Abstract
Carbapenem-hydrolyzing oxacillinases are reported increasingly in Acinetobacter baumannii. Since they hydrolyze carbapenems at low levels, the roles of carbapenem-hydrolyzing oxacillinases OXA-23, OXA-40, and OXA-58 in A. baumannii were determined. The blaOXA-23, blaOXA-40, and blaOXA-58 genes were inserted in broad-host-range plasmid pAT801 and transformed in Escherichia coli DH10B and in A. baumannii CIP 70.10 and its point mutant derivative A. baumannii BM4547, which overexpresses the efflux pump AdeABC. Natural plasmids harboring the blaOXA-23 and blaOXA-58 genes were also transformed in A. baumannii CIP 70.10. In addition, the blaOXA-40 gene was inactivated at its chromosome location in A. baumannii CLA-1. Intermediate levels of resistance or reduced susceptibilities to carbapenems were observed for A. baumannii transformants expressing OXA-23, OXA-40, and OXA-58. The inactivation of blaOXA-40 in A. baumannii CLA-1 yielded reduced susceptibilities to carbapenems. Carbapenem-hydrolyzing oxacillinases OXA-23, OXA-40, and to a lesser extent OXA-58 play a role in carbapenem resistance in A. baumannii, and overexpression of efflux pump AdeABC may also contribute to higher levels of resistance to β-lactams, including carbapenems.
Acinetobacter baumannii is frequently associated with nosocomial infections (3). Its acquired resistance to many antibiotics may complicate significantly the choice for antibiotic treatment (7, 17). A. baumannii naturally produces a cephalosporinase (5) that may be overexpressed due to insertion of insertion sequence (IS) ISAba1 that brings promoter sequences for its high level of expression (10, 29; L. Poirel, C. Héritier, and P. Nordmann, Abstr. 6th Int. Symp. Biol. Acinetobacter, abstr. pC4, 2004). However, overproduction of AmpC alone contributes to ceftazidime resistance but not to carbapenem resistance (5, 10, 29). Nevertheless, A. baumannii may acquire additional β-lactam resistance phenotypes, including carbapenem resistance.
Although carbapenem resistance may be due in part to an impaired permeability related to porin changes or to penicillin binding protein modifications (9, 13, 30), recent reports indicated that carbapenem-hydrolyzing β-lactamases may play a significant role (27). Carbapenem-hydrolyzing oxacillinases (Ambler class D β-lactamases) and metallo-β-lactamases (Ambler class B β-lactamases) have been reported in A. baumannii (27, 31).
Seven oxacillinases with weak carbapenemase activity have been characterized in A. baumannii, including OXA-23, -24, -25, -26, -27, -40, and -58 from A. baumannii isolates in Scotland, Brazil, Spain, Belgium, Singapore, Portugal, and France (1, 4, 6, 11, 12, 14, 15, 19, 23, 26). These oxacillinases may be divided into three different groups. The β-lactamases OXA-23 and -27 share 99% amino acid identity, whereas they share 60% identity with a second group of oxacillinases consisting of OXA-24, -25, -26, and -40 that differ by a few amino acid substitutions (1, 6, 15). β-Lactamase OXA-58 that by itself constitutes a third group of carbapenem-hydrolyzing oxacillinases is weakly related to the other oxacillinases sharing 48 and 47% amino acid identity with OXA-23 and OXA-24, respectively (26). Recently, a novel carbapenem-hydrolyzing oxacillinase, OXA-51, has been described in A. baumannii clinical isolates from Argentina (8). This oxacillinase shares less than 62 and 56% amino acid identity with OXA-40 and OXA-23, respectively (8). Its clinical role in carbapenem resistance of A. baumannii remains to be determined.
Since studies published on these oxacillinases reported mostly analyses of clinical isolates, it is difficult to compare the precise roles of these β-lactamases in resistance to carbapenems in A. baumannii (1, 15, 23, 26).
Thus, the aim of our study was to evaluate the roles of OXA-23, OXA-40, and OXA-58 taken as representatives of the three major groups of carbapenem-hydrolyzing oxacillinases for providing carbapenem resistance in A. baumannii, using reference and isogenic strains. Gene manipulations and expression studies have been performed not only in Escherichia coli but also in A. baumannii.
