Global Regulation of Gene Expression by ArlRS, a Two-Component Signal Transduction Regulatory System of Staphylococcus aureus

Abstract

Staphylococcus aureus expresses various cell wall-associated and extracellular virulence factors, coordinately controlled by different two-component signal transduction systems and transcriptional regulators. In this study, we used microarray technology to identify the genes regulated by ArlR. The microarray data indicate that ArlR functions as a positive regulator and also as a negative repressor to directly and/or indirectly mediate the expression of at least 114 genes involved in different functions, including autolysis, cell division, growth, and pathogenesis.

Staphylococcus aureus is an important human and animal pathogen that causes a wide range of infections, including life-threatening endocarditis and toxic shock syndrome (22, 26). The ability of this organism to cause a variety of diseases is partly due to the expression of different cell wall-associated and secreted virulence factors which enable the bacteria to adhere to and colonize host cells (13) or cause toxic shock syndrome (26). The expression of virulence factors is coordinately controlled by two-component signal transduction systems, such as agr (1), sae (16), arl (14), and srrAB (30), and global regulators, including sar (8, 9), sigB (3, 31), rot (2, 24), and mgr (23). Therefore, the elucidation of the regulons of these regulatory systems is important for better understanding molecular mechanisms of pathogenesis. Recently, S. aureus regulons of agr, sar, sigB, and rot have been revealed by using a microarray-based approach (4, 11, 27). In our studies, we identified target genes controlled by ArlR by a comparison of the transcriptional profile between an arlR mutant and the wild-type strain during the mid-exponential phase of growth by using Affymetrix S. aureus arrays.

Construction of the arlR deletion mutant.

The arlR deletion mutant (Sa316ko) was constructed by bacteriophage φ11-mediated transduction of a cassette containing the tetA gene, flanked by chromosomal fragments upstream and downstream of the alrR, from strain RN4220 into a clinical human isolate strain WCUH29 as described previously (12). Selection for tetracycline resistance and screening for the loss of the erythromycin resistance marker carried by the vector indicated that allelic replacement had occurred and resulted in the arlR mutant strain Sa316ko. The mutation in arlR was verified by PCR and Southern blot analysis (data not shown).

To characterize the arlR mutant strain, we examined the effect of the arlR mutation on the bacterial growth rate, CFU, phenotype, and stress responses to different antibacterial agents, including cell wall synthesis inhibitors such as bacitracin, phosphomycin, and vancomycin. No significant effect of the arlR mutation on stress response to antibacterial agents was observed (data not shown). However, Sa316ko grew slightly slower than WCUH29 between early log and stationary phases (Fig. 1). Growth curves as measured by optical density (OD) were confirmed by determining the effect of arlR mutation on colony size and viable cell counts at intervals during growth. The ArlR mutant strain, Sa316ko, displayed similar-sized colonies on a tryptic soy agar plate and similar morphological features of individual cells under microscopic observation (data not shown) but decreased approximately one log CFU compared to wild-type strain between early log and stationary phases (data not shown). These results suggest that the arlRS regulon may be involved in the modulation of expression of genes associated with growth and cell division. Although it is unlikely that the arlR allelic gene replacement mutation has a polar effect on arlRS downstream gene expression (since arlR and arlS loci are located in a single operon), we examined the transcription level of arlRS downstream gene odhA, encoding 2-oxoglutarate dehydrogenase E1. Our real-time reverse transcriptase (RT)-PCR analyses showed that the arlR mutation had no significant influence on the expression of odhA (see Table 5).

FIG. 1.

Growth curve of the arlR mutant. The arlR mutant strain Sa316ko and parent strain WCUH29 were incubated in TSB at 37°C overnight with shaking; the cultures were inoculated in fresh TSB. The cell growth was monitored at 37°C by a measuring of the OD at 600 nm every 15 min with 1 min of mixing before each reading. These curves represent one of three reproducible experiments.

TABLE 5.

