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR15] 15.Zhou Y, Liu L, Huang WF, Yuan M, Zhou F, Li XG, Lin YJ. Overexpression of OsSWEET5 in rice causes growth retardation and precocious senescence. PLoS ONE. 2014;9(4):e94210. 10.1371/journal.pone.0094210. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR16] 16.Ho LH, Klemens PAW, Neuhaus HE, Ko HY, Hsieh SY, Guo WJ. SlSWEET1a is involved in glucose import to young leaves in tomato plants. J Exp Bot. 2019;70(12):3241–54. 10.1093/jxb/erz154. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR17] 17.Zhen QL, Fang T, Peng Q, Liao L, Zhao L, Owiti A, Han YP. Developing gene-tagged molecular markers for evaluation of genetic association of Apple SWEET genes with fruit sugar accumulation. Hortic Res. 2018;5(1):14. 10.1038/s41438-018-0024-3. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR18] 18.Klemens PAW, Patzke K, Deitmer J, Spinner L, Le HR, Bellini C, Bedu M, Chardon F, Krapp A, Neuhaus HE. Overexpression of the vacuolar sugar carrier AtSWEET16 modifies germination, growth, and stress tolerance in Arabidopsis. Plant Physiol. 2013;163(3):1338–52. 10.1104/pp.113.224972. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR19] 19.Chardon F, Bedu M, Calenge F, Klemens PAW, Spinner L, Clement G, Chietera G, Léran S, Ferrand M, Lacombe B, Loudet O, Dinant S, Bellini C, Neuhaus HE, Daniel-Vedele F, Krapp A. Leaf Fructose content is controlled by the vacuolar transporter SWEET17 in Arabidopsis. Curr Biol. 2013;23(8):697–702. 10.1016/j.cub.2013.03.021. [DOI] [PubMed] [Google Scholar]

[CR20] 20.Liu B, Du HW, Rutkowski R, Gartner A, Wang XC. LAAT-1 is the lysosomal lysine/arginine transporter that maintains amino acid homeostasis. Science. 2012;337(6092):351–4. 10.1126/science.1220281. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR21] 21.Li XY, Guo W, Li JC, Yue PT, Bu HD, Jiang J, Liu WT, Xu YX, Yuan H, Li T, Wang A. Histone acetylation at the promoter for the transcription factor PuWRKY31 affects sucrose accumulation in Pear fruit. Plant Physiol. 2020;182(4):2035–46. 10.1104/pp.20.00002. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR22] 22.Wang S, Liu S, Wang J, Yokosho K, Zhou B, Yu YC, Liu Z, Frommer WB, Ma JF, Chen LQ. Simultaneous changes in seed size, oil content and protein content driven by selection of SWEET homologues during soybean domestication. Natl Sci Rev. 2020;7(11):1776–86. 10.1093/nsr/nwaa110. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR23] 23.Zhang Y, Li YQ, Xiao W, Wu JL, Cheng L. Breeding and cultivation techniques of a new Li variety ‘fengtang’ Plum. China North Fruits. 2018;47(6):146–8. 10.13938/j.issn.1007-1431.20180194. [Google Scholar]

[CR24] 24.Nie XS, Chen H, Wang QY, Lu M, An HM. Sugar composition and transcriptome analysis in developing ‘fengtang’ Plum (Prunus salicina Lindl.) reveal candidate genes regulating sugar accumulation. Plant Physiol Biochem. 2023;202:107955. 10.1016/j.plaphy.2023.107955. [DOI] [PubMed] [Google Scholar]

[CR25] 25.Wang XH, Chen H, Dong XQ. The change of organic acid content and its relationship with malic acid metabolism related enzymes during the development of ‘fengtang’ Plum fruit. J Sci Food Agric. 2018;35(3):293–300. 10.1016/j.scienta.2009.11.001. [Google Scholar]

[CR26] 26.Chen C, Wu Y, Li J, Wang X, Zeng Z, Xu J, Liu Y, Feng J, Chen H, He Y, Xia R. TBtools-II: A one for all, all for one bioinformatics platform for biological big-data mining. Mol Plant. 2023;16:1733–42. 10.1016/j.molp.2023.09.010. [DOI] [PubMed] [Google Scholar]

[CR27] 27.You YH, Zhang L, Li PM, Yang CQ, Ma FW. Selection of reliable reference genes for quantitative real-time PCR analysis in Plum (Prunus salicina Lindl.) under different postharvest treatments. Sci Hortic. 2016;210(10):285–93. 10.1016/j.scienta.2016.07.031. [Google Scholar]