MATERIALS AND METHODS
Bacterial strains and plasmids.
A. baumannii clinical isolates FER and CLA-1 (15) were isolated at the Hôpital de Bicêtre (Le Kremlin-Bicêtre, France) in 2004 and 2001, respectively (Table 1). A. baumannii clinical isolate MAD was isolated in 2003 at the Rangueil hospital (Toulouse, France) (26) (Table 1). These isolates were identified by the API 20NE system (bioMérieux, Marcy l'Etoile, France) and by sequencing of 16S rRNA genes (data not shown).
TABLE 1.
Strains and transformants used in this study
| Strain | Origin | β-Lactamase content | Reference |
|---|---|---|---|
| A. baumannii FER | Clinical strain | OXA-23 and AmpC | This study |
| A. baumannii CLA-1 | Clinical strain | OXA-40 and AmpC | 15 |
| A. baumannii MAD | Clinical strain | OXA-58 and AmpC | 26 |
| E. coli DH10Ba | Reference strain | AmpC (E. coli) | 15 |
| A. baumannii CIP 70.10 | Reference strain | AmpC | 20 |
| A. baumannii BM4547 | Reference strain | AmpC | 20 |
| E. coli DH10B(pOXA-23) | Transformant | OXA-23 | This study |
| E. coli DH10B(pOXA-40) | Transformant | OXA-40 | This study |
| E. coli DH10B(pOXA-58) | Transformant | OXA-58 | This study |
| A. baumannii CIP 70.10(pOXA-23) | Transformant | OXA-23 and AmpC | This study |
| A. baumannii CIP 70.10(pOXA-40) | Transformant | OXA-40 and AmpC | This study |
| A. baumannii CIP 70.10(pOXA-58) | Transformant | OXA-58 and AmpC | This study |
| A. baumannii BM4547(pOXA-23) | Transformant | OXA-23 and AmpC | This study |
| A. baumannii BM4547(pOXA-40) | Transformant | OXA-40 and AmpC | This study |
| A. baumannii BM4547(pOXA-58) | Transformant | OXA-58 and AmpC | This study |
| A. baumannii CIP 70.10(pFER) | Transformant | OXA-23 and AmpC | This study |
| A. baumannii CIP70.10(pMAD) | Transformant | OXA-58 and AmpC | 26 |
| A. baumannii BM4547(pFER) | Transformant | OXA-23 and AmpC | This study |
| A. baumannii BM4547(pMAD) | Transformant | OXA-58 and AmpC | This study |
| A. baumannii CLA-1 (ΔOXA-40) | Recombinant strain | AmpC | This study |
As usual in E. coli, its naturally occurring ampC gene is not expressed.
Escherichia coli reference strain DH10B, A. baumannii CIP 70.10 (Pasteur Institute, Paris, France) and its point mutant derivative, A. baumannii BM4547 (which overexpresses the AdeABC efflux pump [20]), and shuttle plasmid pAT801 (16) were used for cloning experiments. A. baumannii CIP70.10 and A. baumannii BM4547 were also used in transformation experiments. Plasmid pCR-Blunt II-TOPO (Invitrogen, Cergy Pontoise, France) was used in inactivation experiments.
Antimicrobial agents and MIC determinations.
The antimicrobial agents and their sources have been referenced elsewhere (2, 24). Antibiotic-containing disks were used for detection of antibiotic susceptibility with Mueller-Hinton agar plates and a disk diffusion assay (Sanofi-Diagnostics Pasteur, Marnes-La-Coquette, France) (www.sfm.fr). MICs were determined by an agar dilution technique as previously reported (24), and results were interpreted according to the guidelines of the Clinical and Laboratory Standards Institute (formerly the National Committee for Clinical Laboratory Standards [NCCLS]) (22).
Plasmid analysis and transformation.
Extraction of plasmid DNA from A. baumannii FER and A. baumannii MAD was attempted using the Kieser method (18). Plasmid suspensions were used for transformation experiments in A. baumannii CIP 70.10 using a Gene Pulser II electroporator (Bio-Rad, Ivry-sur-Seine, France) as previously described for E. coli (25). Electrotransformation products were selected on ticarcillin (50 μg/ml)-containing plates.