Real-time RT-PCR analysis of expression of genes regulated by ArlR in different growth phases

N315 ORF	N315 gene	N315 description	Change in expression level (n-fold)a in RT-PCR by phase
			Early log	Mid-log	Stationary
SA0250	lytS	Two-component sensor kinase	−4.4	−7	−6.7
SA1844	agrA	Two-component response regulator	−2.7	−2.3	−3.9
SA1882	kdpD	Two-component sensor kinase	−2.6	13.8	1.2
SA1993	lacF	PTS system, lactose specific IIA component	6.3	4	13
SA1245b	odhA	2-Oxoglutarate dehydrogenase E1	NC	NC	NC

^aNormalized values in the arlR mutant over values in the wild-type strain. Negative numbers denote up-regulation in the wild-type strain.

^bDownstream gene of arlRS. NC, no detectable change.

Identification of the arlRS regulon using microarray assay.

To better define the arlRS regulon, gene expression profiles of the arlR mutant and parent cells were analyzed by using Affymetrix S. aureus arrays as described previously (11). The S. aureus array (Affymetrix) contains probe sets to over 3,300 S. aureus open reading frames (ORFs) based on the updated S. aureus genomic sequences of N315, Mu50, NCTC 8325, and COL. Total RNA was extracted from S. aureus cells grown to mid-log phase (OD at 600 nm, 0.4) by using the RNAPrep kit (Promega, MI) and treated with a DNA-free kit (Ambion). The RNA (10 μg) was reverse transcribed to cDNA by using Superscript II reverse transcriptase and random primers (Invitrogen). The cDNA was treated with NaOH, purified by using the QIAquick PCR purification kit (QIAGEN), and digested with DNase I. The fragmented cDNAs were then directly labeled with biotin by using a biotin-ddUTP kit (Affymetrix). Biotinylated cDNA (3 μg) was hybridized to the GeneChips. The GeneChips were then washed and subjected to a series of staining procedures as described in the manual for the Affymetrix array. Each GeneChip was washed and scanned at a 570-nm wavelength and a 3-μm resolution in an Affymetrix GeneChip scanner. The Affymetrix Microarray Suite 4.0 algorithms calculated the signal intensities (average differences) and the present or absent determinations for each open reading frame. The GeneChips were then normalized, and their backgrounds were defined by using GeneSpring 4.0 (Silicon Genetics). The GeneSpring software was used to further analyze the transcription patterns of genes. To identify genes with significantly altered expression levels, a series of statistical analyses (filtering) were performed; cutoff values for ratio of expression levels of 1.80 and 0.55 were used to filter genes with expression level changes (n-fold) greater than ±1.8 in all three independent biological samples. Genes with variations (n-fold) of >1.5 across the three samples were excluded. Furthermore, a statistical group comparison using the Student t test/analysis of variance was conducted to compare the mean expression levels of the control and the arlR mutant samples. The genes with significant differential expression levels (P value, <0.05) were selected.

The results of three independent experiments demonstrated that on average, transcripts for 73% of all genes on the arrays were detected by the Affymetrix arrays in the mid-log phase of bacterial cells of WCUH29. A comparison analysis of gene expression levels between wild-type WCUH29 and the arlR mutant revealed that the expression levels of 114 genes were significantly altered in the arlR mutant. Of these, 37 genes showed a decrease (Table 1) and 77 genes showed an increase (Table 2) in expression level after the mutation of arlR.

TABLE 1.