[CR28] 28.Gao Y, Zhang C, Han X, Wang ZY, Ma L, Yuan DP, Wu JN, Zhu XF, Liu JM, Li DP, Hu YB, Xuan YH. Inhibition of OsSWEET11 function in mesophyll cells improves resistance of rice to sheath blight disease. Mol Plant Pathol. 2018;19(9):2149–61. 10.1111/mpp.12689. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR29] 29.Chen LQ, Hou BH, Lalonde S, Takanaga H, Hartung ML, Qu XQ, Guo WJ, Kim JG, Underwood W, Chaudhuri B, Chermak D, Antony G, White FF, Somerville SC, Mudgett MB, Frommer WB. Sugar transporters for intercellular exchange and nutrition of pathogens. Nature. 2010;468(7323):527–32. 10.1038/nature09606. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR30] 30.Gautam T, Saripalli G, Gahlaut V, Kumar A, Sharma PK, Balyan HS, Gupta PK. Further studies on sugar transporter (SWEET) genes in wheat (Triticum aestivum L). Mol Biol Rep. 2019;46(2):2327–53. 10.1007/s11033-019-04691-0. [DOI] [PubMed] [Google Scholar]

[CR31] 31.Chong J, Piron MC, Meyer S, Merdinoglu D, Bertsch C, Mestre P. The SWEET family of sugar transporters in grapevine: VvSWEET4 is involved in the interaction with botrytis cinerea. J Exp Bot. 2014;65(22):6589–601. 10.1093/jxb/eru375. [DOI] [PubMed] [Google Scholar]

[CR32] 32.Li Y, Feng S, Ma S, Sui X, Zhang Z. Spatiotemporal expression and substrate specificity analysis of the cucumber SWEET gene family. Front Plant Sci. 2017;8:1855. 10.3389/fpls.2017.01855. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR33] 33.Jiang C, Zeng S, Yang J, Wang X. Genome-Wide identification and expression profiling analysis of SWEET family genes involved in fruit development in Plum (Prunus salicina Lindl). Genes. 2023;14(9):1679. 10.3390/genes14091679. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR34] 34.Lin W, Pu Y, Liu S, Wu Q, Yao Y, Yang Y, Zhang X, Sun W. Genome-Wide identification and expression patterns of AcSWEET family in pineapple and AcSWEET11 mediated sugar accumulation. Int J Mol Sci. 2022;23(22):13875. 10.3390/ijms232213875. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR35] 35.Hu W, Hua X, Zhang Q, Wang J, Shen Q, Zhang X, Wang K, Yu Q, Lin YR, Ming R, Zhang JS. New insights into the evolution and functional divergence of the SWEET family in saccharum based on comparative genomics. BMC Plant Biol. 2018;18(1):270. 10.1186/s12870-018-1495-y. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR36] 36.Jeena GS, Kumar S, Shukla RK. Structure, evolution and diverse physiological roles of SWEET sugar transporters in plants. Plant Mol Biol. 2019;100(4–5):351–65. 10.1007/s11103-019-00872-4. [DOI] [PubMed] [Google Scholar]

[CR37] 37.Liu DD, Chao WM, Turgeon R. Transport of sucrose, not hexose, in the phloem. J Exp Bot. 2012;63(11):4315–20. 10.1093/jxb/ers127. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR38] 38.Eom JS, Chen LQ, Sosso D, Julius BT, Lin IW, Qu XQ, Braun DM, Frommer WB. SWEETs, transporters for intracellular and intercellular sugar translocation. Curr Opin Plant Biol. 2015;25:53–62. 10.1016/j.pbi.2015.04.005. [DOI] [PubMed] [Google Scholar]

[CR39] 39.Verdier V, Triplett LR, Hummel AW, Corral R, Cernadas RA, Schmidt CL, Bogdanove AJ, Leach JE. Transcription activator-like (TAL) effectors targeting OsSWEET genes enhance virulence on diverse rice (Oryza sativa) varieties when expressed individually in a TAL effector-deficient strain of Xanthomonas oryzae. New Phytol. 2012;196(4):1197–207. 10.1111/j.1469-8137.2012.04367.x. [DOI] [PubMed] [Google Scholar]