PCR experiments.
PCR experiments were performed as previously described (2, 28). The entire blaOXA-23, blaOXA-40, and blaOXA-58 genes, without their natural promoter and ribosome binding site (RBS) sequences, were amplified using combinations of primers OXA-23A and OXA-23B, OXA-40A and OXA-40B, and preOXA-58A and preOXA-58B, respectively (Table 2). The sizes of the corresponding PCR products were 840 bp, 846 bp, and 859 bp for the blaOXA-23, blaOXA-40, and blaOXA-58 genes, respectively. A 495-bp internal fragment of the blaOXA-40 gene was generated with primers OXA-IMP1 and OXA-IMP2 for inactivation experiments (see below). Primers RA-1 and RA-2 (Table 2) were used to amplify a 603-bp fragment corresponding to the entire arr-2 gene using the genomic DNA of E. coli MG-1 as the template (21). All PCR products were sequenced with an Applied Biosystems sequencer (ABI 3100).
TABLE 2.
Sequences of primers designed for this study
| Primer | Sequence (5′→3′)a | Location and/or primer type |
|---|---|---|
| RA-1 | GCAGCCAAATCCCAACAATTAAGG | arr-2 |
| RA-2 | CGCCGCCATAAACGGCGACAGG | arr-2, reverse primer |
| OXA-23A | GGAATTCCATGAATAAATATTTTACTTGC | blaOXA-23 |
| OXA-23B | CGGGATCCCGTTAAATAATATTCAGGTC | blaOXA-23, reverse primer |
| OXA-40A | GGAATTCCATGAAAAAATTTATACTTCC | blaOXA-40 |
| OXA-40B | CGGGATCCCGTTAAATGATTCCAAGATTTTCTAGCG | blaOXA-40, reverse primer |
| preOXA-58A | GGAATTCCATGAAATTATTAAAATTGAGTTTAG | blaOXA-58 |
| preOXA-58B | CGGGATCCCGTTATAAATAATGAAAAACACCC | blaOXA-58, reverse primer |
| OXA-IMP1 | GCAAATAMAGAATATGTSCC | blaOXA-40, internal primer |
| OXA-IMP2 | CTCMACCCARCCRGTCAACC | blaOXA-40, internal reverse primer |
| M13 reverse | GTCCTTTGTCGATACT | pCR-BluntII-TOPO reverse sequencing primer |
M is A or C, S is G or C, and R is A or G.
Cloning experiments.
The low-copy-number plasmid pAT801 conferring resistance to ampicillin was used as a shuttle vector able to replicate in A. baumannii and E. coli; it consists of part of pWH1266 and pUC18 (16). Inactivation of the blaTEM-1 gene of pAT801 was made using a PCR product corresponding to the entire arr-2 gene inserted into the ScaI-restricted plasmid pAT801, giving rise to pAT801-RA conferring resistance to rifampin. PCR products corresponding to either the blaOXA-23, blaOXA-40, or blaOXA-58 gene then were inserted into the EcoRI- and BamHI-restricted plasmid pIM-1-RA under the control of the lacZ RBS and promoter sequences. This gave rise to recombinant plasmids pOXA-23, pOXA-40, and pOXA-58, which were transformed in E. coli DH10B, as described previously (25). Recombinant plasmids, extracted using the QIAGEN maxiprep kit (QIAGEN, Courtaboeuf, France), were transformed in A. baumannii CIP 70.10 and in A. baumannii BM4547. Transformants were selected on ticarcillin (50 μg/ml)- and rifampin (25 μg/ml)-containing plates.
Gene inactivation.
Kanamycin-resistant plasmid pCR-BluntII-TOPO (Invitrogen, Cergy-Pontoise, France) unable to replicate in A. baumannii was used as a suicide vector. An internal fragment of the blaOXA-40 gene, generated as described above, was inserted in the pCR-BluntII-TOPO using the Zero Blunt TOPO PCR Cloning kit (Invitrogen, Cergy Pontoise, France), giving rise to plasmid pTOPO-OXA-40. This plasmid was introduced in the kanamycin-susceptible A. baumannii CLA-1 strain by electrotransformation. Selection of A. baumannii CLA-1(pTOPO-OXA-40) was made on kanamycin (30 μg/ml)-containing plates.