S. aureus genes up-regulated by ArlR

N315 ORF	N315 gene	N315 description	Change in expression level (n-fold)a	agr, sar, rot, or sigB effectb
SA1844	agrA	Response regulator	−2.8
SA1842	agrB	Accessory gene regulator B	−2.2
SA1843	agrC	Sensor histidine kinase	−2.4
SAS066	agrD	AgrD protein	−1.6
SA1248	arlR	Response regulator	−602.2
SAS065	hld	Delta-hemolysin	−2.2	agr +
SA0250	lytS	Two-component sensor histidine kinase	−3.1	rot +
SA0251	lytR	Two-component response regulator	−2.2
SA0144	cap5A	Capsular polysaccharide synthesis enzyme Cap5A	−1.8	σB +
SA0147	cap5D	Capsular polysaccharide synthesis enzyme Cap5D	−1.5	σB +
SA0211		Putative oxidoreductase	−2.1
SA0212		Hypothetical protein	−1.9
SA0220		Hypothetical protein	−2.8	rot +
SA0252	lrgA	Holin-like protein LrgA	−16.5	sar +, sigB −
SA0253	lrgB	Holin-like protein LrgB	−19.7	sar +, sigB −
SA0269		Hypothetical protein	−2.3
SA0270	ssaA	Secretory antigen precursor SsaA	−2	sigB
SA0271		Hypothetical protein	−5.9	agr +, rot +,
SA0272		Hypothetical protein	−7.4	sigB −
SA0275		Hypothetical protein	−4.2	sigB −
SA0276		Similar to diarrheal toxin	−4.4
SA0417		Hypothetical protein	−2.5
SA0519	sdrC	Ser-Asp-rich fibrinogen-binding protein SdrC	−2.3	sar +, rot +
SA0520	sdrD	Ser-Asp-rich fibrinogen-binding protein SdrD	−3.7
SA0521	sdrE	Ser-Asp-rich fibrinogen-binding protein SdrE	−2.1
SA0746		Staphylococcal nuclease	−1.9
SA0893		Hypothetical protein	−1.9
SA1269		Blt-like protein	−3.1
SA1270		Similar to amino acid pearmease	−1.8
SA1271		IlvA threonine deaminase	−3
SA1272		Alanine dehydrogenase	−2.4
SA1305		Cell-dividion initiation protein	−4.9
SA1583	rot	Repressor of toxin	−1.9
SA2222		Bicyclomycin-resistant protein TcaB	−2
SA2303		Hypothetical protein	−11.2	rot +
SA2486		2-Oxoglutarate/malate translocator	−1.8

^aNormalized values in the wild-type strain over values in the arlR mutant.

^bagr and sar effects are as described by Dunman et al. (13), rot effect is as described by Said-Salim et al. (41), and sigB effect is as described by Bischoff et al. (4). +, up-regulated; −, down-regulated.

TABLE 2.

S. aureus genes repressed by ArlR

N315 ORF	N315 gene	N315 description	Change in expression level (n-fold)a	agr, sar, rot, or sigB effectb
SA0104		Hypothetical protein	1.9
SA0123		Hypothetical protein	22.1	rot−
SA0124		Hypothetical protein	35
SA0125		Hypothetical protein	39.6
SA0126		Hypothetical protein	20.4
SA0127	cpsM	Capsular polysaccharide repeat, Unit transporter cpsM	4	rot −
SA0135		Hypothetical protein	1.6
SA0136		Hypothetical protein	2.7
SA0137		Hypothetical protein	3.6
SA0138		Hypothetical protein	5.6
SA0165		Hypothetical protein	1.8	rot −
SA0299		PfkB family carbohydrate kinase	2.5
SA0304	nanA	N-Acetylneuraminate lyase	2.5
SA0318		Putative membrane protein	2.5
SA0319		Hypothetical protein	4.7
SA0320		Hypothetical protein	5.1
SA0321		Putative PTS multidomain regulator	5.5
SA0331		Hypothetical protein	14.2
SA0332		Hypothetical protein	8
SA0333		Conserved hypothetical protein	10.6
SA0395		Hypothetical protein	2.2
SA0710		Conserved hypothetical protein	7.4	rot −
SA0850		Hypothetical protein	10.7	rot −
SA0851		Oligopeptide ABC transporter, ATP-binding protein	2.2
SA0899	sspC	Cysteine protease	3.1	agr +, rot −
SA0904		Hypothetical protein	10.7	rot −
SA0956		Hypothetical protein	2.9
SA0978	isdC	Conserved hypothetical protein	1.9
SA1090	lytN	LytN protein	10.4	agr +, sar +, rot −, sigB −
SA1091	fmhC	FmhC protein	3.9	rot −
SA1145		Host factor-1 protein	3
SA1154		Conserved hypothetical protein	9.1
SA1266		Hypothetical protein	6.4
SA1267	ebhA	Hypothetical protein	15.1	rot −
SA1268	ebhB	Hypothetical protein	28.6	agr +, rot −
SA1552		Hypothetical protein	3.7
SA1577		Hypothetical protein	17.2
SA1630	splB	Serine protease, V8 protease	4.3	agr +, sar +, rot −, sigB −
SA1637	lukD	Leukotoxin, LukD	1.9
SA1638	lukE	Leukotoxin, LukE	1.6
SA1752	hlb	Truncated beta-hemolysin	2.5
SA1848	nrgA	Probable ammonium transporter	1.9
SA1882	kdpD	Two-component sensor kinase KdpD	2.9
SA1883	kdpE	Two-component response regulator KdpE	2
SA1991	lacG	6-Phospho-beta-galactosidase	4.1
SA1992		PTS system, lactose-specific IIBC component	3.5
SA1993	lacF	PTS system, lactose-specific IIA component	6.5
SA1994	lacD	Tagatose 1,6-diphosphate aldolase	4.4
SA1995	lacC	Tagatose-6-phosphate kinase	4.9
SA1996	lacB	Galactose-6-phosphate isomerase LacB subunit	7.2
SA1997	lacA	Galactose-6-phosphate isomerase LacA subunit	5.1
SA2006		Hypothetical protein	5.5
SA2007		Hypothetical protein	2.8
SA2008	alsS	Alpha-acetolactate synthase	2.4
SA2081		Urea transporter	3.1
SA2082	ureA	Urease gamma subunit	9.3	rot −
SA2083	ureB	Urease beta subunit	12.1	rot −
SA2084	ureC	Urease alpha subunit	7	rot −
SA2085	ureE	Urease accessory protein UreE	5.2	rot −
SA2086	ureF	Urease accessory protein UreF	4.6	rot −
SA2087	ureG	Urease accessory protein UreG	3.6	rot −
SA2088	ureD	Urease accessory protein UreD	4.5	rot −
SA2091		Hypothetical protein	6.7
SA2092		Hypothetical protein	4.5
SA2209	hlgC	Gamma-hemolysin component C precursor	3.2	agr +, rot −
SA2287		Staphylococcal regulator SarH2	7.9
SA2315		Putative membrane protein	2.6
SA2319		Putative l-serine dehydratase	3.8
SA2320		Putative membrane protein	4.7
SA2329		Murine hydrose exporter	3.8
SA2337	feoB	Ferrous iron transporter protein	4
SA2338		Hypothetical protein	7.3
SA2382		Hypothetical protein	5.4
SA2455	cap8C	Capsular polysaccharide synthesis enzyme Cap8C	12.7	rot −, sigB +
SA2456	cap8B	Capsular polysaccharide synthesis enzyme Cap8B	18.1	rot −, sigB +
SA2457	capA	Capsular polysaccharide biosynthesis CapA	31.2	rot −, sigB +
SA2482	arcA	Arginine deiminase	2
SAV0397		Hypothetical protein	12.1