[CR40] 40.Tian R, Xu J, Xu Z, Li J, Li H. Genome-Wide identification and expression analysis of SWEET gene family in strawberry. Horticulturae. 2024;10:191. 10.3390/horticulturae10020191. [Google Scholar]

[CR41] 41.Guo C, Li H, Xia X, Liu X, Yang L. Functional and evolution characterization of SWEET sugar transporters in Ananas comosus. Biochem Biophys Res Commun. 2018;496(2):407–14. 10.1016/j.bbrc.2018.01.024. [DOI] [PubMed] [Google Scholar]

[CR42] 42.Han L, Zhu YP, Liu M, Zhou Y, Lu GY, Lan L, Wang XP, Zhao YF, Zhang XJ. Molecular mechanism of substrate recognition and transport by the AtSWEET13 sugar transporter. Proc Natl Acad Sci U S A. 2017;114(38):10089–94. 10.1073/pnas.1709241114. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR43] 43.Lin IW, Sosso D, Chen LQ, Gase K, Kim SG, Kessler D, Klinkenberg PM, Gorder MK, Hou BH, Qu XQ, Carter CJ, Frommer WB. Nectar secretion requires sucrose phosphate synthases and the sugar transporter SWEET9. Nature. 2014; 508: 546– 49. 10.1038/nature13082 [DOI] [PubMed]

[CR44] 44.Lee J, Lee H, Kim J, Lee S, Kim DH, Kim S, wang I. Both the hydrophobicity and a positively charged region flanking the C-terminal region of the transmembrane domain of signal-anchored proteins play critical roles in determining their targeting specificity to the Endoplasmic reticulum or endosymbiotic organelles in Arabidopsis cells. Plant Cell. 2011;23:1588–607. 10.1105/tpc.110.082230. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR45] 45.Anjali A, Fatima U, Manu MS, Ramasamy S, Senthil-Kumar M. Structure and regulation of SWEET transporters in plants: an update. Plant Physiol Biochem. 2020;156:1–6. 10.1016/j.plaphy.2020.08.043. [DOI] [PubMed] [Google Scholar]

[CR46] 46.Abelenda JA, Bergonzi S, Oortwijn M, Sonnewald S, Du M, Visser RG, Sonnewald U, Bachem CW. Source-sink regulation is mediated by interaction of an FT homolog with a SWEET protein in potato. Curr Biol. 2019;29(7):1178–e11861176. 10.1016/j.cub.2019.02.018. [DOI] [PubMed] [Google Scholar]

[CR47] 47.Herik V, Bergonzi S, Bachem CW, Ten Tusscher K. Modelling the physiological relevance of sucrose export repression by an flowering time homolog in the long-distance phloem of potato. Plant Cell Environ. 2021;44(3):792–806. 10.1111/pce.13977. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR48] 48.Klemens PA, Patzke K, Deitmer JW, Spinner L, Le Hir R, Bellini C, Bedu M, Chardon F, Krapp A, Neuhaus HE. Overexpression of the vacuolar sugar carrier AtSWEET16 modifies germination, growth and stress tolerance in Arabidopsis Thaliana. Plant Physiol. 2013;163:1338–52. 10.1104/pp.113.224972. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR49] 49.Li J, Chen D, Jiang G, Song H, Tu M, Sun S. Molecular cloning and expression analysis of EjSWEET15, encoding for a sugar transporter from Loquat. Sci Hortic. 2020;272:109552. 10.1016/j.scienta.2020.109552. [Google Scholar]

[CR50] 50.Zhang Z, Zou LM, Ren C, Ren F, Wang Y, Fan P, Li SH, Liang ZC. VvSWEET10 mediates sugar accumulation in grapes. Genes(Basel). 2019;10(4):255. 10.3390/genes10040255. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR51] 51.Nie P, Wang L, Li M, Lyu D, Qin S, Xue X. MdSWEET23, a sucrose transporter from Apple (Malus ×domestica Borkh.), influences sugar metabolism and enhances cold tolerance in tomato. Front Plant Sci. 2023;14:1266194. 10.3389/fpls.2023.1266194. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR52] 52.Kim P, Xue CY, Song HD, Gao Y, Feng L, Li Y, Xuan YH. Tissue-specific activation of DOF11 promotes rice resistance to sheath blight disease and increases grain weight via activation of SWEET14. Plant Biotechnol J. 2021;19(3):409–11. 10.1111/pbi.13489. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR53] 53.Zhang XS, Feng CY, Wang MN, Li TL, Liu X, Jiang J. Plasma membrane-localized SlSWEET7a and SlSWEET14 regulate sugar transport and storage in tomato fruits. Hortic Res. 2021;8(1):186. 10.1038/s41438-021-00624-w. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR54] 54.Jin Y, Ni DA, Ruan YL. Posttranslational elevation of cell wall invertase activity by Silencing its inhibitor in tomato delays leaf senescence and increases seed weight and fruit hexose level. Plant Cell. 2009;21(7):2072–89. 10.1105/tpc.108.063719. [DOI] [PMC free article] [PubMed] [Google Scholar]