Inactivation of the blaOXA-40 gene by insertion of pTOPO-OXA-40 was checked by PCR amplification using primers M13 reverse and OXA-40A (Table 2). The lack of production of β-lactamase OXA-40 in A. baumannii CLA-1 (ΔOXA-40) was also verified by isoelectric focusing as previously described (15).
In order to complement A. baumannii CLA-1 (ΔOXA-40) isolate, recombinant plasmid pOXA-40 was transformed in A. baumannii CLA-1 (ΔOXA-40) as described previously (25). Selection of A. baumannii CLA-1 (ΔOXA-40) (pOXA-40) was made on ticarcillin (50 μg/ml)-, rifampin (25 μg/ml)-, and kanamycin (30 μg/ml)-containing plates.
RESULTS AND DISCUSSION
Antibiotic susceptibility and plasmid analyses.
A. baumannii clinical isolates FER, CLA-1, and MAD produced the β-lactamases OXA-23, OXA-40, and OXA-58, respectively (15, 26). They were resistant to all β-lactams, including carbapenems (Table 3).
TABLE 3.
MICs of β-lactams for A. baumannii strains
| β-Lactama | MIC (μg/ml) of β-lactam for A. baumanii strainb:
|
||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|
| FER (OXA-23) | CIP 70.10 (pFER) | BM4547 (pFER) | CLA-1 (OXA-40) | CLA-1 (ΔOXA-40) | CLA-1 (ΔOXA-40) (pOXA-40) | MAD (OXA-58) | CIP 70.10 (pMAD) | BM4547 (pMAD) | CIP 70.10 | BM4547 | |
| AMX | >256 | >256 | >256 | >256 | >256 | >256 | >256 | >256 | >256 | 32 | 64 |
| TIC | >256 | >256 | >256 | >256 | 128 | >256 | >256 | >256 | >256 | 4 | 8 |
| CAZ | >32 | 4 | 4 | >32 | >32 | >32 | >32 | 2 | 4 | 2 | 4 |
| CTX | >32 | 16 | >32 | >32 | >32 | >32 | 32 | 8 | >32 | 8 | >32 |
| FEP | >32 | >32 | >32 | >32 | 32 | >32 | >32 | 1 | >32 | 1 | >32 |
| CPO | >32 | >32 | >32 | >32 | >32 | >32 | >32 | 8 | >32 | 2 | >32 |
| ATM | 128 | 64 | 64 | 128 | 128 | 128 | 32 | 16 | 16 | 16 | 16 |
| IPM | >32 | 16 | >32 | >32 | 2 | >32 | 32 | 2 | 32 | 0.25 | 0.5 |
| MEM | >32 | 16 | >32 | >32 | 4 | >32 | >32 | 2 | 32 | 0.25 | 0.5 |
AMX, amoxicillin; TIC, ticarcillin; CAZ, ceftazidime; CTX, cefotaxime; FEP, cefepime; CPO, cefpirome; ATM, aztreonam; IPM, imipenem; MEM, meropenem.
MICs of β-lactams for A. baumannii FER (OXA-23), A. baumannii CIP 70.10 and A. baumannii BM4547 harboring natural plasmid pFER, A. baumannii CLA-1 (OXA-40), A. baumannii CLA-1 (ΔOXA-40) and A. baumannii CLA-1 (ΔOXA-40) harboring recombinant plasmid pOXA-40, A. baumannii MAD (OXA-58), A. baumannii CIP 70.10 and A. baumannii BM4547 harboring natural plasmid pMAD, and A. baumannii CIP 70.10 and A. baumannii BM4547 reference strains.
Plasmid extractions of A. baumannii FER and A. baumannii MAD revealed a ca. 70-kb plasmid and a 30-kb plasmid (26), respectively, whereas no plasmid was detected in A. baumannii CLA-1 (15). These plasmids were extracted and then electrotransformed in A. baumannii CIP 70.10 and in its point mutant derivative, A. baumannii BM4547, which overexpresses the AdeABC efflux pump. A. baumannii CIP 70.10(pFER) and A. baumannii BM4547(pFER) transformants, were resistant to ticarcillin, imipenem, and meropenem, with a higher level of carbapenem resistance for A. baumannii BM4547(pFER) (Table 3). A. baumannii CIP 70.10(pMAD) transformant, was resistant to ticarcillin and had a reduced susceptibility to imipenem and meropenem, whereas the A. baumannii BM4547(pMAD) transformant was resistant to imipenem and meropenem (Table 3). These results indicated that overexpression of the AdeABC efflux pump and expression of OXA-23 or OXA-58 led to higher levels of carbapenem resistance.