^aNormalized values in the arlR mutant over values in the wild-type strain.

^bagr and sar effects are as described by Dunman et al. (13), rot effect is as described by Said-Salim et al. (41), and sigB effect is as described by Bischoff et al. (4). +, up-regulated; −, down-regulated.

The array data indicated that ArlR positively regulates a two-component system, lytR-lytS, which encodes a response regulator and a sensor histidine kinase and is involved in autolysis (6, 14). The positive regulation of lytS expression by ArlR was confirmed by real-time RT-PCR analysis using the Stratagene Mx3000P real-time PCR system. Gene-specific primers were designed to yield ∼100 bp of specific products (Table 3), and the housekeeping gene 16S rRNA was used as an endogenous control (29). All samples were analyzed in triplicate and normalized against 16S rRNA gene expression. The results were statistically analyzed for correlation to the microarray results. Compared to the wild type, the arlR mutant possessed low levels of lytS mRNA in the early log, mid-log, and stationary phases of growth (Tables 4 and 5). We also found that the mutation in arlR significantly down-regulates the expression of lrgA and lrgB, encoding different holin-like proteins involved in murein hydrolase transport and inhibition of murein hydrolase activity (7, 17). These enzymes are involved in the cleavage of specific cell wall components, which are important for cell division and growth (7, 17).

TABLE 3.