[CR55] 55.Wan H, Wu L, Yang Y, Zhou G, Ruan YL. Evolution of sucrose metabolism: the dichotomy of invertases and beyond. Trends Plant Sci. 2018;23(2):163–77. 10.1016/j.tplants.2017.11.001. [DOI] [PubMed] [Google Scholar]

[CR56] 56.Ma QJ, Sun MH, Lu J, Zhu XP, Gao WS, Hao YJ. Ectopic expression of Apple MdSUT2 gene influences development and abiotic stress resistance in tomato. Sci Hortic. 2017;220(36):259–66. 10.1016/j.scienta.2017.04.013. [Google Scholar]

[CR57] 57.Lu J, Sun MH, Ma QJ, Kang H, Liu YJ, Hao YJ, You CX. MdSWEET17, a sugar transporter in Apple, enhances drought tolerance in tomato. J Integr Agric. 2019;18(9):2041–51. 10.1016/s2095-3119(19)62695-x. [Google Scholar]

PERMALINK

Identification of the SWEET gene family and functional characterization of PsSWEET1a and PsSWEET17b in the regulation of sugar accumulation in ‘Fengtang’ plum (Prunus salicina Lindl.)

Shan Liu

Xiaoshuang Nie

Hong Chen

Xinjie Shen

Abstract

Background

Results

Conclusion

Supplementary Information

Introduction

Materials and methods

Plant materials

Determination of sugar content and enzyme activity

Identification of SWEET gene family and chromosomal localization of ‘fengtang’ Plum

Phylogenetic analysis of the SWEET gene family in Arabidopsis thaliana,Prunus persica,Prunus avium, and ‘fengtang’ Plum

Conserved motif and gene structure analysis of SWEET genes in ‘fengtang’ Plum

Sequence and protein structure analysis of the SWEET gene family in ‘fengtang’ Plum

Construction of the expression vector

RNA extraction and qRT-PCR validation

Subcellular localization of PsSWEET1a and PsSWEET17b proteins

Genetic transformation of tomato

Statistical analysis

Results

Identification and characterization of SWEET gene family members in ‘fengtang’ Plum

Fig. 1.

Phylogenetic tree analysis of SWEET genes in Arabidopsis thaliana,Prunus persica,Prunus avium, and ‘fengtang’ Plum

Fig. 2.

Sequence and motif analysis of SWEET genes in ‘fengtang’ Plum

Fig. 3.

Analysis of cis-acting elements in SWEET genes

Fig. 4.

Fig. 5.

qRT-PCR validation of SWEET genes during the development of ‘fengtang’ Plum fruit

Fig. 6.

Expression profiles of SWEET genes in different ‘fengtang’ Plum tissues and organs

Fig. 7.

Subcellular localization of PsSWEET1a and PsSWEET17b

Fig. 8.

Functional characterization of PsSWEET1a and PsSWEET17b in ‘fengtang’ Plum fruit

Fig. 9.

Overexpression of PsSWEET1a and PsSWEET17b altered the phenotype and sugar content of tomato plants

Fig. 10.

Fig. 11.

Fig. 12.

Discussion

The PsSWEET gene family of ‘fengtang’ Plum

Expression and functional diversity of PsSWEET genes in ‘fengtang’ Plum

PsSWEET1a and PsSWEET17b participate in the accumulation of sugar in ‘fengtang’ Plum fruit

Heterologous expression of PsSWEET1a and PsSWEET17b altered sugar concentration and metabolism in tomato fruit

Conclusion

Electronic supplementary material

Acknowledgements

Abbreviations

Author contributions

Funding

Data availability

Ethics approval and consent to participate

Consent for publication

Competing interests

Footnotes

Contributor Information

References

Associated Data

Supplementary Materials

Data Availability Statement

ACTIONS

PERMALINK

RESOURCES

Similar articles

Cited by other articles

Links to NCBI Databases