Cloning and expression of the carbapenem-hydrolyzing oxacillinase genes in E. coli.
After PCR amplification, the blaOXA-23, blaOXA-40, and blaOXA-58 genes were inserted into the rifampin-resistant vector pAT801-RA under the control of the lacZ RBS and promoter sequences and expressed in E. coli DH10B. Antibiotic susceptibility testing revealed that these E. coli recombinant strains had a β-lactam resistance that include reduced susceptibility to imipenem (Table 4).
TABLE 4.
MICs of β-lactams for E. coli and A. baumannii strains
| β-Lactama | MIC (μg/ml) of β-lactam for strainb:
|
|||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
|
E. coli
|
A. baumannii
|
|||||||||||
| DH10B (pOXA-23) | DH10B (pOXA-40) | DH10B (pOXA-58) | DH10B (pAT801-RA) | CIP 70.10 (pOXA-23) | CIP 70.10 (pOXA-40) | CIP 70.10 (pOXA-58) | CIP 70.10 (pAT801-RA) | BM4547 (pOXA-23) | BM4547 (pOXA-40) | BM4547 (pOXA-58) | BM4547 (pAT801-RA) | |
| AMX | >256 | >256 | >256 | 4 | >256 | >256 | >256 | 32 | >256 | >256 | >256 | 64 |
| TIC | >256 | >256 | >256 | 4 | >256 | >256 | >256 | 4 | >256 | >256 | >256 | 8 |
| CAZ | 0.06 | 0.06 | 0.06 | 0.06 | 4 | 4 | 4 | 2 | 4 | 4 | 4 | 4 |
| CTX | 0.12 | 0.12 | 0.12 | 0.12 | 16 | 16 | 16 | 8 | >32 | >32 | >32 | >32 |
| FEP | 0.12 | 0.12 | 0.12 | 0.06 | 2 | 2 | 2 | 1 | >32 | >32 | >32 | >32 |
| CPO | 0.12 | 0.12 | 0.12 | 0.06 | 4 | 4 | 2 | 2 | >32 | >32 | >32 | >32 |
| ATM | 0.12 | 0.12 | 0.12 | 0.12 | 16 | 16 | 16 | 16 | 16 | 16 | 16 | 16 |
| IPM | 0.25 | 0.5 | 0.25 | 0.06 | 4 | 4 | 0.5 | 0.25 | 8 | 8 | 1 | 0.5 |
| MEM | 0.06 | 0.06 | 0.06 | 0.06 | 4 | 4 | 0.5 | 0.25 | 8 | 8 | 1 | 0.5 |
AMX, amoxicillin; TIC, ticarcillin; CAZ, ceftazidime; CTX, cefotaxime; FEP, cefepime; CPO, cefpirome; ATM, aztreonam; IPM, imipenem; MEM, meropenem.
MICs of β-lactams for E. coli DH10B harboring recombinant plasmid pOXA-23, pOXA-40, or pOXA-58; E. coli DH10B reference strain harboring plasmid pAT801-RA; A. baumannii CIP 70.10 harboring recombinant plasmid pOXA-23, pOXA-40, or pOXA-58; A. baumannii CIP 70.10 reference strain harboring plasmid pAT801-RA; A. baumannii BM4547 harboring recombinant plasmid pOXA-23, pOXA-40 or pOXA-58; and A. baumannii BM4547 reference strain harboring plasmid pAT801-RA.
Expression of the carbapenem-hydrolyzing oxacillinase genes in A. baumannii.