Primers used in real-time RT-PCR

Primer	Sequence (5′-3′)
SA0123for	ATATTACGGCGAACGGACGAC
SA0123rev	TGGCTTGTTATGCTCAAATGAATCG
SA0250for	GCATGGTTCTATCGTCGGTACATTG
SA0250rev	ACTTACTTTGCGTTTCGGCTTCAC
SA0252lrgAfor	TGAAACAACAAAAAGACGCATCAAAACCAG
SA0252lrgArev	ACTTCGCCTAACTTAACAGCACCAG
SA0270ssaAfor	GGCATCCAAGTCAATTAAACCAAGATAATG
SA0270ssaArev	CAGTACGGTAGCTGTTTGTGTTGTAAC
SA0319for	GCACCATCTGATATCGAAGTTGAAC
SA0319rev	TAGGCGTTCGGCATTTTCAGC
SA1248for	TGACAAAGTTGCTGGGCTTGATTAC
SA1248rev	TGTGGCTGACGACGTAAAATTGC
SA1583for	TCAGCGAGATTGAAAGCGAATAC
SA1583rev	CTGTCCATTTCTTTAAGCGTCATAG
SA1637for	TGGGGCGGTAAGTATAATGTTTCG
SA1637rev	GATCCATTCAATCCACCTGATAAGC
SA1882for	GAAAGACAAGCTGGTGCAACAAC
SA1882rev	AACGGCGAGAGAAAGTTCATTTAAC
SA1844agrAfor	GTGAAATTCGTAAGCATGACCCAGTTG
SA1844agrArev	TGTAAGCGTGTATGTGCAGTTTCTAAAC
SA1993for	GAAGGAAACAATTGCATTGCTGAAG
SA1993rev	ATATCATCACCTTGCGCTTCTTTAG
SA1245odhA1665for	GCAATGAACCACCCGTAGAATAGC
SA1245odhA1833rev	ACGAGAGCAGCACAAGATGATACAC
16S rRNAfor	CTGTGCACATCTTGACGGTA
16S rRNArev	TCAGCGTCAGTTACAGACCA

TABLE 4.

Real-time RT-PCR analysis of expression of genes regulated by ArlR

N315 ORF	N315 gene	N315 description	Change in expression level (n-fold)a
			RT-PCR	Microarray
SA0123		Hypothetical protein	42.8	22.1
SA0319		Hypothetical protein	5.1	4.7
SA1637	lukD	Leukotoxin LukD	2	1.9
SA1882	kdpD	Two-component sensor kinase	3.1	2.9
SA1993	lacF	PTS system, lactose-specific IIA component	17	6.5
SA1844	agrA	Two-component response regulator	−5.7	−2.8
SA0250	lytS	Two-component sensor kinase	−2.8	−3.1
SA0252	lrgA	Holin-like protein LrgA	−64.8	−16.5
SA0270	ssaA	Secretory antigen precursor SsaA	−1.7	−2
SA1583	rot	Repressor of toxin	−4	−1.9

^aNormalized values in the arlR mutant over values in the wild-type strain. Negative numbers denote up-regulation in the wild-type strain.

To determine whether the growth defect of the mutant is attributable to increased susceptibility to cell lysis, we examined the effect of ArlR on autolysis induced by Triton X-100 and detected the cell wall murein hydrolase activity by using a zymographic assay as described previously (19). Consistent with a previous report (14), the arlR mutant cells displayed increased lysis in the presence of 0.01% Triton and showed enhanced peptidoglycan hydrolase activity compared to the parent control (unpublished data). These results indicated that increased autolysis in the arlR mutant may result from the significant down-regulation of the lytSR and lrgAB operons and, in turn, may partially affect bacterial growth. Although it has been reported that the mutation in rat, another autolysis regulator, exhibited a growth defect and enhanced autolysis partly due to increased murein hydrolase activity (19), the reason why the mutation in arlR led to a slight impact on growth remains undefined, since the lrgAB mutation did not show significant impact on the cell shape and growth rate (17).

Also, our microarray data showed that ArlR positively regulates virulence factor genes, such as sdrC, sdrD, and sdrE, encoding different Ser-Asp-rich bone sialoprotein-binding proteins (Table 1) (28). The result for sdrD was confirmed by using real-time RT-PCR and demonstrated that the level of sdrD mRNA in the arlR mutant strain is significantly decreased compared with that in the wild-type strain (Table 4). The up-regulation of sdrC by ArlR may indirectly function via up-regulated rot expression, since Rot positively regulates the expression of sdrC (11). In addition, ArlR positively regulates the tcaB gene (which encodes a bicyclomycin-resistant protein), the secretory antigen precursor ssaA, and toxin genes, such as hld and SA0276, encoding delta-hemolysin and diarrheal toxin, respectively (Table 1).