Recombinant plasmids pOXA-23, pOXA-40, and pOXA-58 were then electrotransformed in A. baumannii CIP 70.10. High-level resistance to ticarcillin and susceptibility to ceftazidime was observed for all transformants, as expected for this type of oxacillinases (15, 23, 26). Reduced susceptibilities to imipenem and meropenem were observed for A. baumannii CIP 70.10(pOXA-23) and A. baumannii CIP 70.10(pOXA-40), and A. baumannii CIP 70.10(pOXA-58) was susceptible to these antibiotics (Table 4). Thus, OXA-58 conferred only very weak reduced susceptibilities to carbapenems once expressed in A. baumannii, by contrast to OXA-23 and OXA-40. Recombinant plasmids pOXA-23, pOXA-40, and pOXA-58 were then electrotransformed in A. baumannii BM4547, which overexpresses the efflux pump AdeABC. A. baumannii BM4547(pOXA-23) and A. baumannii BM4547(pOXA-40) had intermediate levels of resistance to imipenem and meropenem (Table 4), whereas only a slight increase of carbapenem resistance in A. baumannii BM4547(pOXA-58) was observed (Table 4). These results showed that overexpression of the AdeABC efflux pump associated with expression of these oxacillinases induced a higher level of carbapenem resistance.
These discrepancies suggested that the kinetics of these oxacillinases were more complex, since they are supposed to have similar hydrolytic activities for these substrates (15, 23, 26). Note that since blaOXA-23 and blaOXA-58 have been found in association with IS elements, it is likely that these structures provided higher levels of expression for OXA-23 and OXA-58 in A. baumannii.
Inactivation of blaOXA-40.
In order to determine the precise role of the chromosomally located β-lactamase OXA-40 in carbapenem resistance of A. baumannii CLA-1, inactivation of the blaOXA-40 gene was performed. After transformation of the pTOPO-OXA-40 recombinant plasmid into A. baumannii CLA-1 and selection on kanamycin-containing plates, A. baumannii CLA-1 (ΔOXA-40) was obtained. We checked that A. baumannii CLA-1 (ΔOXA-40) did not express OXA-40 by isoelectric focusing compared to results obtained with culture of A. baumannii CLA-1. A culture extract of A. baumannii CLA-1 subjected to isoelectric focusing gave two β-lactamases with pIs of 8.6 and 9.4, which correspond to the pIs of OXA-40 and AmpC, respectively, whereas a culture extract of A. baumannii CLA-1 (ΔOXA-40) gave only one β-lactamase with a pI of 9.4, which corresponds to the pI of AmpC (data not shown). Inactivation of the blaOXA-40 gene resulted in susceptibility to carbapenems (Table 3), thus showing the contributive role of OXA-40 in carbapenem resistance. This result was confirmed, as resistance to carbapenems was restored in A. baumannii CLA-1 (ΔOXA-40) (pOXA-40) by complementing the phenotype with the expression of OXA-40 (Table 3).
Conclusion.
This study demonstrated that carbapenem-hydrolyzing oxacillinases contribute significantly to resistance to carbapenems in A. baumannii. A. baumannii transformants with natural plasmid pFER or pMAD, producing either β-lactamase OXA-23 or OXA-58, had higher levels of carbapenem resistance than A. baumannii transformants with recombinant plasmid pOXA-23 or pOXA-58 producing the same oxacillinase. Thus, in vivo association of blaOXA-23 and blaOXA-58 genes with insertion sequence elements ISAba1 and ISAba3, respectively (10, 26, 29), were likely responsible for their higher levels of expression in A. baumannii by providing strong promoter sequences. Finally, overexpression of efflux pump AdeABC of A. baumannii contributed significantly to the high level of resistance to most β-lactams, including carbapenems. Further work may determine whether this effect is direct or indirect through changes of outer membrane proteins.
Acknowledgments
This work was funded by a grant from the Ministère de l'Education Nationale et de la Recherche (UPRES-EA3539) and Université Paris XI, Paris, France, and by the European Community (6th PCRD, LSHM-CT-2003-503-335). L.P. is a researcher from the INSERM, Paris, France.