Moreover, the array data showed that ArlR positively regulates the accessory gene regulator (agr) (Table 1). A real-time RT-PCR was employed to validate this result and demonstrated that the mutation in arlR significantly decreased the level of agrA expression (Table 4). The expression of agrA was constantly up-regulated by ArlR at different times of growth (Table 5). These results are inconsistent with the finding that the mutation in arlS leads to the overexpression of Agr (15). This controversy may be due to different sensitivities, culture conditions, and time points of sampling between different assays. In addition, the array results indicated that ArlR also positively regulates the expression of the repressor of toxins (rot). This result was confirmed by real-time RT-PCR and demonstrated that the mutation in arlR causes a decrease in rot expression (Table 4). Our findings are consistent with previous reports that the expression of certain secreted enzymes, toxins, and ureases are repressed by Rot (9, 27). Most virulence factors negatively regulated by ArlR were also repressed by Rot but were up-regulated by Agr (5, 25). Therefore, the down-regulation of these toxins, proteases, and adhesins may be mediated directly by ArlR or indirectly controlled via Rot or Agr (Fig. 2).

FIG. 2.

Schematic figure showing how the staphylococcal two-component signal transduction regulatory system, ArlRS, directly and/or indirectly modulates gene expression. →, positive regulation; ⊥, negative regulation.

To determine the role of the ArlRS regulatory system in pathogenesis, we examined the effect of the arlR mutation on virulence by using a murine hematogenous pyelonephritis model as described previously (20). The virulence of the arlR mutant was significantly attenuated compared to that of the parent control (unpublished data). Collectively, these findings suggest that ArlRS is a global two-component virulence regulatory system which can interact with other regulators to modulate the expression of virulence factors.

On the other hand, ArlR functions as a repressor of virulence factors. Our microarray data showed that ArlR negatively regulates some toxin genes, lukD, lukE, phlC (hlb), and hlgC, which encode leukotoxin D, leukotoxin E, beta-hemolysin component C, and gamma-hemolysin component C, respectively (Table 2). Gamma-hemolysin is an S. aureus virulence factor that has been shown to play a role in S. aureus endophthalmitis and corneal pathogenesis (10, 21). The microarray result for lukD was confirmed by real-time RT-PCR. As shown in Table 4, the lukD transcript was present at higher levels in the arlR mutant strain than in the wild-type strain. The array results also demonstrated that ArlR negatively regulates splB (encoding V8 protease), sspC (encoding cysteine protease), and ebhA and ebhB (encoding adhesins) (Table 2). The negative regulation of ebhB expression by ArlR was confirmed by a real-time RT-PCR (Table 4).

Furthermore, the array results showed that ArlR negatively regulates the expression of genes involved in different PTS systems, such as the lacG, lacF, lacD, lacC, lacB, and lacA operons, as well as hypothetical proteins. To validate these results, real-time RT-PCR was performed, and it demonstrated that the mutation of arlR increases the expression of hypothetical proteins (SA0123 and SA0319) and constantly up-regulates lacF expression at different phases of growth (Tables 4 and 5). Also, we found that in the arlR mutant, the levels of kdpD and kdpE transcripts (which encode a two-component sensor kinase and response regulator and involve K⁺ transport [18]) were obviously higher than those in the wild-type strain. To confirm this result, real-time RT-PCR was performed, and the results demonstrated that the mutation of arlR increases kdpD expression in the mid-log phase of growth but decreases kdpD expression in the early log phase of growth (Tables 4 and 5). These results suggest that ArlR differentially regulates kdpD expression at different times of growth.

Conclusion.

The regulon of ArlRS has been identified by employing transcriptome technology using Affymetrix S. aureus arrays. The results demonstrate that ArlRS is a global transcriptional regulator which directly and/or indirectly interacts with other regulators in regulatory networks and modulates the expression of genes involved in autolysis, cell growth, and pathogenesis (Fig. 2). Some genes/operons mediated by ArlRS may be missed, due to their lack of stability and/or kinetic regulation as well as low detection sensitivity. Further studies to investigate which genes identified using microarray assays are directly regulated by ArlR and are involved in autolysis and/or pathogenesis are in progress.