REFERENCES
- 1.Afzal-Shah, M., N. Woodford, and D. M. Livermore. 2001. Characterization of OXA-25, OXA-26, and OXA-27, molecular class D β-lactamases associated with carbapenem resistance in clinical isolates of Acinetobacter baumannii. Antimicrob. Agents Chemother. 45:583-588. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Aubert, D., L. Poirel, J. Chevalier, S. Léotard, J.-M. Pagès, and P. Nordmann. 2001. Oxacillinase-mediated resistance to cefepime and susceptibility to ceftazidime in Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 45:1615-1620. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Bergogne-Bérézin, E., and K. J. Towner. 1996. Acinetobacter spp. as nosocomial pathogens: microbiological, clinical, and epidemiological features. Clin. Microbiol. Rev. 9:148-165. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Bou, G., G. Cervero, M. A. Dominguez, C. Quereda, and J. M. Martinez-Beltran. 2000. Characterization of a nosocomial outbreak by a multiresistant Acinetobacter baumannii strain with a carbapenem-hydrolyzing enzyme: high-level carbapenem resistance in A. baumannii is not due solely to the presence of β-lactamases. J. Clin. Microbiol. 38:3299-3305. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 5.Bou, G., and J. Martinez-Beltran. 2000. Cloning, nucleotide sequencing, and analysis of the gene encoding an AmpC β-lactamase in Acinetobacter baumannii. Antimicrob. Agents Chemother. 44:428-432. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Bou, G., A. Oliver, and J. Martinez-Beltran. 2000. OXA-24, a novel class D β-lactamase with carbapenemase activity in an Acinetobacter baumannii clinical strain. Antimicrob. Agents Chemother. 44:1556-1561. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Brown, S., C. Bantar, H. K. Young, and S. G. Amyes. 1998. Limitation of Acinetobacter baumannii treatment by plasmid-mediated carbapenemase ARI-2. Lancet 351:186-187. [DOI] [PubMed] [Google Scholar]
- 8.Brown, S., H. K. Young, and S. G. Amyes. 2005. Characterisation of OXA-51, a novel class D carbapenemase found in genetically unrelated clinical strains of Acinetobacter baumannii from Argentina. Clin. Microbiol. Infect. 11:15-23. [DOI] [PubMed] [Google Scholar]
- 9.Clark, R. B. 1996. Imipenem resistance among Acinetobacter baumannii: association with reduced expression of a 33-36 kDa outer membrane protein. J. Antimicrob. Chemother. 38:245-251. [DOI] [PubMed] [Google Scholar]
- 10.Corvec, S., N. Caroff, E. Espaze, C. Giraudeau, H. Drugeon, and A. Reynaud. 2003. AmpC cephalosporinase hyperproduction in Acinetobacter baumannii clinical strains. J. Antimicrob. Chemother. 52:629-635. [DOI] [PubMed] [Google Scholar]
- 11.Dalla-Costa, L. B., J. M. Coelho, H. A. Souza, M. E. S. Castro, C. J. N. Stier, K. L. Bragagnolo, A. Rea-Neto, S. R. Penteado-Filho, D. M. Livermore, and N. Woodford. 2003. Outbreak of carbapenem-resistant Acinetobacter baumannii producing the OXA-23 enzyme in Curitiba, Brazil. J. Clin. Microbiol. 41:3403-3406. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Donald, H. M., W. Scaife, S. G. Amyes, and H. K. Young. 2000. Sequence analysis of ARI-1, a novel OXA β-lactamase, responsible for imipenem resistance in Acinetobacter baumannii 6B92. Antimicrob. Agents Chemother. 44:196-199. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 13.Gehrlein, M., H. Leying, W. Cullmann, S. Wendt, and W. Opferkuch. 1991. Imipenem resistance in Acinetobacter baumannii is due to altered penicillin binding protein. Chemotherapy 37:405-412. [DOI] [PubMed] [Google Scholar]
- 14.Héritier, C., A. Dubouix, L. Poirel, N. Marty, and P. Nordmann. 2005. A nosocomial outbreak of Acinetobacter baumannii isolates expressing the carbapenem-hydrolyzing oxacillinase OXA-58. J. Antimicrob. Chemother. 55:115-118. [DOI] [PubMed] [Google Scholar]
- 15.Héritier, C., L. Poirel, D. Aubert, and P. Nordmann. 2003. Genetic and functional analysis of the chromosome-encoded carbapenem-hydrolyzing oxacillinase OXA-40 of Acinetobacter baumannii. Antimicrob. Agents Chemother. 47:268-273. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Hunger, M., R. Schmucker, V. Kishan, and W. Hillen. 1990. Analysis and nucleotide sequence of an origin of DNA replication in Acinetobacter calcoaceticus and its use for Escherichia coli shuttle plasmids. Gene 87:45-51. [DOI] [PubMed] [Google Scholar]
- 17.Joly-Guillou, M. L., E. Bergogne-Berezin, and J. F. Vieu. 1990. Epidemiology of Acinetobacter and resistance to antibiotics at hospitals. A 5-year evaluation. Presse Med. 19:357-361. [PubMed] [Google Scholar]
- 18.Kieser, T. 1984. Factors affecting the isolation of CCC DNA from Streptomyces lividans and Escherichia coli. Plasmid 12:19-36. [DOI] [PubMed] [Google Scholar]
- 19.Lopez-Otsoa, F., L. Gallego, K. J. Towner, L. Tysall, N. Woodford, and D. M. Livermore. 2002. Endemic carbapenem resistance associated with OXA-40 carbapenemase among Acinetobacter baumannii isolates from a hospital in northern Spain. J. Clin. Microbiol. 40:4741-4743. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Marchand, I., L. Damier-Piolle, P. Courvalin, and T. Lambert. 2004. Expression of the RND-type efflux pump AdeABC in Acinetobacter baumannii is regulated by the AdeRS two-component system. Antimicrob. Agents Chemother. 48:3298-3304. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Naas, T., Y. Mikami, T. Imai, L. Poirel, and P. Nordmann. 2001. Characterization of In53, a class 1 plasmid- and composite transposon-located integron of Escherichia coli which carries an unusual array of gene cassettes. J. Bacteriol. 183:235-249. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 22.National Committee for Clinical Laboratory Standards. 2003. Methods for dilution antimicrobial susceptibility tests for bacteria that grow aerobically, p. 1. Approved standard M7-A6. NCCLS, Wayne, Pa.
- 23.Paton, R., R. S. Miles, J. Hood, and S. G. B. Amyes. 1993. ARI-1: β-lactamase mediated imipenem resistance in Acinetobacter baumannii. Int. J. Antimicrob. Agents 2:81-88. [DOI] [PubMed] [Google Scholar]
- 24.Philippon, L. N., T. Naas, A.-T. Bouthors, V. Barakett, and P. Nordmann. 1997. OXA-18, a class D clavulanic acid-inhibited extended-spectrum β-lactamase from Pseudomonas aeruginosa. Antimicrob. Agents Chemother. 41:2188-2195. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Poirel, L., D. Girlich, T. Naas, and P. Nordmann. 2001. OXA-28, an extended-spectrum variant of OXA-10 β-lactamase from Pseudomonas aeruginosa and its plasmid- and integron-located gene. Antimicrob. Agents Chemother. 45:447-453. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Poirel, L., S. Marqué, C. Héritier, C. Segonds, G. Chabanon, and P. Nordmann. 2005. OXA-58, a novel class D β-lactamase involved in resistance to carbapenems in Acinetobacter baumannii. Antimicrob. Agents Chemother. 49:202-208. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 27.Poirel, L., and P. Nordmann. 2002. Acquired carbapenem-hydrolyzing β-lactamases and their genetic support. Curr. Pharm. Biotechnol. 3:117-127. [DOI] [PubMed] [Google Scholar]
- 28.Sambrook, J., and D. W. Russell. 2001. Molecular cloning: a laboratory manual, 3rd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
- 29.Segal, H., E. C. Nelson, and B. G. Elisha. 2004. Genetic environment of ampC in an Acinetobacter baumannii clinical isolate. Antimicrob. Agents Chemother. 48:612-614. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Urban, C., E. S. Go, K. S. Meyer, N. Mariano, and J. J. Rahal. 1995. Interactions of sulbactam, clavulanic acid and tazobactam with penicillin-binding proteins of imipenem-resistant and -susceptible Acinetobacter baumannii. FEMS Microbiol. Lett. 125:193-197. [Google Scholar]
- 31.Walsh, T. R., M. A. Toleman, L. Poirel, and P. Nordmann. 2005. Metallo-β-lactamases: the quiet before the storm? Clin. Microbiol. Rev. 18:306-325. [DOI] [PMC free article] [PubMed] [Google Scholar]